Ifyoucanreadthis,youspendtoomuchtimefiguringouttaglines.
IneedsignificantlymoreroominthislineforwhatIwanttosay.
Vote anarchist.
What hallucinations?
Abolish mornings.
Xpress yourself.
Snails' pace: .00758 mph.
Never say "oops."
Binary Choir = 1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1o1.
Let length(walk) > length(pier)
Friction is a drag.
Necessity is a mother.
Everybody lies about sex.
Play it, again Sam.
Murphy was an optimist.
Shareware, crippleware, annoyware, underwear.
Another day, another challenge.
Hairy fishnuts, anyone?
Et in Arcadia ego.
Avoid Mailmen...............They Are Carriers.
As easy as 3.1415926535897932384626433832795028841.
Kiss my ASCII.
DANGER. Human at keyboard.
Familiarity breeds attempt.
Innuendo can be fun.
Save energy: be apathetic.
Results may be unpredictable.
Look out.  Behind you.
Trackman(men) have bigger balls.
Happiness can't buy money.
Dollars cannot buy yesterday.
Halt and catch fire.
Down with categorical imperatives.
When in charge, ponder.
Whatsa matter Colonel Sanders.......CHICKEN?
Pants: Trousers' country cousins.
Here today, dawn tomorrow.
"Nietzsche is dead,"   God.
Biochemists wear designer genes.
The butler did it.
Wie geht's dir heute?
What's up doc?
DEL *.*     Does WHAT?
Nice computers don't crash.
When in doubt, mumble..
When in doubt; Cheat.
Save trees, eat beavers.
Live better, electrically.
"Once,"  adv.:  Enough.
Classified tagline==Please enter password._
Optimization hinders evolution.
Look.  A flying porpoise.
This bug's for you.
Farfrompoopin...German word for constipation.
It works for me.
Lets keep genealogy vital.
Garbage in, Gospel out.
J'suis le Grand Zombie.
"Isn't everybody happy?" - Machiavelli
Don't steal.....Politicians hate competition.
Even weeds have needs.
Paranoia is heightened awareness.
Hero-worship: Idol gossip.
Abort, Retry, Ignore, Valium?
Batteries not included.
Dulce bellum inexpertis.
Outside noisy, inside empty.
Cynicism is intellectual dandyism.
Big Brother is watching.
Common sense is uncommon.
Common sense isn't.
Nobody's seen it all.
Ambition destroys its possessor.
Documentation:  The last resort.
He who laughs, lasts.
Fat heads, lean brains.
Rumors love lies.
Nothing recedes like success.
Nothing succeeds like failure.
Life is like......an analogy.
LAMA=priest.  LLAMA=beast.  LLLAMA=conflagration.
UNIX are lousy lovers.
Your mileage may vary.
Organic:  Church music.
Typos? Blame my cat.
No decorations necessary.
Excess is never enough.
Have a nice day.
Carasvemos, corazones no sabemos.
This tagline no verb.
Avoid The Noid.
Read messages, not taglines.
Condense soup, not books.
Other times, other customs.
Programmers get overlaid.
Parts is parts.
Practiss maks perfict.
Florist: A petal pusher.
Non omnia possumus omnes.
Do blondes prefer gentlemen?
Void where prohibited.
All answers questioned here.
Dermatologists give rash judgments.
Is wetter REALLY better?
Some assembly required.
Kleptomaniac: A rich thief.
Heads will roll.
Rules?  What rules?
Windows, Just Say No.
UART?.. Me Science?
Skeptics are seldom deceived.
The cautious seldom err.
Love is sentimental measles.
Tablet:  A small table.
Misery brings strange bedfellows.
Bedfellows make strange politicians.
Facts are stubborn things.
Good cooking takes time.
The stranger, the better.
Say "No," then negotiate.
Suppress that thought.
Time takes time.
Press <CTRL>+<ALT>+<DEL> to continue.
Happy trails to you.
Cedant arma togae.
When in trouble, delegate.
Originality is undetected plagiarism.
Constants aren't; variables don't.
C'est la vie.
Chicken Little was right.
Chaste makes waste.
In DOS we trust.
"I drank WHAT!?" - Socrates
NAK NAK... Who's there?
Have stock?  Will broker.
Gravity always wins.
Metaphors be with you.
I just work here.
Teleportation affects your orientation.
Submitted for your approval.
Mister!  Here's your mule.
Time on your hands? . . . get Windows.
It's only a hobby ... only a hobby ... only a.
I've had BETA days ... and nights.
Memory overload error noted ... Meltdown now evident.
If it feels good .... Do It.
The dog ate my .REP packet.
Syntax Error in KITCHEN.H : COFFEE not found.
Congenital: Adjective synonymous to "friendly."
Boldly start in reverse, 'cause that's the genealogy way.
How come they call 'em APARTments when they're attached?
Where do 'cannot' and 'must' meet on this graph?
USAir = (U)nderwater (S)eating (A)vailable (I)n (R)ear.
IBM at times means (I)ncredibly (B)otched (M)achines.
ROM instruction: (R)ead (O)perators (M)ind.
General Brain Failure.  (A)bort, (R)etry, (I)gnore, (O)h.
SCUD : (S)ure (C)ould (U)se (D)irections.
Don't blame Congress. With $600 Billion frugality leaves.
Windows 3.0 - The best $89 solitaire game you can buy.
The question is: "(2 * B!) OR NOT(2 * B!)"
File not found.  Delete *.* and change directory? (Y/N)_
Don't you know where *your* towel is?
NAK NAK  who's there?  ^A!@#$%^B&*()^Z NO CARRIER.
"Beam me aboard Scotty!" <-> "Will a 2 X 4 do Captain?"
Keyboard not connected, press <F1> to continue.
A ounce of pretension = a pound of manure.
And God said: E = mv - Ze/r ...and there *WAS* light.
That tagline is TRUE ->  <- That tagline is FALSE.
For some: know God & know peace/others: no God & no peace.
Help.  I'm trapped at 0D1C:01DA.
E = mc  2 dB.
Year: A period of 365 failures and disappointments.
"Build a watch in 56,179 easy steps" by C. Forsberg.
10... 9... 8... 7... 6... (Bo Dereck getting older).
Herman Hollerith is buried 9 edge, face down.
2 x 4 bbs - a basic board.
A book, a friend, a song, a glass, a chaste loving lass.
Never call a man a fool, instead, borrow from him.
He who always plows a straight furrow is in a rut.
Santa's elves are just a bunch of subordinate Clauses.
Only in baseball is a self-sacrifice appreciated.
Always store beer in a cool dark place.
Modem sex begins with a handshake.
ROM wasn't built in a day.
Even a cactus needs a little water now and then.
Only God can make a random selection.
No medicine can cure a vulgar person.
Blaming others can become a satisfying way of life.
Fiction: It can't hold a scandal to biography.
If you cannot catch a bird of paradise, grab a wet hen.
My other car is a Galaxy Class Starship, need a ride?
I was changed into a tadpole.  I knew about methmorphosis.
My other computer is a Cadillac.
Nothing's more dangerous than a mind with a solitary idea.
She is descended from a line that her mother listened to.
Two writes don't make a novel.
Humpty Dumpty DOS - Just a shell of himself.
When in doubt, make a backup.
Silence is evidence of a superb command of the language.
All that glitters has a high refractive index.
I must have slipped a disk -- my pack hurts.
To love her was a liberal education.
Artistic ventures highlighted.  Rob a museum.
You realize how short a month when you pay alimony.
Homo sum; humani nihil a me alienum puto.
Where can I fnid a spell chequer for taglines?
Whad'ya mean I need a license to do that?
Back when I was a boy, we carved our own ICs out of wood.
Abort, Retry, Ignore, plan a Funeral Service?
I'm as innocent as a new-laid egg.
Repartee: An insult with a suit and tie on.
The cinema is not a slice of life but a piece of cake.
The city is not a concrete jungle.  It is a human zoo.
The consumer is not a moron, it is your spouse.
A crappie is not a sunfish found in a toilet.
The earth is like a tiny grain of sand, only heavier.
The earth is like a tiny grain of sand, only much heavier.
A father is usually a banker provided by nature.
If life is just a bowl of cherries, throwing pits is OK.
My mind is like a blotter: Soaks it up, gets it backwards.
A mother is not a dust rag.
The world is like a cactus except the pricks are inside.
Seismologists do it to a fault.
Don't force it, get a larger hammer.
Communication.. without it, everyone's a mushroom.
Is a Jamaican terminal a Rastafarian?
Thousands of journeys have a start but no end.
A little knowledge is a dangerous thing.
Rise from life as a banquet, neither thirsty nor drunken.
We all live in a yellow subroutine.
That concept looks like a chicken in a windstorm.
If Old MacDonald had a computer, it uses Eee-aye-eee I/O.
Sin has many tools, a lie is only handle for them all.
Smile you may meet a person who will play with your life.
An attacker must vanquish, a defender need only survive.
A woman must be a genius to create a good husband.
Age needn't necessarily be a bar to immaturity.
Tabloid: A newspaper with a permanent crime wave.
Politics: When one makes a decision that involves others.
If youth only had a chance or old age any brains.
Too many pages make a tome.
Hardware:  The parts of a computer that can be kicked.
A bonded penguin is a happy penguin.
Zippy the pinhead is a twit
Save the plankton - eat a whale.
A jerk present in a group indicates a jerk in charge.
Put off procrastinating until a later time.
Every huge program has a small program trying to get out.
Is it progress if a cannibal uses a knife and fork?
Any IC protected by a fast acting fuse protects the fuse.
ASCII stupid question, get a stupid ANSI.
A Robin redbreast in a cage puts all heaven in a rage.
Endocannibalism: The result of a really hungry cannibal.
A dime saved is a dollar earned. The rest is Uncle Sam's.
A penny saved is a Congressional oversight.
A statesman shears sheep, a politician skins them.
The past should be a mental springboard - not a hammock.
Do not sleep in a eucalyptus tree tonight.
Give a small boy a hammer and everything needs pounding.
For the Snark *was* a Boojum, you see.
Beneath every stone sleeps a scorpion.
Good architecture takes on a life of its own.
What if they gave a war and only one side came? 
There's bound to be a gargoyle here somewhere.
Fine day to throw a party.  Throw him as far as you can.
Excellent day to have a rotten day.
Excellence is to do a common thing in an uncommon way.
Life is to you a dashing and bold adventure.
Always remember, to copy a disk is not to Xerox it.
Excellent time to become a missing person.
Best way to appreciate a job: imagine yourself without it.
One way to stop a run away horse is to bet on him.
Bank Rule: To get a loan, first prove you don't need it.
Hollywood: A trip through a sewer in a glass bottom boat.
To be trusted is a greater compliment than to be loved.
Don't worry.  We're on a mission from God.
Let he who takes a Monday plunge return it by Tuesday.
Of all wild beasts, a boy is the most difficult to tame.
Recent investments will yield a slight profit.
The living world is a continuum in each and every aspect.
If you would keep a secret from an enemy, tell nobody.
Retirement: when you get a certificate of depreciation.
DOES ANYBODY KNOW WHAT A 'cAPS lOCK' KEY IS?
Beware of little expenses. A small leak can sink a ship.
Stick \'stik\ n. 1: A boomerang that doesn't work
Gun control is being able to hit your target.
I'm just needling you about the thread.
Kids? Who said anything about kids?
Autobiography: Unrivalled telling truth about others.
Is relativism the only absolute?
Only he attempting the absurd can achieve the impossible.
The devil falls on account of his gravity.
AAAAA: American Association Against Acronym Abuse.
Wise men in love act the fool.
If this were an actual tagline, it could be funny.
Quien con perros se acuesta con pulgas se levanta.
Unless to thought is added will, Apollo is an imbecile.
It is easier to admire hard work if you don't do it.
While eating an elephant advance one bite at a time.
Sysoping, not just an adventure, sometimes it's emesis.
Marriage is the only adventure open to the cowardly.
I saw a subliminal advertising executive for a second.
Asking PAC BELL for advice is like asking IRS tax advice.
If you want my advice, pay me.
Shake well before and after use.
Watch out..the paranoids are after you.
Life: You peel layer after layer, you find nothing in it.
It always rains right after I wax philosophical.
Benign: What you are after you be eight.
Spring makes everything young again except humans.
What youth deemed crystal, age finds was dew.
If things improve with age, I'm nearly magnificent.
Middle age: When your age starts to show at your middle.
Nobody can be as agreeable as an uninvited guest.
To know the road ahead, ask those coming back.
DANGER DANGER Computer store ahead...hide wallet.
If DOS was an airline, would you purchase a ticket?
One of these days, Alice, one of these days.
It's 5PM and I'm all out of pithy things to say.
Without love and trust all you can be in life is alone.
All clowns are masked, all personae flow from choices.
If you bow at all, bow low.
So where did we all come from? Stop acting like a monkey.
Nobody has ever learned all of WordPerfect.
Thank you for observing all safety precautions.
I finally got it all together, but forgot where I put it.
How come I get all the hard questions?
Logic is logic. That's all I say.
UNIX, the MF of all DOS's.
Manuals come out, after all possible keystrokes fail.
Th-th-th-that's all, folks.
Nobody could ever learn ALL of WordPerfect!
Teamwork is essential it allows you to blame someone else.
God gave burdens shoulders also.
Progress is made on alternate Fridays.
Of all thirty-six alternatives, ignoring it is best.
Man is a fool, always wanting what is not.
Closed eyes are not always sleeping.
Claiming mental bankruptcy is always an easy option.
Even hairless heiresses are always beautiful.
The show-off is always shown-up in a show-down.
Confucius say: Show-off always shown up in showdown.
With consequences,  the unexpected always predominate.
Age and treachery can always overcome youth and skill.
A worthless wise man always charms the rabble.
To the Caliph I am dirt, but to dirt, I am Caliph.
I think, therefore I am (or am I?).
I think, therefore, I am single.
Even the happiest of amoebae lack sexual organs.
The less a statesman amounts to the more he loves a flag.
Celebrate Hannibal Day.  Take an elephant to lunch.
Virtue is easy for an ugly woman.
If you ever have an idea, try to go with it.
Even a hawk is an eagle among crows.
It's not how much an item costs, it's how much you save.
No answer is also an answer.
Most free items find an eager waiting user.
Avoid junk mail, get an unlisted ZIP code.
We walk on like an elephant and back off like a giraffe.
Kibitzer: A person with an interferiority complex.
For some, reality is an illusion.
Tumor: A request for an extra pair.
A family reunion is an effective form of birth control.
Sorry, can't think of an insult stupid enough for you.
Each of us contains an element of insanity.
Do not wait for an echo when you drop a rose petal.
A hen who lays an egg cackles as if it was an asteroid.
Do I even WANT ancestors? Some I wish I could lose.
If A = B and B = C, then A = C, except where void.
X minus 6 weeks and counting.
Morality is a private and costly luxury.
Reality: Only a concept and the home of the brave.
It was a dark and stormy night.
I am always exact and precise (more or less).
Life is an onion and each one peels it crying.
Cyberspace forever and ever and ever.
Split hairs any finer and you'll end up with split ends.
Charity begins at home, and mostly ends where it begins.
Cow's breath attracts mosquitoes and tsetse flies!
Boys will be boys, and so will a lot of middle-aged men.
Some rise by sin and some by virtue fall.
If you do drink and drive you might as well smoke too.
Eat healthy, exercise daily, and die young anyway.
Politics: The glad hand and the marble heart.
What the hell, go and put all your eggs in one basket.
Mountains culminate in peaks, and nations in people.
All's fair in love and war - What a contemptible lie.
After all is said and done, usually more is said than When
If everybody knows such-and-such, then it just ain't so.
Take your levity whenever and wherever you can find it.
Sleep warm, love well and carry a big stick.
A fool must now and then be right by chance alone.
A deluge of words and drop of sense.
Help stamp out, eliminate and abolish redundancy.
I am perfectly sane, and so am I.
Let the rain fall, and fall, and fall.
Your best response: Seethe and fume and throw a tantrum.
Say the secret word and this duck is yours.
Every woman should marry -- and no man.
Prosperity makes some friends and many enemies.
Get me some coffee and then ask me in ten minutes.
Think much, speak little, and write less.
Cats, proof that eating and sleeping isn't all bad.
Adam ate the apple, and our teeth still ache.
Honey in the mouth and knives in the heart.
Give me the luxuries, and to hell with the necessities.
Users: Keep them dry and don't feed them after midnight.
Let's win this one and go home.
Ever stop to think and forget to start again?
Know when to fight and when to run.
Teenager: Having tunnel vision and selective hearing.
We have two ears and one tongue, use them likewise.
What you want, must, and need to do are seldom congruent.
Stick to your talent and the cows will be well tended.
You tell 'em June, And don't July.
I am not an animal!  I am what I am, but not an animal.
Rainforest: a scarcity of animals a plethora of tourists.
One person's bug is another person's feature.
No, I'm not just another extended character.
No person should govern another without their permission.
One man's theology is another man's belly laugh.
Press  +  to see another tagline.
One person's <grin> is another's <groan>.
Sex is not a answer. Sex is a question. Yes is the answer.
Every time I have answers, someone changes questions.
The course of true anything never does run smoothly.
If you play with anything long enough it will break.
I can resist everything/anything except temptation.
43rd Law of Computing:  Anything that can go wrong, will.
I'm flexible..just don't change anything.
What's in a name, anyway? Everything and nothing.
What is this thing anyway? The Discordian Society?
Everything put together falls apart sooner or later.
I would strongly oppose apathy, if I cared. 
Money is a good aphrodisiac. Flowers work almost as well.
This tagline is umop apisdn.
A good angle to approach any problem is the try-angle.
Every person is the architect of their own fortune.
At all ages you are certain you still have another year.
93.4% of all statistics are made up.  The rest are false.
43% of all statistics are totally worthless..
Your Yin and Yang are no longer on speaking terms.
My opinions expressed above are not necessarily mine.
Nothing is foolproof, idiots are too ingenious.
Beware of friends who are false and deceitful.
Both of his feet are firmly planted in the air.
Mistrust first impulses, they are always good.
Minnie and Mickey Mouse are slow maze learners.
Pi are round. Cornbread are square.
I love standards, there are so many of them!
And all the children are above average in our system.
With clothes the new are best, with friends the old.
All of the stars are to be found only up in the sky.
Varicose veins: Veins that are very close together.
Too many wild asses are not yet extinct.
Some are wise; others are otherwise....
Only in your dreams are you really free.
Money is like an arm or leg - use it or lose it.
I'd give my right arm to be ambidextrous.
Protect your right to arm bears
There's never a cop around when you need one.
When someone turns things around, don't get run over.
What comes around goes around.
These days there's no arrest for the wicked.
Do artificial plants need artificial water?
A living example of Artificial Intelligence.
If thou is a artist, how does one grasp your art?
I am as poor as Job, but not so patient. - Shake.
Nobody is as deaf as those who will not to hear.
Nothing is as easy as it looks.
Everything should be made as simple as necessary.
Some people grasp stupidity as though it were a virtue.
As lacking in privacy as a goldfish.
Nothing is more believed as that known least by the most.
Things are not always as they seem.
A wise person sees as much as ought, not as much can.
There's no such thing as gravity.  The whole world sucks.
I know the answer, as long as you ask the right question.
I'm making this up as I go along.
Pro is to con as progress is to Congress.
Rap is to music as Etch-A-Sketch is to art.
All great truths began as blasphemies.
Human Being: An ingenious assembly of portable plumbing.
Alone in a bank at night is a pleasant experience.
Everyone is a genius at least once a year.
Fishing rod: a hook at one end, a fool at the other.
I saw a light at the end of the tunnel - it was a train.
Some people can't succeed at anything, even suicide.
If you can't laugh at yourself, try laughing at others.
Shareware author dies:  .GIF at eleven.
If it isn't true, at least it is a happy invention.
Silence is more eloquent at times than words.
There are no answers at best a few possibly good guesses.
Everyone meets their Waterloo at last.
Mars needs women, apply at NASA.
Every noble work is at first impossible.
Everything goes wrong all at once.
Hmmmmm.... never tried an atomic bomb before.
In case of atomic attack, prayer in schools will be OK.
I believe we're under attack, but I'm not too sure.
I've got a BEER attitude.
Prsentez toujours le devant au monde.
Comment vous sentez-vous aujourdn'hui?
Forget  RTFM  - Call the author at home.
I'm writing an unauthorized autobiography.
A tidal wave of avalanche proportions.
Plan to throw one away.  You will anyhow.
We hired you to baby sit. You cooked and ate them both?
Sherman, set the Way-Back Machine for 1492.
Taglines are almost as bad as bumper stickers.
Old age isn't so bad when you consider the alternative.
Lost interest? It`s so bad I`ve lost apathy.
Not to know is bad, but not to wish to know is worse.
Lend money to a bad debtor and he will hate you.
Good girls get Heaven; Bad girls, the world.
Every anarchist is a baffled dictator.
Modesty is a good bait when fishing for praise.
He walks as if balancing the family tree on his nose.
Tennis players have fuzzy balls.
No wanna work.  Wanna bang on keyboard.
G.I. Series: A military baseball game.
Love is like a baseball game, three strikes you're out.
Love is like a baseball game, four balls and you walk.
Hollywood is like Picasso's bathroom.
If this is a battle, then you have already lost.
Since prehistoric man, no battle has ever gone as planned.
Pessimism never won a battle.
Don't regulate banks.  Help BCCI and Charlie Keating.
Gen. Custer, can I be excused for this afternoon?
It's often cheaper to be forgotten than remembered.
It is easy to be wise after the event.
RTFM?  You've got to be kidding.
This contest has to be the dumbest thing I've ever seen.
Something will have to be done, something irresponsible.
Something would have to be done... something Sometimes a I
A bleeding heart can be hell on the carpeting.
A simple idea will be worded in the most complicated way.
World War IV will be fought with sticks and stones.
Judge not, lest ye be judged incompetent by the world. 
It's bad luck to be superstitious.
I be nibble, you be quick, he jump over the joystick.
A red nose can be the result of sunshine or moonshine.
Remember, one shoe cannot be a pair.
It was supposed to be so easy.
Are we supposed to be having fun yet?
Without creation there could be no destruction.
Without fools there would be no wisdom.
If you try to be too sharp, you will cut yourself.
I don't want to be there when it's time for me to die. 
Whatever advice you give, be brief.
Kindergarten Rules: Be kind. Be safe. Be protective.
Succumb to natural tendencies.  Be hateful and boring.
THIS TAGLINE NOT TO BE REMOVED UNDER PENALTY OF LAW.
God said,  Let Newton be!  and all was light.
What fools these morals be!
Go to a nude beach. Keep abreast of developments.
The weed of crime bears bitter fruit.
My mail reader can beat up your mail reader.
A Smith & Wesson beats four aces every time.
The world is a beautiful book, for those who can read it.
The law hath not been dead, though it hath slept.
All things are difficult before they are easy.
Hick: Looks both ways before crossing a one-way street.
Poker: It's darkest just before you've drawn.
Keep your eyes open before marriage, half-shut afterwards.
Things will get worse before they get better, if they do.
You must know much before you know how little you know.
Earth was not earth before her sons appeared.
If wishes were money, beggars would be choosers.
To reform a man, begin with his grandmother.
Gezundteit has a loose beginning.
The universe is laughing behind your back.
Sysoping: More fun than being beaten with a sledgehammer.
Accuracy:  The vice of being right.
2+2=4 (for the time being).
Everybody should believe: I believe I'll have a drink.
It is hard to believe that even his friends like him.
Marriages are based on believing you won the arguments.
You tell 'em Church Bell, I told you.
All your future lies beneath your hat.
If it screams, it's best not to eat it.
Life is still in Beta test.
The past always looks better than it was when it was here.
Living on earth is better than loafing around Hades.
5  floppy is not better than 3  hard.
Brain, like muscle, works better if regularly exercised.
A good scare is better than good advice.
Couldn't have sid it better myself.
It is so much better to live rich than to die rich.
A rolling stone is better than a bird in the hand.
Never appeal to his better nature.  He may not have one.
Half Moon tonight -- its better than no Moon at all.
An accommodating vice is better than an obstinate virtue.
Detour: The roughest distance between two points.
Never mind the dog, beware of the owner & fecal deposits.
Don't think too far beyond your next meal.
There were computers in Biblical times. Eve had an Apple.
Irony: Giving father a billfold for Christmas.
It is the wise bird who builds his nest in a tree.
Everything in time is birth to some and death to others.
Tact: Recalling a lady's birthday but forgetting her age.
if (program == crippleware)  bit-bucket(program).
Mother nature is a bitch.
I'm just another blankity-blank BLANK.
If your mind goes blank, remember to turn down the sound.
This space intentionally left blank.
Dime de lo que blasonas, y te dire de lo quwe careces.
Length of an average blink: 0.1 second.
It runs in the blood like wooden legs.
Old computers make great boat anchors.
You tell 'em Hard-Boiled Egg, you're hard to beat.
Adam's Rib: The original bone of contention.
You can't judge a book by the way it wears its hair.
I used to read books.  Now I read .qwk files.
I've given up reading books. It takes my mind off myself.
Spongecake:  Dessert made of borrowed ingredients.
Forgotten men at the bottom of the economic pyramid.
Freedom is a hard-bought thing - A gift no man can give.
My reality check just bounced.
Life is just a bowl of chili, but no beans for you.
Resist being put into boxes.
Home, to a young boy, is merely a filling station.
Practice safe algebra, use brackets.
David Duke: Sheet for brains.
Trust your neighbors, but brand your cattle.
Once more into the breach.
Get someone else to break the shrink wrap.
Orthopedists get all the breaks.
[... text deleted for brevity ...]
What a day may bring, a day may take away.
A good tree cannot bring forth evil fruit.
When in doubt, use brute force.
Some days you're a bug, other days a windshield.
There's always one more bug.
Elvis hasn't left the building, he's just in the john.
Hobo: A person who builds palaces and lives in shacks.
An elephant: A mouse built to government specifications.
It is better to burn out than to fade away.
Even the smallest candle burns brighter in the dark.
A bird in the bush can't make a mess in your hand.
One Buchanan beats a Bush hiding a Quayle any day.
These are the George Bush times that try men's soles.
I'm in the computer business, I make Out-Of-Order signs.
What is a lie but the truth in drag?
I'm not a D.J., but I play one on the radio.
Time heals all wounds, but the belly button remains.
Young gorillas are friendly, but they soon learn.
Glory may be fleeting, but obscurity is forever.
You may be Southern -- but you're no Comfort.
Money can't buy happiness, but allows a choice of misery.
A rooster clucks defiance -- but a lawyer.
Men, in general, are but overgrown children.
Many foxes grow gray, but few grow good.
Old Grandad is dead, but his spirit live on.
A hole is nothing but you can still break your neck in it.
Life is lived forwards, but understood backwards.
Computers don't make mistakes, but foolish people do.
Chance makes our parents, but choice makes our friends.
Adversity makes people wise but not rich.
Not a real tagline, but an incredible soy substitute.
I can resist anything but temptation.
God gives the nuts, but He does not crack them.
Always remember the past, but make waves when it matters.
Actions are usually right, but the reasons seldom are.
America is a tune.  But it must be sung in harmony.
A pain in the butt may be a friend in need..
Beware of low-flying butterflies.
Man`s horizons are bounded by his vision.
We are as made by God, and often a great deal worse.
You learn as much by writing as you do by reading.
Biography should be written by an acute enemy.
I Just got stopped by the LAPD and boy am I beat.
Time: an illusion perpetrated by the makers of space.
This discussion is hanging by a thread.
America was not discovered by Americans, shame on them.
Discoveries are often made by not following instructions.
Hell, Heaven or Hoboken by Christmas.
Message brought to you by sufficient coffee indigestion.
Day-by-day a day goes by.
Someone superglued all my bytes onto my hard drive.
Cole's Law: Thinly sliced cabbage.
Instant Human: Just add caffeine, alcohol, and nicotine.
Engineers do it by calculation and design.
All mathochists suffer from calculust
Take two aspirin and call the consultant.
Firmness in politics is called obstinacy in a donkey.
Altruism is the devil's calling card.
Join Taglines Anonymous.  We can help.
A big enough hammer can usually fix anything.
Good news from afar can bring you a welcome visitor.
Murphy's Law: If anything can go wrong, it will.
Even a noseless dog can stink.
Thinking ill of someone can be a two-way street. 
Why solve problems you can bypass with a GOTO?
Redundancy is something I can do again and again.
Whatever is well conceived can be well expressed.
I like work.  I can sit and look at it for hours.
Help. I've fallen and can't get up. A. Tree.
Help.  I've fallen and can't reach my beer.
Maintainer's Motto: If we can't fix it, it ain't broke.
A hundred thousand lemmings can't all be wrong.
You can't win. You can't break even. You can't even quit.
Infinity is a self-canceling thought form.
Medical staff: A physician's cane.
You can't jump a canyon in two leaps.
hAS ANYONE SEEN MY cAPSLOCK KEY?
Just got a new car for my wife... Great trade.
I use windows...on my car, on my house, but not on my.
You tell 'em Playing Cards, you know the joker.
Real programmers use punched cards.
You cannot be too careful in the choice of your enemies.
The wife of a careless man is almost a widow.
If you think nobody cares, miss a couple of payments.
Nothing works, and nobody cares.
Beware of programmers who carry screwdrivers.
Grippe:  A suitcase for carrying flu medicines.
Does history record any case where a majority was right?
Happiness is a positive cash flow.
Must go - My attack cat needs her claws filled.
Purring....the sound of a cat manufacturing cuteness.
Be smart as a cat: Make a friend of your enemy's enemy.
It is easier to catch flies with honey than with vinegar.
Gotta run, the cat's caught in the printer.
Honesty: Fear of being caught.
Of all forms of caution, cautious love is the most fatal.
Take two crows and caw me in the morning.
The worst thing about censorship is .
There are good five-cent cigars, but they cost two bits.
Lasciate ogni speranza voi ch'entrate.
Sir Lancelot, you have chain mail in Knight's Conference.
Good day for a change of scene.  Repaper the bedroom wall.
There will be big changes for you but you will be happy.
Pedestrian: The most approachable chap in the world.
Ceci n'est pas un chapeau.
Please do not break character.
**FLASH** Eveready Bunny arrested, charged with battery.
A bachelor enjoys the chase but doesn't eat the game.
No, boars are never chauvinists.
Valuable things are not cheap.
Echo: Only thing that cheats some out of the last word.
Do witches run spell checkers?
Epitaph on a gravestone: Cheerio, see you soon.
Dan Quayle asks: "Are Cheerios are bagel or donut seeds?"
Biological love =/= chemical love.
A mother pampering a child is raising a serpent.
Man is the bad child of the universe.
Do not handicap your children by making their lives easy.
Celibacy isn't hereditary. Your children force it on you.
Lawyers, I suppose, were children once.
Bachelor's wives and spinster's children: always perfect.
Only people born with chimneys are allowed to smoke.
All the tea in china: 356,000 metric tons.
I never met a chocolate I didn't like.
Only the stupidest calves chose their own butcher.
Why would a wood chuck want to chuck wood anyway?
Curmudgeons are cantankerous and churlish.
cigar is just a cigar.
Give the man a cigar.
Flattery is counterfeit money, circulated by vanity.
Will people in the CIS be known as sissies?
People, by nature, are civic animals.
Communists do it without class.
Nobody shoots at Santa Claus.
Cleanliness is next to clean-limbed, in the dictionary.
No one can think clearly with clenched fists.
Clever father, clever daughter; clever mother, clever son.
I always did like climbing trees, is this genetic?
I always did like climbing trees. 
Did you know that clones never use mirrors?
Reading with your eyes closed may help you understand.
Laundry: A place where clothes are mangled.
Due to inflation, all clouds will now be lined with zinc.
Cross ball points with coat hangers so they multiply.
The four food groups: coffee, ice cream, beer and pizza.
A newspaper is a collection of half-injustices.
I wish I could come up with an original tagline.
To live now, first come to terms with your past.
If your ship doesn't come in, it's time you swim out.
The best water doesn't come in fancy bottles.
Where did we all come from in the first place?
World peace will only come when patriotism is forgotten.
Shhhhhh.....the topic cops are coming.
Drawing on my fine command of English, I said nothing.
People who have trouble communicating should shut up.
Misery loves company, but company does not reciprocate.
Learning makes people fit company for themselves.
And now for something completely different.
Old MacDonald had a computer with EIA I/O.
Have you hugged your computer today?
RTFM: But it's the computer manuals I hate.
Misinformation is the cruelest computer virus of all.
Noble deeds that are concealed are most esteemed.
Adversity reveals genius, prosperity conceals it.
Never test for a condition you don't know how to handle.
If facts do not conform to the theory, dispose of them.
It is dangerous to confuse children with angels.
Pragmatism should never be confused with moderation.
When all else fails, consult Jack Daniels.
Press any key to continue or any other key to quit.
Military intelligence is a contradiction in terms.
Of course I can cook, but I never do it on the first date.
Never trust a skinny cook.
Mr. Worf!  Eating Christmas Cookies, on my bridge?
It is better to copulate seldom rather than never.
I either want less corruption, a chance to participate.
Anyone can hate. It costs to love.
Avoid reality at all costs.
I never knew lasers could be printed.
America is the only country founded on a good ideal.
Often the test of courage is not to die but to live.
He bellows like a cow standing on her tit.
I'm a hero with coward's legs.
Do vegetarians eat animal crackers?
Will vegetarians eat animal crackers?
Psychoceramics: The study of crackpots.
Never sleep with anyone crazier than yourself.
People are the only creatures with the power of laughter.
Cash, a poor person's credit card.
An appeaser feeds a crocodile, hoping to be eaten last.
Subway: A place so crowded even all men can't get seats.
Whip me, beat me, crush me, is this wrestling or what?
A bear robbed of cubs is safer than the folly of fools.
Prevention is better than cure.
I just bought a cured ham.  Wonder what it had? 
It doesn't help to curse the darkness.
Wait.  That's the FORBIDDEN dance.
Beware! This is a dangerous product, manuals required.
A shot in the dark = searching for a needle in hay stack.
Do not curse the darkness, check your warranty.
<-------- The information went data way -------->
This is a good day to let down old friends who need help.
24 hours in a day and 24 beers in a case.  Hmmmm.....
Today is the first day of the rest of the mess
Today is the first day after yesterday.
And on the seventh day, He exited from append mode.
If I had two dead mousies, I'd give you one.
Who is the Grateful Dead, and why do they follow me?
Life has a great deal up its sleeve.
"Let me sweeten the deal a bit for you,"  - Beelzebub.
Why is bread so dear and flesh and blood so cheap?
God is real, unless declared integer.
Forests lovely, dark & deep ... I have promises to keep.
Any certainty is a delusion.
Justice delayed is justice denied.
None but a mule denies his genealogy.
All reality is aspect dependent.
What orators lack in depth, they give in length.
This open hand of desire wants everything.
This file will self-destruct in five minutes.
Nam homo proponit, sed Deus disponit.
That was a pointing device? My cat thought it was dinner.
I modem down, but dey grew back.
I am not a dictator.  It's just I have a grumpy face.
Madam, an error, we did a hysterectomy on your husband
Can you prove it didn't happen?
She kept saying I didn't listen to her -- or something.
Born crying, live complaining, die disappointed.
Some of us just die, others of us live on.
I wish Adam had died with all his ribs in his body.
Radical: Anyone whose opinion differs from ours.
When all else fails, dig out the dusty user's manual.
Blame Murphy when you dig at the wrong end of a rainbow.
Cats are like furry dilettanti, or the reverse?
Reality sure has unknown dimensions.
Boy:  A noise with dirt on it.
Look into yourself to discover your first priority.
All true wisdom is discovered in tag lines.
Love -- a grave mental disease.
This screen is microwave, dishwasher and fly safe.
Only the rich have distant relatives.
Cesarean Section: A historic district in Rome.
Early to rise and ditto to bed, makes you socially dead.
No bachelor files for divorce after a home-cooked meal.
Be reasonable ... Let's do it my way.
Today is a "Honey do day"  Honey do this, honey do that..
What good does it do an ass to be called a lion?
IF I had to do it over again, it would be without TV.
All I have to do is imagine, and I am in dreamland.
A thick head can do as much damage as a hard heart.
Never despair.  If you do, you will work on into despair.
What kind of cars do Proctologists drive?  Ford Probes.
Minor operation.  What workers do in a coal mine.
Genius: One who can do anything except earn a living.
Chastity Belt is here. Do you have the right key?
Dammit Jim, I'm a doctor, not a tagline writer.
I didn't get the documentation for the manuals.
Being a "nice guy" doesn't cost, but it generally pays.
Time is so everything doesn't happen at once.
It's a dog-eat-dog world, don't wear MilkBone underwear.
You've been leading a dog's life.  Stay off the furniture.
Diplomacy is saying "nice doggy" until you find a rock.
Look out for barking dogs that bite.
Cats are smarter than dogs.  They won't pull sleds.
Meetings are indispensable for doing nothing.
If it's not worth doing, it's not worth doing well.
It's stupid to continue doing what doesn't work.
The shortest answer is doing.
If at 1st you don't succeed, call it Ver. 1
If it ain't borken, don't fix it.
If it ain't cooked, don't serve it.
If you can't bite, don't try to show your teeth.
We don't care, we don't have to, we're the phone
Frankly my dear, I don't give a download. -Rhett Sysop.
If you're feeling good, don't worry.  You'll get over it.
If at first you don't succeed, you're doing average.
If at first you don't exceed, try, try again.
If at first you don't succeed, re-format.
If at first you don't succeed, destroy all evidence.
If at first you don't succeed; Blame everyone else.
If at first you don't succeed, don't be foolish, give up.
If at first you don't succeed, try something else.
If at first you don't succeed, skydiving is not for you.
If at first you don't succeed, fall back and punt.
I'm user friendly, I don't byte -- I snap.
Simple rule: If you don't treat me right, shame on you.
Network?  I'm retired, I don't do no work never.
Russian Express Card motto: Don't leave home.
all is said and done, people keep saying and doing.
Well begun is half done.
Misfortunes always enter any door left open for them.
Sub omni lapide scorpio dormit.
Love the sea?  I dote upon it - from the beach.
You spotted snakes with double tongue... be not seen.
State Dept. of Unnecessary Double Redundancies Section.
If at first you doubt, doubt again.
When uncertain, or in doubt, run in circles and scream.
Just remember:  when in doubt, you're always right.
If you don't fall down, you're not trying.
Good day to let down old friends who need help.
Planned parenthood --- the impossible dream.
Show respect for age.  Drink good Scotch for a change.
General stupidity error reading drive C.
Friends don't let friends drive Fords.
Pure drivel tends to drive away ordinary drivel.
Daddy.  What does Formatting Drive C: mean?
"Daddy, what does FORMATTING DRIVE C mean?"
Back up my hard drive? I can't find the reverse switch.
There are more old drunkards than old doctors.
Le mieux est l'ennemi du bien.
Beware of the Quantum Ducks -- QUARK  QUARK  QUARK.
Mac screen message: "Like, dude, something went wrong."
He is not only dull within, but causes dullness without.
Latest conspiracy theory:  Humpty Dumpty was pushed.
Edam is not a Dutch Cheese, it's "made" backwards.
God never imposes a duty without giving time to do it.
Se non e vero, e molto ben trovato.
-----T-A+G-L-I+N-E--+M-E-A+S-U-R+I-N-G+--G-A+U-G-E-------.
Mental Floss: In one ear and out the other.
Men know life too early, women too late.
Little pitchers have wide ears.
If God lived on earth, people would break his windows.
The meek may inherit earth. Those who dare, the stars.
Men die and worms eat them - but not for love.
Life is unsure, always eat your dessert first.
MODEM - Monumentally Overpriced Data Eating Machine.
San Francisco: where NOBODY eats Rice-a-Roni.
I'm on the trailing edge of technology.
Swell-head: Nature's frantic effort to fill a vacuum.
A hen is an egg's way of making another egg.
Ein unntz Leben ist ein frher Tod.
In war and life, either fight to win or don't fight.
I don't like broccoli either.
Long live The Great Electronic Underground.
A mouse is an elephant built in Japan.
Just when I make ends meet, someone moves one end.
We have met the enemy, and he's all yours.
You aren't here forever, enjoy each day as a miracle.
It sounds like you enjoy looking forward to yesterday.
Honesty pays, but not enough for some.
If U look close enough, the truth is hidden in the words.
I am not young enough to know everything.
640K ought to be enough for anybody. -Bill Gates, 1981.
En boca cerrada no entran moscas.
Reality is the indefinite enumeration of objects.
For a bug-free environment do NOT run this program.
Daddy, what does 'read error in FAT' mean?"
Stop spelling misteaks: use error correcting modems.
Love truth but pardon error.
All real programs contain errors.
Certum est quia impossibile est.
It's nobody's business, not even mine.
And when fate summons even the Tsar must obey.
Silver and gold make even pigs seem clean.
What lightspeed?  I can even surpass dark speed.
A liar isn't believed even when he speaks the truth.
A bad peace is even worse than a war.
Everything bows to success, even grammar.
When no wind blows, even the weather vane has character.
Without fingers you cannot even thumb your nose.
Smoking cures weight problems... eventually.
No tax collector will ever enter the Kingdom of Heaven.
There's an answer to every problem.  Sometimes it's "No."
A thief believes that everybody steals.
Catastrophes to others are everyday events to you.
I'm totally unprepared for everyday life.
Love is blind, to everything except fat.
Hasten to laugh at everything, or later you may weep.
Tip the world and everything loose lands in Los Angeles.
When choosing between two evils, select the newer one.
I still miss my ex-wife - but my aim is improving.
Hindsight is the most exact science.
With people, reach should exceed grasp. Try for heaven.
Now may be an excellent time to become a missing person.
Love conquers all things except poverty and toothaches.
Change is inevitable ... except from vending machines. 
Press any key... NO!... except that one.
There is no defense except stupidity against a new idea.
If I feel like exercise, I lie down until it passes.
We have standards and expect you not to exceed them.
Climate is what we expect, weather is what we get.
Consult with a real expert - Call your mother.
You never have to explain things you never said.
I'm sure it's clearly explained in the Zmodem DOC's.
Fibonacci Numbers: The mathematical explanation of life.
Art is vision not expression.
Women's clothes: Go to extremes, seldom to extremities.
You can close your eyes to reality but not to memories.
Error: No Keyboard: Press F1 to Continue.
If you can't win fair, win foul.
With sin, a human falls into it, a saint grieves at it.
Rounded numbers are always false.
Live so that the family parrot can live afterwards.
Tact is knowing how far to go in going too far.
A big mouth travels far and fast.
Illustrate your Sermons! Wear far side ties.
Ostrich: He runs so fast he leaves his behind behind.
Once uttered, words run faster than the horses I bet on.
I may have my faults, but being wrong ain't one of them.
Bank error in your favor.  Collect $200.
They are slaves who fear to speak for the fallen & weak.
Even the boldest zebra fears a hungry lion.
My mind.  I can feel it.  I can feel it going. Goodbye.
Windows Error: 004 -- Operator fell asleep while waiting.
Stulti timent fortunam sapientes ferunit.
We're looking for a few good men.
Yes Dear, just a few more minutes....
There's a time to fight, and a time to hide out.
Retreat hell! We're just fighting in another direction.
The universe is a figment of it's own imagination.
Programs will expand to fill available memory.
Now where can you find one, nicer than this?
Perhaps a radiologist can find something of value in him?
Stupid: Being unable to find your own butt in the dark.
SHIN - A device for finding furniture in the dark.
He who wakes up finding himself a success, hasn't slept.
It is not only fine feathers that make fine birds.
Never drink from your finger bowl, it contains only water.
My bologna has a first name, it's O-S-C-A-R.
Memory seems to go first, or second, or ...
The ripest fruit falls first.
If it works, Don't fix it: Unless you are a consultant.
The orator, with a flood of words a his drop of reason.
Good taste is the flower of good sense.
There's at least one fool in every married couple.
To avoid seeing a fool, break your mirror.
Sometimes it takes a fool to rush in to get the job done.
If you listen to fools the mob rules.
Seek not to follow footsteps but what they sought.
Damn your "Once more for old times sake."
ASL has 15 signs for stupidity; 3 for smart.
Life is a tragedy for feelers and a comedy for thinkers.
Today is a day for firm decisions .....  Or is it?
A man's a man for that.
The world: A comedy for thinkers; a tragedy for feelers.
Window-screen: An arrangement for keeping flies in.
So long, and thanks for all the fish.
Quit work and play for once.
At yuletide, astronauts look for the missile toe.
You have been selected for a secret mission.
Wernher von Braun settled for a V-2 instead of a V-8.
A belly button is for salt when you eat celery in bed.
Post-Operative:  Fancy title for a letter carrier.
Rotisserie: a ferris wheel for chickens.
Stay away from hurricanes for a while.
If God had meant for us to be naked, we would be so born.
This tagline is only for the living.
Remember to leave 15% for the tip of the iceberg.
Do you like me for my brain, or my BAUD?
You obviously mistook me for someone who knows.
Nitrate: The motel rate for a stay of more than two hours 
A fool must search for a greater fool to find admiration.
Please take my word for it.
Civilized people need love for full sexual satisfaction.
There are no limits for journeys of the mind.
There is no remedy for sex but more sex.
Stupidity is no excuse for not thinking.
Tradition is no excuse for insensitivity or racism.
America, land of opportunity for Japanese businessmen.
All for one; one for all, except me above all.
The scenery only changes for the lead dog.
Diplomacy: The patriotic lying for one's country.
Pity the poor corpuscle, for he labors in vein.
There's no second chance for a good first impression.
Blessed are the pessimists, for they hath made backups.
Blessed are the meek, for they make great scapegoats.
Now is the time for all good men to come to.
Silly rabbit, tricks are for hookers.
There are two reasons for doing: one good, the other real.
If your work speaks for itself, don't interrupt.
Ancient custom has the force of law.
A horse may be forced to drink but a pencil must be lead.
A man should live forever, or die trying.
Since she won't live forever, why give her a diamond?
Women and elephants never forget real or supposed injury.
If I die, I forgive you, if I recover, we shall see.
Should old acquaintance be forgot - Count of Monte Cristo.
Assassination is the extreme form of censorship.
No problem is so formidable that you can't just walk away.
Misfortune:  The kind of fortune that never misses.
We make our own fortunes and call them our fate.
A problem can be found for almost every solution.
Lost gold may be found, time lost is gone forever.
A school: Building with four walls and tommorrow inside.
Hm..what's this red button foNO CARRIER.
We must believe in free will.  We have no choice.
From every mountainside, let freedom ring.
Hams do it with frequency, till their GIGAHERTZ.
You can't eat your friends and have them too.
Monotheism is a gift from the gods.
Digital circuits are made from analog parts.
Are dog biscuits made from Collie Flour?
From listening comes wisdom, from speaking, repentance.
Only a doctor suffers from good health.
Education, not experience, comes from reading fine print.
You can't get there from here.
The wise learn more from fools than fools from the wise.
Philosophy: A route leading from nowhere to nothing.
Happiness: A sensation arising from misery of others.
Good news: Ten weeks from Friday may be a pretty good day.
Keep cool, stand in front of an open refrigerator.
Time flies like wind.  Fruit flies like pears.
Let's have a little fun, let's do a pun.
Jealousy is all the fun you think they have.
Paranoia isn't as much fun as it used to be.
And now, let the fun begin.
One's needs are a function of what other people have.
I had a dislocated funny bone <OUCH> but it's better now.
Easy as pie, no fuss, no muss, no crust.
Hard work has a future payoff.  Laziness pays off now.
Mythology: Invented lies for future consumption.
I have seen the future, it is just an extended present.
Never think of the future.  It comes too soon regardless.
Best thing about the future: it comes one day at a time.
God made the first garden, Cain the first city.
If you don't eat garlic, they'll never smell it on you.
Stupidity has no limits, genius does.
The only chance I get to talk is while my wife inhales.
It is easier to get forgiveness than permission.
You might want to get a band-aid for that.
The best way to get ahead is to use the one you've got.
The only way to get rid of a temptation is to yield to it
Youthful figure: What you get when asking a woman's age.
Gene Police: "Hey YOU! Get out of this pool."
Information is hard to get. Using it is even harder.
Nickel: Once good for getting the wrong number with.
Beware of geeks bearing GIFs!
Treaties like roses and girls - they last while they last.
Hotel: A place you give good dollars for bad quarters.
Every child should be given the desire to learn.
The warranty: Bold print giveth & fine print taketh away.
People who live in glass houses should not throw stones.
Cynic: Through rose-colored glasses with a jaundiced eye.
Legal marijuana needs true glaucoma patients.
Bugs are sons of glitches.
Let no good deed go unpunished.
Where do honey bees go potty?  At a BP station naturally.
A little ignorance can go a long way.
To whom should I go to for some self-help?
Nobody notices when things go right, I'm always noticed.
Being alive: Concentrating on goals, not limitations.
A man without a god is like a fish without a bicycle.
Some men without a god are like fish without bicycles.
A farmer is always going to make it rich the next year.
Pale ink beats a good memory.
Foolish fears drive away good fortune.
Bad officials: elected by good citizens who fail to vote.
Fine day for a good workout. Steal something heavy.
No man has a good enough memory to make a successful liar.
Gravity:  Not just a good idea, it's the law.
Actions are neither as good nor as evil as impulses.
Too much of a good thing is wonderful.
Some days the only good thing on TV is the vase.
Feather by feather the goose is plucked.
I hate to repeat gossip, so I'll only say this once.
Let art alone. She's got enough guys sleeping with her.
Been there, done that, got the T-shirt.
Beulah, peel me a grape.
I'm not fat! - just gravitationally challenged. 
He cannot rule the great who cannot rule the small.
Absinthe makes the tart grow fonder.
Growing old is mandatory, growing up is optional.
Sometimes I wake up grumpy...other times I let her sleep.
Some thoughts are best guillotined before actions result.
A)bort R)etry G)et a gun and kill it.
Blow your mind, smoke gunpowder.
An optimist is a guy without much experience.
Artificial Intelligence: The other guy's opinion.
Difficult? I wish it had been impossible!
Radioactive cats have 18 half lives.
A shower is the halfway point between bed and world.
A bird in the hand is the best way to eat chicken.
A bird in the hand is worth what it will bring.
Confucius say: Man with hand in pocket is having a ball.
Always use your enemy's hand to catch a snake.
A bird in the hand's better than one overhead.
Stupidity is not a handicap.  You have to park elsewhere.
I've got too many hands on my time.
Yes-men: Fellows who hang around the man nobody noes.
Hangnail: A place to hang your coat and hat upon entering 
What the heck just happened here?
No one is so happy or sad as he imagines.
Happiness is mandatory....Are you happy?
A rock ----->me<----- A hard place.
Humble pie is always hard to swallow with your pride.
If you push something hard enough, it will fall over.
3 dreaded words: " hard disk failure."
Floppy not responding, Format HARD DRIVE instead? Y/N.
10.0 times 0.1 is hardly ever 1.0.
Parents: One of the hardships of a minor's life.
HaHaHa! Yuk, Yuk. Snort. Harumph.
Gnaw the bone which has fallen to thy lot.
Raising pet electric eels has lots of current popularity.
Bachelor: A guy who has cheated a woman out of a divorce.
Notice: All incoming fire has the right of way.
The cost of feathers has risen, now even down is up.
Outpatient.  A person who has fainted in the waiting room 
Prune: A plum that has seen better days.
Golden Rule: she who has the gold makes the rules.
Aunt Em. Hate Kansas. Hate you. Took dog. Dorothy.
Not now ... I have to go mow the laundry.
Beware. I'm armed and have suffered from PMS all my life.
Fear not, for I have given you authority.
Overdrawn?  But I still have checks left.
We have resumed control...we have resumed control...
Who says you can't have it all?
I seem to be having problems with my lifestyle.
Del dicho al hecho hay gran trecho.
Caution: Breathing may be hazardous to your health.
Nothing is impossible for he who doesn't have to do it.
And you know Flipper, he lives in a world full of wonder.
Don't knock President Fillmore he kept us out of VietNam.
God is subtle but he is not malicious.
You always swat where he's not, or if he is aha! a spot.
You tell 'em Bean, He's stringing you.
Everything starts in somebody's head as a daydream.
You tell 'em Bald Head, you're smooth.
A mob has many heads, but no brains.
Fact of life #15: Heads bleed, walls don't.
The first wealth is health.
Don't believe everything you hear or anything you say.
Always listen to experts. Hear the impossible then do it.
I seem to be hearing the sound of idle hands clapping.
Women take to good hearted men. Also from.
To live in the hearts we leave behind, is not to die.
Every person gets to heaven in their own way.
Excellent day for drinking heavily.  Spike water cooler.
Choose heaven for climate, hell for society.
Even a lot of help at the wrong time adds up to nothing.
Live: Know the past, help the present, touch the future.
Illiterate?  Write for free help.
A spoonful of sugar helps any medicine go down.
A sleeping fox counts hens in his dreams.
The only difference between her and it is the lipstick.
But, if ye wish her gratefu' prayer, Gie her a haggis.
American politics: The walruses herding the oysters.
I see no humor here, I can only laugh at the thought.
Let me out of here fast. TRON is catching up.
Witty tag line placed here. -->
Youth, a habit of hers so long she couldn't part with it.
Real programmers practice safe HEX.
Testing 1 2 3. Hey, is this thing on?
HHeellpp.. II''mm ssttuucckk iinn hhaallff--dduupplleexx.
If you want to hide your face, walk naked.
Secretion: Something someone is hiding from you.
Dachshund: Half a dog high by a dog and a half long.
If life is a highway... What's the Queensway?
When you're over the hill, you begin to pick up speed.
A king's castle is his home.
Let a fool hold his tongue and he will pass for a sage.
A man's house is his hassle.
Everyone should know where his towel is.
History doesn't repeat itself. Historians do.
A generation which ignores history has no past or future.
User Error: Replace user, hit any key to continue.
Golfer: A person who hits and lies.
Reality-O-Meter:  [\.......]  Hmmph!  Thought so.
Try cooling coffee by holding it closer to your heart.
I lost a button hole today.
There's no place like home.
Now and then an honest person goes into politics.
Self-made man: A horrible example of unskilled labor.
A horse is a horse, of course, of course.
Fiddle: Friction of a horse's tail on a cat's entrails.
If wishes were horses, horses would ride.
Religious people are wicked, how would they be without?
If you do nothing, how do you know when you're finished?
Regular or extra crispy, how do you want the environment?
Misteaching: Telling one's grandmother how to suck eggs.
Computers can never replace human stupidity.
Computers are unreliable, but humans are more unreliable.
It's hard to be humble when you're having so much fun.
The Church of St. Humid the Incontinent.
Animal attraction: here for hunger or for love.
Be vewy, vewy quite....I'm hunting tagwines.
Let's see your tagline hunting permit, sir.
Happy couple: A deaf husband and a blind wife.
I think ... therefore I am overqualified.
You tell 'em Submarine, I can't seaplane.
If life's a stage, I want better lighting.
I can be decisive, I think.
I can't be overdrawn, I still have checks.
I can't be stupid, I completed third grade.
That must be wonderful. I don't understand it at all.
Wherever I came from, I sure ain't there now.
I bought dehydrated water...but I don't know what to add.
When all else fails, I STILL refuse to read the docs.
Where is everything? All I typed was "Format c:". 
The only heavy breathing I ever hear is after aerobics.
Twenty-four hour banking: I just don't have time for it.
I came; I saw; I screwed up.
So crowded in here, I must go outside to change my mind.
As for me, all I know is that I know nothing.
I feel more like I do now than I did a while ago.
I [] My Dog. I [] My Cat.
Brain damage?  No thanks, I already have some.
I figured out what I was doing right, it doesn't anymore.
As I said before, I never repeat myself.
It was so cold, I almost got married.
I just steal 'em, I don't explain 'em.
Of all the people I have met, you are certainly one.
Beam me up Scotty.... I swallowed my Phaser.
As I was saying, I hate it when people don't finish their
Oh could I fly, I'd fly with thee.
You tell 'em Simon, I'll Legree.
Smoke me a kipper, I'll be back for breakfast.
Fax me no questions, I'll Fax you no lies.
You tell 'em Hunter, I'm game.
You tell 'em Hunter, I'm a duck.
You tell 'em Printer, I'm not your type.
You tell 'em Mountain, I'm only a bluff.
You tell 'em Cashier, I'm a poor teller.
I ain't broke, but I'm badly bent.
Blond Mating Call:  Oh, I'm so drunk [giggle].
I'm not..no I am..no, I'm NOT indecisive. Am I?
Just my opinion (But I'm right).
I'm terribly sorry, but I'm afraid you're just a mirage.
Pretend to spank me - I'm a pseudo-masochist.
I'm from the government. I'm here to help you.
Please don't unzip here. I'm bashful; I'll probably laugh.
OK, I'm weird! But I'm saving up to be eccentric.
Put on your seatbelt. I'm gonna try something new.
You tell 'em Cucumber, I've been pickled.
You tell 'em Manicurist, I've been trimmed.
I consider cake and ice-cream my just desserts.
Every Titanic has its iceberg.
Orator: a two minute idea, a two hour vocabulary.
He who attacks my ideas attacks democracy itself.
Everything's got a moral, if only you can find it.
In gambling and life if you don't play, you never win.
Be mischievous and creative, if they fit you.
Tag lines are irrelevant if you don't understand them.
Life can be profitable, if you know the odds.
Life might be easier if we had the source code.
Many would be cowards if they had courage enough to be so.
In a family argument, if you are right apologize at once.
Start a family only if your parents are able to baby sit.
The problem is not if machines think, but if people do.
What use is magic if it can't save a unicorn?
I'm the NRA, and if I can't vote twice, I'll shoot you.
The probability of success if not almost 1 is usually 0.
Age is only important if you're a cheese.
Shareware it only works if you pay.
He wouldn't recognize subtlety if it hit them on the head.
Proofread carefully to see if you any words out.
Why waste time learning, ignorance comes with the turf?
Sanity not found.  Abort, Ignore, Retry, Fail?
Anything good is either illegal, immoral, or fattening.
This tagline exploits the illiterate.
Bumpersticker: Honk if you're illiterate.
"That's entertainment," - Vlad the Impaler.
Quien da el pan impone la ley.
Wasting time is an important part of living.

*NOW* is a point in time that is already gone.
He is a sheep in sheep's clothing.
There is a skeleton in every old house and old horse.
A pest: A friend in need.
Genealogy:  It's all relative in the end anyway.
It's a beautiful day in the neighborhood.
I've seen better conversations in alphabet soup.
Important letters develop errors in the mail.
You always find it in the last place you look.
You'll never find it, in all those loose clothing!
Genealogy: Looking for bones in the closet.
I multitask... I read in the bathroom.
Help me, I'm stuck in here! - A Tagline.
Don't worry, I'm fluent in weirdo.
Executive ability is prominent in your make-up.
My life is still in BETA test.
One who is always in a stew generally goes to pot.
Subliminal:  Send me $1000 in small, unmarked bills.
Don't hit me!!  I'm in the Twilight Zone!!!
Faint hearts never win in love nor sell life insurance.
Tonight's the night:  Sleep in a eucalyptus tree.
There is no joy in Mudville, mighty Casey has struck out.
To do nothing is in every person's power.
Kernel panic: Nut lose in operator's chair.
Bureaucracy: That place always in need of a laxative.
The only red menace in America is the sunburn.
A good rooster crows in any hen house.
Quick!  Say something profound in 45 characters or le.
My best taglines are in for repair!  This one's a loaner.
Gee... What's that ticking in the corner.
A long time ago in a galaxy far far away, or was it here?
My family tree is in the forest, somewhere! 
Our program, who art in memory, EXE be thy name...
Can I yell "movie" in a crowded firehouse?
Always put your brain in gear before starting your mouth.
mY lINKAGE iS sTUCK iN rEVERSE.
Excuse me for butting in.  But, I'm interrupt-driven.
Too often justice is incidental to law and order.
This fortune intentionally not included.
Incorrigible punster -- do not incorrige.
Look at all the Indians.
Sex is like an industrial film covered in fur..
A lie is terminological inexactitude.
Undetectable errors are always infinite in variety.
Tagline space to let.  Inquire within. 
This machine is an instrument of terror.
If anyone approaches with intent of doing you good, run.
Never borrow trouble, the interest is entirely too high.
You can't step twice into the same river.
Reality is a constant intrusion on my dreams.
An atheist has no invisible means of support.
I just took an IQ test.  The results were negative.
Never cut down an Ironwood Tree to build your life raft.
What kills a skunk is the publicity it gives itself.
Anything not a constant, is not a commandment from God.
Art for art's sake is a philosophy of the well-fed.
On earth as it is in San Francisco
90% of being smart is knowing what you're dumb at.
Seeing is believing, Touching is convincing.
Every hard-boiled egg is yellow inside.
Lady with chastity belt is not having a ball.
Two is company, three is an orgy.
What this country needs is a good five-cent nickel.
Assumption #1: Dan Quayle is smarter than broccoli.
Losing your drivers' license is God saying "Walk!"  
All things evolve, nothing is extinguished.
A word fitly spoken is like a beautiful apple of gold.
Stop searching forever. Happiness is just next to you.
The race from stupidity is to the driven, not the swift.
SYSOP: The guy that is laughing at your typing.
What we have here is a failure to communicate.
Drama in her opinion is knowing how to fill a sweater.
Always tell her she is beautiful, even if she isn't.
Art is I; Science is We.
Not everything in life is funny.
A friend in need is a pest.
A mother-in-law is often a mother.
Life is...life is...life is...life is a kumquat.
To live long, it is necessary to live slowly.
Only a mediocre person is ever at their best.
Not everything more difficult is more meritorious.
A small object that is accidentally dropped will hide.
The bird of war is not the eagle but the stork.
Man, born of woman is of few days; full of trouble.
The Day of Judgement is approaching, or it is not.
An inch of dog is better than a mile of pedigree.
An ounce of example is worth a ton of advice.
An ounce of image is worth a pound of performance.
The plural of spouse is spice.
A pound of pluck is worth a ton of luck.
The price of greatness is responsibility.
The purification of politics is an iridescent dream.
A thing of beauty is in the eye of the beholder.
The tree of liberty is watered with the blood of tyrants.
Any priest or shaman is guilty until proven innocent.
Getting a second chance is never a certainty.
Mr. Bullfrog sez:  Time is fun when you're having flies.
Colic: a sheepdog that is part collie.
Since GOD spelled backwards is DOG, is my poodle Satan?
Remember, UNIX spelled backwards is XINU.
Ignorance is temporary; stupid is forever.
Confirmation of the past is often the greatest surprise.
That was then, this is now.
If you think education is expensive, try ignorance.
Nothing in this world is certain but DOS and taxes.
The desire to work is confined to classified ads.
A motion to adjourn is always in order.
person slow to anger is better than the mighty.
To be too clever is to be stupid.
Nothing is true, everything is permitted.
A day without okra is like a day without sunshine.
A day without sunshine is like night.
A well-written life is as rare as a well-spent one.
The mistake you make is in trying to figure it out.
Line noise?  What fh=.hElL is.LinS nfise?
Death is certain, life isn't.
Civilization is a movement, it is a voyage not a harbor.
Youngsters remember anything if it happened or not.
When you are in it up to your ears, keep your mouth shut.
Think carefully before wishing, it might just come true.
If it breaks make it bigger, if it sticks out chrome it.
It`s clever, but is it art?
I'm perfect by necessity, it isn't honest to be modest.
If you can touch it and you can see it, it's real.
If you can't make it work, make a statistic of it.
If you can't make it good, make it big.
When in doubt, make it sound convincing.
If you find it, it is always in the last place you look.
Those who fought for it know the true taste of freedom.
Ignore your health and it will go away.
Do well, hear of it never. Do ill, hear of it forever.
The older I get, it seems the better I used to be.
I think I got it made & they throw something else at me.
Whatever it is, whenever it occurs, I'm against it.
Life is like Jazz, it should be improvised.
Money: A mint makes it first and we try to make it last.
Used Car: Not what it is jacked up to be.
It never rains but it pours.
Support FREE software.  Write it yourself.
The last sound that it made was "Zap."
Envy is thin because it bites, but never eats.
It's hard to believe it, but some teens are humans.
Never time to do it right, but always time to do it over.
Always yield to temptation, it may never return.
Use it up.  Wear it out.  Make it do. Or do without.
Never agree with me, it shakes my self confidence.
What a wonderful world it is that has girls in it.
Assembly line workers do it over and over.
If it works, rip it apart and find out why.
Quick!  Make a wish!  It has a chance to come true.
All probabilities are 50%. It happens or it doesn't.
No sense being pessimistic.  It wouldn't work anyway.
Of course I tessssted it.
If it jams -- force it.  It needed replacing anyway.
"Tourist Season" : When it's OK to shoot them.
Matrimony isn't a word, it's a sentence.
That's not a bug, it's an undocumented feature.
Anything is good if it's made of chocolate.
Robotech? Oh, look Darling, it's Dallas in outer space!
If nobody measures up, it's time to check your yardstick.
If it's not true, it's quite easily found.
186,282 miles per second, it's the LAW.
Complexity isn't the answer - it's the problem.
Just when you think it's hopelessly broken, it works.
You tell 'em Railroad, It's not along my line.
You can't do that. It's been digitally cursed.
Law of Window Cleaning:  It's always on the other side.
I/O  I/O  IT'S WRITE TO DISK I GO  I/O  I/O.
Dogmatism: Puppyism come to its full growth.
A good pun is its own reword. 
Everything changes except change itself.
Celery raw develops a jaw. But stewed, is quietly chewed.
Bach is like a jetstream -if you can get on it, you soar!
How many sex-restricted jobs require a penis or a vagina?
Can you see it Joker?  It's written all over my face.
The only way to judge the future is by knowing the past.
I'm not confused, I'm just well-mixed.
I'm not crazy, I just don't give a &*$#.
Postmen never die, they just lose their zip.
It's not me,  it's just the way they dress me. 
Love thy neighbor ... just never get caught.
186,000 miles/sec: Not just a good idea, it's the law. 
Be flexible, some things just take time.
Have tree, will climb - just as all my ancestors did.
Always remember you're unique - just like everyone else.
Remember, the end never justifies the meanness.
Abort, Retry, Ignore, say Kaddish?
Make new friends but keep the old. Like silver and gold.
Committee: A body that keeps minutes and wastes hours.
Give the gift that keeps on giving; a female kitten.
Character is much easier kept than recovered.
Applied emotion is the key to success with happiness.
Careful planning is the key to safe and swift travel.
Indecision is the only key to flexibility.
My Go this  amn keyboar  oesn't have any  's.
Peeking two-eyed through a keyhole takes a narrow mind.
Here's looking at you, kid.
California raisins murdered! Cereal killer suspected.
Real wealth is the kind that can only increase.
Gee, Ward, weren't you kind of hard on Beaver last night.
It is better to kiss an avocado than to kiss an aardvark.
The trouble with a kitten is that, eventually it's a cat.
True terror: A female Klingon with PMS.
Sharp wits, like sharp knives, often cut their owner.
The world, as we know it, has come to an end.
It is better to know useless things than nothing.
When you do not know what you are doing, do it neatly.
They know enough who know how to learn.
A person's got to know his limitations to avoid failure.
Will your great-grandchildren know you existed and how?
Real knowledge is to know the extent of your ignorance.
Preserve the old, but know the new.
Forget your origin, always know where you're heading.
I'm too stupid to know what I'm involved in.
Optimist: Someone who doesn't know all the facts yet.
Inquiring minds want to know.
If God is all knowing, can He understand DSZ docs?
Without my ignorance, your knowledge would be meaningless.
Teaching: Appearing to have known your subject forever.
Every person you meet knows something you don't.
A yer ago I kudnt spel progrmer now I are won.
Learning without thought is labor lost.
Mary had a little lamb, a little beef, a little ham.
Help a swallow to land at Capistrano.
Speculation is the return lane of the road to knowledge.
Lean books are often larded with fat of others' works.
(A)bort (R)etry (I)nfluence with large hammer.
Patriotism is always the last refuge for the scoundrel.
Tradition is always the last refuge for the incompetent.
I just found the last bug.
Hmmm, When is the last time the Tooth Fairy visited you?
If you want the last word with a woman, apologize.
That was definately the LAST bug, take my word for it.
Bubble, Bubble..Am I too late to jump the ship ?
There is always a law against doing anything interesting.
Who to himself is law, no law doth need.
Justice is incidental to law and order.
A plucked goose doesn`t lay golden eggs.
Evangelists do more than lay people, sometimes.
Good luck is a lazy man's estimate of a worker's success.
The speed of the leader determines the rate of the pack.
In human history, most leaders prove to be good bleeders.
Smoking is one of leading causes of statistics.
No need to be leading to have the courage to go ahead.
You live and you learn - or you don't live long.
By trying we can learn to endure another's adversity.
Oh, no. Not another learning experience.
Oh, no! Not *ANOTHER* learning experience.
Bring the whole family...but leave the kids at home.
Equality of the sexes leaves women standing on buses.
An institution is the lengthened shadow of one man.
The Caldecott Tunnel has less traffic than that vagina.
Whatever you have, spend less.
Follow your heart and let your head take care of itself.
Said the fly " Let us flee."  Said the flea "Let us fly."
I'm a person of letters... unread collection notices.
Figures don't lie, but liars can figure.
Repent and return those library books.
He has too many lice to feel an itch.
Trust me, would I lie to you..... again?
Twinkies have a half-life, but Velveeta is eternal.
Only the lucky find life is two steps forward, one back.
Revenge is sweeter than life itself.  So think fools.
It's a simple choice: Life, Death, or Los Angeles.
Nobody home but the lights, and they're out too.
It was a night like this, 40 million years ago.
Nobody can be just like me. Even I have trouble.
Heaven has no rage like love to hatred turned.
Hell hath no fury like a demon scorched.
Responsibility without power is like slavery.
Acting without thinking is like shooting without aiming.
I'd like to live like a poor person with lots of money.
Genetics: Why you look like your father, or should.
It's nice to be liked just the way you are.
You must know your limits to break through them.
Reality stems from the line printer.
Persons reading between the lines do so at their own risk.
Man is the missing link between apes and human beings.
Electronic publishing: What's my lino?
A person is a lion in his own cause.
Life is full of little surprises. - Pandora.
Just cannot resist a little fun along the way.  :-)
As long as I live, I shall be, myself, no other, just me.
They never let you live it down. One little mistake.
The best defense against logic is stupidity.
Why use a big, long word when a diminutive one will do?
Today has been a long year.
He who hesitates too long, must change his underwear.
I don't have to look up my family tree. I'm the sap.
To understand other's miseries, look at their pleasures.
Any sufficiently advanced magic looks like technology.
Beware when God lets loose a thinker on this planet.
Swap read error.  You lose your mind.
If we learn from losing, we become winners in the end.
When all else is lost, the future still remains.
You can observe a lot by watching.
would have suffered a lot more if I'd been understood.
Mad: Affected with a lot of intellectual independence.
To cure insomnia, get lots of sleep.
Our first and last love is self-love.
He who falls in love with himself will have no rivals.
The first sigh of love is the last of wisdom.
Those whom the gods love grow young.
The only victory over love is flight.
Communism will work when love, not greed, inspires it.
I sighed as a lover, I obeyed as a child.
Good manners are the lubricant of social intercourse.
Laughter is the best lubricant for life's engine.
Today is not your lucky day. You won't have one this year.
"He who hesitates is lunch !"
Never wear a Big Mac suit while next to George Foreman.
He is a self-made man, and worships his creator.
Postage not necessary if mailed within the United States.
Myth-conceptions are the major cause of wars.
Luxury: Costs $7.69 to make and $20.00 to market.
Two wrongs do not make a right, it takes three or more.
In case of doubt, make it sound convincing.
Remember that three lefts make a right.
They're only trying to make me LOOK paranoid.
It takes two to make a bargain.
Opportunities taken are what makes your future.
Love your enemies -- it makes them so damned mad.
Who has the bread makes the laws.
Man's inhumanity to man makes countless thousands mourn.
We're lost, but we're making good time.
He was a bold man that first ate an oyster.
You can judge a man by how he keeps his golf score.
We must laugh at man, to avoid crying for him.
Better to marry a man who loves you than one you love.
In this world a man must either be anvil or hammer.
How dieth the wise man? As the fool.
The way to a man's heart is through his veins
The first myth of management is that management exists.
A nose in artificial manure is not studying nature.
Why are there so many fools on the road?
Why are there so many gnarly limbs on my family tree?
Bigamy: One wife too many.  Monogamy: Same idea...
Destiny is not a matter of chance but a matter of choice.
Success is simply a matter of luck.  Ask any failure.
Happiness is no laughing matter.
WARNING... drinking tap water may kill your thirst.
Yield to temptation; It may not pass your way again.
Regardless of what you may think, this is not a tagline.
I thank whatever gods may be for my unconquerable soul.
Even if you're paranoid maybe they're really after you.
This tagline stolen by me, or was it you?
I give up. Push me that hollow log and I'll climb in.
Please don't yell at me.  I'm new at this.
Don't play stupid with me....I'm better at that also.
Menu:  A list of meals the restaurant has just run out of.
1024x768x256.... Sounds like one mean woman.
To be a Californian means to have faults others don't.
A husband is the medicine for the ills of girlhood.
Creditors have much better memories than debtors.
Dawn: the time when men of reason go to bed.
Travel important today;  IRS men arrive tomorrow.
Women go on diets. Men just eat less... and grow fat.
No woman should imitate men.  Men are not worth it.
Did you really expect mere proof to sway my opinion?
The characters in this message are recyclable.
Don't reply to inappropriate messages, left by SysOp.
don't reply to inappropriate messages, leave SysOp do it.
All wiyht.  Rho sritched mg kegtops awound?
Make a wish, it might come true.
Our world: a 8000 mile in diameter spherical pile of dirt.
When you shoot a mime, should you use a silencer?
A programmer and his mind are soon parted
I have lost my mind, but it must be backed-up somewhere.
Indiscriminate study bloats the mind.
Georgia is on my mind.
Have you seen my mind? It wandered again.
Money talks, but all mine ever says is "Goodbye."
I don't believe in miracles, I rely on them.
Some winners rely upon miracles without believing in them.
If you make a mistake, fix it to the best of your ability.
If you learn from mistakes, you will learn a lot today.
Philosophic enjoyment = mutual misunderstanding.
Banging head against wall mode - off.
I have a 9600bps modem and 1.5bps fingers.
DO I need a modem for each phone line?
Education which is not modern, faces the organic fate.
Modesty died when false modesty was born.
Usually insane; in lucid moments merely stupid.
A fool and his money are invited everywhere.
Government should spend our money like it was their own.
Mental floss might prevent moral decay. 
Cowards can never be moral.
I am a man more sinned against than sinning. - King Lear.
She has been under more drunken sailors than a naval head.
No wonder can last more than three days.
A learned fool is more foolish than an ignorant fool.
COFFEE.COM not found: A)dd more, R)eheat F)reak out.
A woman's guess is more accurate than a man's certainty.
Man: There is nothing more miserable and more arrogant.
I think it needs more juice.
Non-fiction often is more unrealistic than fiction.
There are some defeats more triumphant than victories.
She can't take much more of this Captain.
A hen tomorrow is more valuable than an egg today.
If I were here more often, I wouldn't be gone so much.
You tell 'em September Morn, no one has anything on you.
Empty vessels make the most sound.
In data, the figure most obviously correct, is an error.
One good turn gets most of the blanket.
One good turn gets most of the blanket on a cold night.
Lunatic asylum: where optimism most flourishes.
Tend the molehills, the mountains look after themselves.
Anger always drives the mouth faster than the mind.
If I have no mouth but I must scream what should I do?
Flamers have uncontrollable vowel movements.
The other line always moves faster.
See you in the movies.
Is this drive really moving with my head parked?
Humankind cannot bear very much reality.
Where you've been means much less than where you're going.
Nobody ever bet too much on a winning horse.
No one does as much harm as one going about doing good.
Silent gratitude isn't of much value to anyone.
I don't know how much more she'll take of this, Captain.
Modern poets mix too much water with their ink. -Goethe
Earth: A solid substance, much desired by the seasick.
He who talks too much commits a sin.
Be careful when slinging mud, you might lose ground.
I'm not schizophrenic, I'm multi-faceted.
Parturient montes, nascetur ridiculus mus.
Onward and backward!  We must look busy.
If the family skeleton must remain, make it dance.
To return home, you must walk backwards in time & space.
The arrogance of age must submit to be taught by youth.
Who would understand youth must know old age.
If it works, it must be obsolete.
There's a brain in my tumor.
Either he's dead or my watch has stopped.
Everyone is entitled to my opinion.
It is hereditary in my family to have no children.
How do I set my laser printer to stun?
There's no skeletons in my closet.
I tried to drown my problems but they can swim.
Just want to add my two cents worth, for what it's worth.
There's a Yankee in my closet - will trade for skeleton.
Did my ancestors inbreed? My genes seem tight.
Quoth the Raven,  Eat My Shorts.
I can't use Windows.  My cat ate my mouse
Youth + confidence + myopia = naivete.
This is another fine myth you've gotten me into.
Shut up, or I'll nail your other foot to the floor.
Maytag is my middle name: I'm an agitator.
<<< Tagline deleted by Natl Endowment for the Arts >>>
A person without a navel lives within all of us.
Little boats should keep near the shore.
Society like air, is necessary but not complete for life.
Memory Manager:  Something I need more than my computer.
Many a family tree needs trimming.
Maybe you're correct being nervous now.
Forgive your enemies, but never forget their names.
A truly wise man never plays leapfrog with a unicorn.
A leap year is never a good sheep year.
Don't be a snob. Never lie when truth is more profitable.
Don't be fazed by new fashions in anything.
So much for No New TAXES, I'm giving up lip-reading.
Seriousness is the very next step to being dull.
Bits make bytes, but nibbles turn me on.
History is made at night.
I mustanottagottalotta sleep last night.
How come men got nipples?
Be right & fear no man.  Don't write & fear no woman.
If you didn't vote, no complaints about who's in or out.
Backups?  We don' *NEED* no steenking baX%^~,VbKx.
A KGB keyboard has no <ESC> key.
Did you know that no-one ever reads these things?
A closed mouth gathers no foot.
A closed mouth gathers no flies.
Let your mouth write no check that your tail can't cash.
No condo, no MBA, no BMW, no 486, no clever tagline.
Everyone complains of memory, no one of judgment.
What if there were no hypothetical situations?
In war there is no substitute for victory.
It's a tragedy that no man becomes like his mother.
History books which contain no lies are extremely dull.
Words, words, words.  And no place to put them all.
Being able to say NO is the root to reclaiming your life.
Ivo Andric - Yugoslavia's First Nobel Laureate.
After four decimal places, nobody gives a damn.
History repeats itself because nobody listens.
Be suspicious of all non-native-born Esperanto speakers.
No facts are sacred, none are profane.
Sex isn't the best nor the worst thing in the world.
Pereant, inquit, qui ante nos nostra dixerunt.
Words must be weighed, not counted.
Features should be discovered, not documented.
No, Taco Bell is not the Mexican telephone company.
Talking of bulls is not like being in the bull ring.
Air conditioned environment - Do not open Windows.
Being old fashioned is not necessarily good or better.
Those without heads do not need hats.
Rational information in arguments not permitted here.
It's what inside you, not the outside that counts.
All the kookies are not in the jar.
Reputation:  What others are not thinking about you.
Lack of planning does not constitute an emergency.
A child prodigy knows not to bother with it.
Machine-independent program: Will not run on any machine.
Remember, one runner does not make a race.
Actions from sanity are not necessarily from feeling.
A beard signifies lice, not brains.
Breast implant silicon should not influence brains.
Remember, one singer is not a duet.
A hundred stars do not equal the light of the one moon.
Opposing action systems do not execute simultaneously.
Raising your voice does not reinforce your argument.
Fault lies with systems not the technologies involved.
Worth seeing?  Yes, but not worth going to see.
Drink! for you know not whence you came, nor why.
Shake, a man of note, wrote so many things to quote.
Blessed is he expecting nothing, and never disappointed.
Everything is possible, but nothing of interest is easy.
Eggheads unite!  You have nothing to lose but your yolks.
When seeking love give nothing.  Finding love give all.
Reader not found, please notify tagline.
Sails trimmed, autopilot on, now it's "Miller Time."
Feathers are so expensive now that DOWN is up.
I don't want it now, I want it RIGHT now.
Do what comes naturally now. Throw a tantrum.
Alimony is like buying oats for a dead horse.
Rebellion to tyrants is obedience to God.
Waiting to overcome all objections, results in nothing.
Good day for overcoming obstacles.  Try a steeplechase.
If there is an obvious solution it is always obvious.
Some settling may have occurred in shipping.
It's all a matter of taste.
Fame: Chiefly a matter of dying at the right moment.
Is evil a child of the nature or nurture of the beast?
Inflation is a result of legalized counterfeiting.
Life is a kind of trick.
Life is a series of rude awakenings.
Man is a piece of the universe made alive.
Marriage makes a life of deception a necessity.
Isn't there a statute of limitations on stupidity?
Talking is another disease of age.
The graveyards are full of indispensable people.
If you aren't part of a solution, you are a precipitate.
To laugh at men of sense is the privilege of fools.
Living: The best demonstration of victory over mortality.
RU486SX - 16 bit version of the popular abortion pill.
Speak of braggarts: talking of those lacking something.
Diplomacy: the delicate weapon of the civilized warrior.
Save the earth, some of my best friends live here.
Snozzelberry? Who ever heard of a snozzelberry? 
Instinct is intelligence incapable of self-consciousness.
The laborer is worthy of his hire, only if his labor is.
Lawyers: the larval form of a politician.
Lawyers: the larval form of politicians.
Children have more need of models than of critics.
I fear needing explanations of things explained.
Postscript: The only thing of interest in some letters.
You'll always overlook one of those pins in a new shirt.
I'm not paranoid!  Which of my enemies told you this?
It's a poor sort of memory that only works backwards.
The most popular form of birth control: The headache.
The worst possible set of circumstances is bound to occur.
Hug: A roundabout way of expressing affection.
That's a smug aura of respectability you see in a mirror?
Someone is speaking well of you.
Taglines unite! Stop kidnapping of taglines.
Urine: Baseball term: Opposite of "Your out."
Memoirs are the backstairs of history.
Words are the voice of the heart.
I despise the pleasure of pleasing people whom I despise.
College: Guarantee the quality of the product or return.
A hangover:  the wrath of grapes.
Acting is the art of keeping the audience from coughing.
Adventure is the champagne of life.
Assumption is the mother of all screw-ups.
Architecture is the art of how to waste space.
Custom is the law of fools.
Doctrine is the skin of truth set up and stuffed.
Doubt is the root of education, not faith.
Disease is the retribution of an outraged nature.
Hypocrisy is the type of homage vice pays to virtue.
Ignorance is the mother of superstition.
Matrimony is the root of all evil.
Leisure is the mother of philosophy.
Money is the sinews of both love and war.
Money is the root of all evil, and man needs roots.
Money is the root of all wealth.
Prejudice is the reason of fools.
Repetition is the death of art.
Tact is the intelligence of the heart.
This is the voice of world control.  I have brought peace.
Today is the scene of the accident.
Wit is the spice of conversation, not the food.
Memories keep the wolf of insignificance from the door.
For many, the declension of life is: I go, you go, ego.
Its not the size of the ship, its the size of the waves.
Let not the sands of time get in your lunch.
Beware of the opinion of someone without any facts.
Many possess the wisdom of many and only the wit of one.
Dan Quayle: the EDLIN of Vice-Presidents.
Devoted to the study of cat bathing as a martial art.
Don't underestimate the power of inflation.
Never underestimate the power of human stupidity.
Losing weight: the triumph of mind over platter.
Is "Artery"  The study of fine paintings?
Army food: The spoils of war.
Oh war. Thou son of Hell.
Dancing: A vertical manifestation of a horizontal desire.
Your sin, was it of omission, commission, or emission?
The best way out of a difficulty is through it.
Barometer: Indicates what kind of weather we are having.
There's a whole generation of people out there my age.
Beer and women: Two of God's best gifts to mankind.
Bomb #20, you're out of the bomb bay again.
Guns don't kill people  off-line readers do.
Accountants work their assets off.
Morbid: The next higher offer at an auction.
Common politics: Holding an office of trust for profit.
Love is in the offing. Be affectionate to who adores you.
A clear conscience is often the sign of a bad memory.
The best laid plans often go a fowl.
Man loves little and often, woman much and rarely.
Plop, plop, fizz, fizz, oh, what a relief it is.
Sure, when OINK FLAP OINK FLAP ... I'll be damned.
Life is a cabaret, old Chum.
You can teach an old dog new tricks, under protest.
Dios tarda pero no olvida.
Humans sin by both ommision as well as commission.
Repunzel, Repunzel, ... turn on your modem.
LOTTERY: Just a tax on people who are bad at math.
Judge not a carpenter on how fast the chips fly.
The sun always rises on the most tired people.
Don't kiss an elephant on the lips today.
All words are pegs on which to hang ideas.
Contraceptives: to be used on all conceivable occasions.
It will be done on time, if I can find the time.
My hard disk went on a diet and lost it's FAT.
Nothing ever gets built on schedule or within budget.
Time slows if you're on the outside of the bathroom door.
Everybody is ignorant, only on different subjects.
Jesus Saves, Johnson scores on the rebound.
How you look depends on who is looking.
You can multi-task on C-64s... keep a multitude of them.
Get a new lease on life, do you have the security deposit?
What's the point-spread on World War III?
Whenever possible, put people on hold.
The sun shines even on the wickedest.
I spilled spot remover on my dog.  He's gone now.
Does LIFO-suction work on a FAT table?
Never try this stunt on your own PC.
If a tree fell on a florist, would he make a sound?
Don't trust doctors, they once said you were sane.
You are only young once, but it is easy to stay immature.
Dare to dream - no one can take that away from you.
A true friend is one soul in two bodies.
Oh well, half of one, six dozen of the other.
If you like this one, wait until you hear my next story.
A good memory is one trained to forget the trivial.
Think hard now.  Which one is Shinola?
Two of perfect virtue: one dead, the other yet unborn.
If a string has one end, then it has another end.
Man and wife make one fool.
Nihilism should commence with oneself.
Power is an illusion; only stupidity is real.
When puns are outlawed only outlaws will have puns
We are immortal, but only for a very limited time.
A book is the only immortality.
Minds, like parachutes, work only when open.
They also serve who only stand and wait.
Elevators travel in groups.  Only one of them knows why.
When Marriage is Outlawed, Only Outlaws will have Inlaws.
Never be led astray onto the path of virtue.
My mind ain't so open that anything can crawl right in.
The only time I open my mouth is to change feet.
Unable to find coffee, operator halted.
If I wanted your opinion I would give it to you.
It looks like an optical illusion, but it isn't.
George Orwell was an optimist.
Is "Sue" a noun or a verb?
Art thou an artist, or art thou art?
Art is either plagiarism or revolution.
A committee has six or more legs and no brain.
The choice: Roll over or stand up to the challenge.
Politics: Passing the buck or passing the doe.
Press [ESC] to detonate or any other key to explode .
Cemetery: (n); A marble orchard you can take for granite.
Semiconductor:  A part-time orchestra leader.
A clean, neat, and orderly desk is a sign of a sick mind.
Please return stewardess to original upright position.
Don't store garlic near other victuals.
Tips: Wages we pay other people's hired help.
Some men are discovered, others are found out.
Share your happiness with others today.
Self-sacrifice: to sacrifice others without blushing.
Vulgarity: The conduct of others.
With our judgements as our watches, none go just alike.
Oh captain! my captain! our fearful trip is done.
Save out planet for our descendants.
We now return to our regularly scheduled flame-throwing.
We are the people our parents warned us about.
You're being followed, cut out hanky-panky for a few days.
Hot air sometimes thaws out a cold reception.
Baroque: When you are out of Monet.
Your karma just ran over my dogma.
The more you run over a cat, the flatter is gets.
Hang up your logic over there.
Every person constructs their own bed of nails.
To a dog his owner is Napoleon; hence their popularity.
The footprint of the owner is the best manure.
Never buy a software package bigger than your head.
Some authors should be paid by the quantity NOT written. 
Worry is the interest paid on trouble in advance.
Few things are as painful to us as the truth.
Blessings never come in pairs; misfortunes never alone.
Out of the frying pan, into der fire. - The Swedish Chef.
Now... where did I park that hard disk?
Advertisement: The most truthful part of a newspaper.
When dangling, watch your participles.
Contains no user-serviceable parts.
A male rite of passage: Writing your name in the snow.
A person in a passion is riding a mad horse.
The hole and the patch should be commensurate.
Do something unusual today.  Pay a bill.
All warranties expire upon payment of this invoice.
A mainframe: The biggest PC peripheral available.
Too many pray for peace with their fists clenched.
One crow will not peck out another crow's eyes.
It is a sin peculiar to people to hate their victims.
You can fool all people, except but you can't fool Mom.
Windows 3.0 - From the people who brought you EDLIN.
Diode: What happens to people who don't die young.
Always smile.  It makes people wonder what you're up to. 
The more known about people, the more to admire in dogs.
The welfare of the people is the chief law.
Fame is proof that people are gullible.
Protein: Supportive of young people.
I may not be perfect, but I am all I got.
I see you are performing up to your standards.
One who is in peril thinks with their legs.
A celebrity is a person who is known for well-knownness.
I never loved another person the way I loved myself.
The first step towards philosophy is incredulity.
The proof is the phylogeny of plant-animal interactions.
All science is either physics or stamp collecting.
Astronomy: The anatomy and physiology of our universe.
I'm a pilot.  I pick it up here and pile it there.
You tell 'em Custard Pie, you've got the crust.
California is a fine place to live, if you are an orange.
This is a *dangerous* place.
Dream of a pure planet.
With foxes we must play the fox.
God is a comic playing to an audience afraid to laugh.
Oh that?  I was playing leap frog with a unicorn.
You disagree?  May I plea guilty by reason of sanity?
It is a rather pleasant to be alone in a bank at night.
He says a thousand pleasant things, but never "Adieu."
This door is baroque; please call Bach later.
If you always postpone pleasure you will never have it.
Accordion: A bagpipe with pleats.
Windows, icons, mouse and pointer = WIMP.
Meaningless tagline attached to pointless message.
Avert misunderstanding by calm, poise, and balance.
Ideals kill politicians, and politicians kill ideals.
BUSH.SYS corrupted, recommend optimizing politics.
Positive thinking: Believe everything positively stinks.
Health is the slowest possible rate at which one can die.
At 19, everything is possible; tomorrow looks friendly.
Have you any Grey Poupon?
Hearts will never be practical 'til they're unbreakable.
Speed things up, make pre-aged wine from old raisins.
Price of admission - your premise.
Courage is your greatest present need.
Friendships are not always preserved in alcohol.
Close your eyes and press escape three times.
To steal this tagline press <CTL> <ALT> <DEL> now.
We are what we pretend to be -- Kurt Vonnegut.
I am who I pretend to be at that point in time and space.
Satire does not look pretty upon a tombstone.
Always format alphanumerically, then preview graphically.
Every politician has a price, some hold bargain sales.
Every purchase has its price.
Enter any 12-digit prime number to continue.
Screw each and every prime directive.
He who laughs last probably made a backup.
He who laughs last probably doesn`t understand the joke.
Your solution stinks. The problem is very interesting.
The solution to a problem changes the problem.
The chief cause of problems is solutions.
Every solution breeds new problems.
Life is one long process of getting tired.
Reality is an illusion produced by alcohol deficiency.
C program run... Run, program, run...  PLEASE...
Caution! - Bug squashing in progress.
It is easy to propose impossible remedies.
Bride: Woman with fine prospect of happiness behind her.
Transistors blow before a protecting fast acting fuse.
Hey man, you can't prove nothing.  I was at home.
Vote for abolishment of public display of butt-cracks.
Hey, Rocky, watch me pull a rabbit out of my hat.
Chastity is it's own punishment.
Go soak your head, puny human.
"Happiness is a warm puppy." said the anaconda.
Never lean forward to push an invisible object.
My twit filter just put me on its twit List.
"Ok, now for a quick backuL+b&2PO^1+=.
Ok, now for a quick backu^L+b&2PO^1+=.
$ not found:  A)bort, R)efinance, D)eclare bankruptcy.
Desecrate, decimate, rah. rah. rah.
Malice is merely stupidity raised to a higher power.
The thing most generally raised on land is taxes.
Remember, even winning the rat race, you're still a rat.
TV advertising is the rattling inside a swill bucket.
If reality wants to reach me, it knows where I am.
When all else fails, read the instructions.
Beat's me!!! I never read the documentation.
But once you are real, you can't become unreal again.
Many are absent from reality physically and/or mentally.
How could anything alter reality for $9.95?
Some zoophilic dreams are really wild.
Megahertz--when something is really painful.
PARANOID - One who is really in touch with reality. 
Monologue: A conversation between realtor and prospect.
A nudist has no reason to fear a pickpocket.
The eventual supremacy of reason should be accepted.
A bigot will not reason, a fool cannot, a slave dare not.
Before advising be yourself, reassess his character.
Be as good at receiving as you are at giving.
Do cellular phones cause reckless dialing?
On this BBS, we recycle all of our bytes, bit by bit.
No parking in the red zone.
He hasn't a single redeeming vice.
In fashion be a reed in the wind.
Consistency is the last refuge of the unimaginative.
To really know a relative, divide an inheritance with him.
The only thing more reliable than magic is one's friends.
Don't need a new religion, haven't used up the old one.
As long as we remain unsure, we are alive.
Don't find faults, discovery remedies.
<This Tagline has been removed by U.S. Customs>.
* FORD    Fix or Repair Daily.
History doesn't repeat, historians repeat each other.
Abort, Retry, Ignore, hold Requiem Mass?
The picture of health requires a happy frame of mind.
It has been discovered: research causes cancer in rats.
If I could be respected and not have to be respectable.
An idea is not responsible for people who believe in it.
Events of importance often result from trivial causes.
Show affection, it may result in a pleasant response.
Bastard toadflax: not the result nearsighted horny toads.
Backup not found: Abort, Retry, Massive heart failure?
Cities, like cats, will reveal themselves at night.
What soberness conceals, drunkenness reveals.
A penny saved is ridiculous.
Give me patience .  RIGHT NOW.
Left lane must turn right. 
((wrong && wrong) != right)
Does the name Pavlov ring a bell?
Reality is something you rise above.
Fountains mingle with the river, rivers with the ocean.
In principles be a rock in the stream.
Hail, hail, rock and roll.
Money is round, it rolls away.
Windows? !Por Favor, No Rompa Mis Cojones! Gracias!
You can always make room for one more. Except a new baby.
Straight trees have crooked roots.
How did I get round from eating square meals.
I'm in shape ... round's a shape isn't it?
Hi, my name is Rover, I'll paint your car yellow free.
The young know the rules, the old know the exceptions.
Beware of hip and rum drivers.
It is easier to run down a hill than up one.
Hospitals: Places where the run down wind up.
Any given program,  when running correctly, is obsolete.
He who fights & runs away will live to fight another day.
Water in the West runs uphill toward money.
Nuclear Weapons:  May they rust in peace.
Will Rogers never met Saddam Hussein.
What Saddam Hussein's mom said: Abort, Retry, Fail?
What garlic is to salad, insanity is to art.
Mary had potatoes, wine, salad, and a little lamb.
Irregular verbs are on sale in the bargain basement.
East credit terms available. - Satan.
You can write until sated, but no one must read it.
Stay away from flying saucers today.
The hard disk you save may be your own.
The best way to save face is to keep the lower part shut.
A lie in time saves nine.
There's so much to say but your eyes keep interrupting me.
Sparky's Law: You must say something cute here!
Petty crime is the scourge of business today.
You got to stop screwing around, daddy.
The devil can cite Scripture for his purpose.
The fish in the sea are as good as the fish removed.
Beauty faded has no second spring.
Keep hands off the secretary's reproducing equipment.
MSDOS is a boot sector virus.
Spaghetti code = job security.
Even the blind can see money.
Always proofread carefully to see if you any words out.
I know nothing, I see nothing, I didn't wake up yet.
Even the Tsar can't see his face without a reflector.
To those who can see, a picture is a wordless poem.
Boot & ye shall see. Replace & all will be made clear.
The wrong way always seems the more reasonable.
Admiration: Polite recognition of self-reflection.
Nothing astonishes like common sense and plain dealing.
He is the most sensible looking man talking nonsense.
Music is the only sensual pleasure without vice.
Witches who misbehave are sent to their broom.
Some believe their life sentence is take up room and die.
Far duller than a serpent's tooth to spend a quiet youth.
Money is an excellent servant, but a horrible master.
Do not adjust your set.  We are in control.
At times we must settle for inferior  quality time.
He who hesitates is several miles from the next exit.
Most family trees have several branches best forgotten.
Love is of chemistry, sex is of physics.
He who has a shady past knows that nice guys finish last.
Whoso diggeth a pit shall fall therein.
They who dig pits shall end falling into them.
Where there is no shame, there is no honor.
All wanting joy must share it, happiness was born a twin.
Shared pain is lessened;  shared joy is increased.
David Duke: Same old sheet.
Don't wait for your ship to come in, swim out to it.
Don't give up the ship. Give up the captain.
Contents may settle during shipping.
Imelda Marcos: "If any shoe fits, buy it."
Don't drink. You might shoot at tax collectors and miss.
To make pleasures pleasant, shorten them.
Moderation in all things should be practiced sparingly.
A minister says matrimony should be enduring.  It is.
"Off with her head!" shouted the Queen.
Midas was into golden showers.
Why do I always shrug my shoulders?  I have no idea.
Astrophysicans try to cure sick stars.
All barkers are not side show hawkers.
Every sound ends in silence, but silence never dies.
When the eagles are silent the parrots begin to jabber.
A yawn is a silent shout.
Every crowd has a silver lining.
The mouse with a single hole is quickly caught by the cat.
Think and you won't sink.
A true diplomat struts sitting down.
Error reading FAT Table...Try Skinny one ? (Y/N).
Never argue with a skunk, mule, female, or a SysOp.
Any socialism involves more slavery than democracy.
Get a ROBONAP: Will sleep for you while you're online.
A slap vs a slog is like a ribbon vs an obi.
The buck doesn't even slow down here.
The moon may be smaller than Earth, but it's further away.
If dolphins are so smart, why did Flipper work for TV?
It is possible to smell after you stop breathing.
Flattery: Cologne water, to smell but not swallow.
Is this Heaven... No. Smell, its Iowa.
I'm human: nothing human smells strange to me.
Standing on head makes smile of frown for mouth only.
When you see a snake, never mind where he came from.
Buy a 486-33 so you can reboot faster.
Since we all move so slow, why is it called rush hour?
I owe, I owe, so off to work I go.
Most wonderful ideas are so obvious that they're not.
So many messages ... So little time left. 
By the way, you're soaking in it.
There's always one more SOB than you counted on.
ZMODEM has bigger bits, softer blocks, and tighter ASCII
If you can't speak softly, just use the stick.
Hardware: This you kick. Software: This you corrupt.
HELP! Protect America's children, soil, and water today.
Quick! hand me that solar-powered flashlight.
A noisy exhaust to some almost amounts to a mating call.
Yawn: The only time some men get to open their mouths.
Always do right: Gratify some and astonish the rest.
Everyone as they loveth, some people kiss cows.
A leading authority is someone lucky who guessed right.
God heals, but always someone else wants a fee.
Genealogy. Tracing descent from someone who didn't.
Mistakes at least show someone did something at sometime.
It's okay to call someone stupid; just don't prove it.
I try to impress someone and always end on the short end.
I smell memory leakage.  Someone here is dozing.
Every valuable idea offends someone.
Behind every argument is someone's ignorance.
Shouldn't you be doing something useful?
If an experiment works, something has gone wrong.
Everyone lives by selling something.
You got to start somewhere if you're going end elsewhere.
Better three hours too soon than a minute too late.
You may be recognized soon.  Perhaps you should hide?
A hug warms the soul and places a smile in the heart.
Don't go surfing in South Dakota for a while.
Excuse me, can you spare a tagline?
Earn cash in your spare time -- blackmail your friends.
It is meaningless to speak of domesticating a child.
REAL SysOps disconnect the speakers.
We are all related...relatively speaking.
Never trust anyone who speaks well of everyone.
Why isn't there a special name for the tops of your feet?
Time is the dressmaker specializing in alterations.
Life is not a spectacle or a feast, it is a predicament.
What grammar is to speech, logic is to reason.
Yeah, but what's the speed of DARK?
Fer sail cheep, Windows spel chekker, wurks grate.
With two ways to spell a word, the wrong one will be used.
Ever wonder why Oprah spelled backwards is Harpo?
If you know the spelling of a word, you will err anyway.
Draw your salary before spending it.
Eeny Meeny, Jelly Beanie, spirits are about to speak.
Do unto others, then split.
Judicial reform is no sport for the short-winded.
What results from using spot remover on your dog Spot?
Recognize the signs of spring.
Call out the vice squad.  Someone's mounting a disk drive.
I'm on the Brute Squad. No, you ARE the Brute Squad.
There is more at stake here than our lives.
Celery farmers play the stalk market.
#:-)   <:   - Snake stalking person.
I think that I'll stand up-wind, if you don't mind.
Few of us can stand prosperity -- someone else's.
Behind every successful man stands a surprised MIL.
Why did I ever start this, anyway?
I'm so bored, I'm starting to miss my husband.
To get ahead and stay ahead, use your head.
Honest Politician: One who stays bought.
Here I run, to steal the secret of the sun.
Mistakes are often the stepping stones to total failure.
So dumb: Chewing the stick, not sucking the lollipop.
Life's a beach and still you always marry one.
I'm incredibly jealous, but still glad for you.
You can never stand still nor go backwards in time.
All those updates, and still imperfect.
Where there is a stink feces there is the odor of being.
Defeat even explained well stinks.
Strange but not a stranger...
Keep grandma off the streets -- legalize bingo.
Remember, the paper is strongest at the perforations.
Never try to out stubborn a cat.
Taxidermy Cafe: Let us stuff you.
Some people are born stupid, others work to acquire it.
Sleep is a poor substitute for caffeine.
If you wish to succeed, consult three old people.
You can judge the success of a man by his bodyguards.
The only road to success is always under construction.
8 of 10 people suffer hemorrhoids the other 2 enjoy them.
Like winter snow on summer lawn, time past is time gone.
Yeah...and some day the sun will die out.
A smile is the sunshine that is a part of life.
Tell me, am I supposed to be pleased or frightened?
When we are not sure, we are alive.
There is only one sure way to throw dice: away.
Half a loaf is surely much better than no vacation at all
Surly to bed, and surly to rise.
Fishing is a delusion surrounded by liars in old clothes.
To keep your milk sweet, leave it in the cow.
Why don't many cats swim?  Why don't many fish fly?
Is a  PC a symbol of Immaculate Contraption?
Corruption. The most infallible symptom of liberty.
Error finding COLD BEER. Sysop not loaded.
OFF-line mail make sysops happy.
Talk about memory, this system includes a sense of guilt.
The proof of a system's value is its existence.
I know a good tag line when I steal one.
Do not remove this tag under penalty of death.
Movement To Ban Silly Tag Lines; Send donations to:
Tagito ergo sum  (I Tag, therefore I am).
Quick, I need a tagline, let me steal yours.
You may use this tagline 30 days before registering.
This rerun due to Tagline Writer's strike.
I almost stole another tagline. I'm so ashamed.
Show me a good tagline... And I'll steal it.
Beep. Invalid Input.  I take only cash.
It is when you take for yourself that you truly take.
Clean mind, clean body:  Take your pick.
I'm sure we can talk things out like uncivilized people.
Bore: A person who talks when you wish him to listen.
Today I have grown taller from walking with the trees.
A vote on the tally sheet is worth two in the box.
De los sos ojos tan fuertemientre lorando.
Drive defensively.  Buy a tank.
There's no accounting for taste.
Paul Revere was a tattle-tale.
Pee-Wee's favorite baseball team --> the Expos.
An actor without buck teeth can play the Easter Bunny.
Operator!....Trace this call and tell me where I am.
Is someone trying to tell you something?
Freedom begins when you tell Mrs Grundy to go fly a kite.
The Poles are now telling free market jokes.
Lead me not to temptation, I enjoy finding it myself.
"C.I.A." -- A contradiction in terms most of the time.
Engraving is, in brief terms, the art of scratch.
A mind is a terrible thing to taste.
A waist is a terrible thing to mind.
Biography: One of the terrors of death.
Never eat anything larger than your head.
Some cures are worse than the disease.
Some farewells are easier than others.
Never settle for less than your best.
Here is further away than you think.
The heart is wiser than the intellect.
"Wagner's music is better than it sounds."
My widget is better than yours simply because it's MINE.
Running Windows is better than washing them.
Taxation is little more than legalized extortion.
Men are more sentimental than women. It blurs their minds.
Carelessness does more harm than a want of knowledge.
Imagination is more important than knowledge.
People who stagnate rather than evolve are almost dead.
The only thing worse than a sorcerer is his apprentice.
Better to understand little than misunderstand a lot.
Art is a lie that makes us realize the truth.
How wise are they that are but fools in love.
I may be stupid, that still makes me smarter than you.
The only certainty is that nothing is certain.
In making decisions, recall that the trend is a friend.
Don't keep doing things that can't work.
Restaurant: An eating place that does not sell drugs.
If you explain so that nobody misunderstands, some will.
When you find anything that works, it usually fails.
Reality is for those that can't handle drugs.
The worst hatred is that of relatives.
No matter how large that drive is, it'll never be enough..
Never invest in anything that eats or needs painting.
Oh, pardon me, was that *your* culture?  So sorry.
They do not love that do not show their love.
Hey. Don't pick up that phoׯች  NO CARRIER.
A diploma proves only that you know how to find an answer.
Nothing is so smiple that it can't get screwed up.
Nothing is so good that somebody will not hate it.
Oh, I'm sorry, was that your hard drive.
Sailors curse the rain that farmers prayed for in vain.
Challenge is the fuel that drives the winner.
Fear is the tax that conscience pays to guilt.
Many kiss the hand that they wish they could bite off.
Poker Face: The face that launched a thousand chips.
There are three things that come next, uh four.
We read to say that we have read.
He who wonders discovers that this in itself is wonder.
What do you mean that my urine sample is too small?
I distinctly remember forgetting that.
People will buy anything that's one to a customer.
You can't fool me, that's DIRTY DANCING, I see.
You tell 'em Cat, That's what you're fur.
Gravity is a myth, the Earth sucks.
I need a drink...where's the SPACE BAR?
Many receive advice, only the wise profit from it.
Kin:  An affliction of the blood.
Always take aim at the Tidy Bowl Man.
The only argument with the wind is to put on a coat.
When the bad combine, the good must associate.
The highest bidder catches the most politicians.
Take the bull by the hand, and don't mix metaphors.
Some bosses call passing the buck delegating authority.
Any day can be the beginning of a new year.
Any fool can tell the truth, it takes sense to lie well.
Help!  I can't find the "ANY" key.
When we can't dream the time for death has arrived.
If you can't stand the heat, stay out of the kitchen.
The wildest colts make the best steeds.
In the country of the blind, the one-eyed man is king.
The woman cries before the wedding; the man afterward.
A short cut is the longest distance between two points.
Monday:  The day after the football game.
Experience varies directly with the equipment ruined.
The best doctor is the one you hunt for and can't find.
Predestination was doomed from the start.
When CPR fails, does the doctor order "Barium?"
You can't fall off the floor.
UFO's are for real: the Air Force doesn't exist.
Ask not for whom the bell tolls the answer can be deadly.
Be a friend to the earth and it will be a friend to you.
A true friend is the best possession.
Graveyards are full of the indispensable.
Quick.  Operator.  Give me the number for 911.
A gun gives you the body, not the bird.
When you go to the market, use your eyes, not your ears.
ATTENTION ..............Elvis has left the echo.
Penguin: The headwaiter of the Antarctic.
Go to hell is the only answer a snooper's question rates.
He who hesitates at the wrong time is lunch for a shark.
No Commander, I meant the OTHER battleship.
Don't shoot! I'm only the Casio player.
Just when I've found the answer, you change the question.
Scrute the inscrutable;  eff the ineffable.
Iron sharpens iron; scholar, the scholar.
Real knowledge is knowing the extent of one's ignorance.
The sun is never the worse for shining on a dunghill.
Genealogists do it in the library.
Sailors do it upon the waves.
Don't Panic. Just push the Reset button.
Press any key - i.e. the key with  "ANY"  on it.
Status Quo--Latin for the mess we are in.
If you lie to the computer, it will get you in the end.
May you live all the days of your life.
Wisdom of many and the wit of a half.
A good marriage outlasts the first box of dental floss.
Positive: Being mistaken at the top of one's voice.
Art does not reproduce the visible; it makes visible.
Ethics is not necessarily the handmaiden of theology.
F r o m  the  s l o w  s p e a k e r s  o f  A m e r i c
Beauty is often in the thighs of the beholder.
To the old cat, the tender mouse.
Antonym:  The opposite of the word you're searching for.
A good organizer is the one who is careful to plan ahe
The fewer our wants, the more we resemble the gods.
Faith goes out through the window when beauty comes in.
It's not over until the FAT table sings.
The trodden path is the safest.
If the people lead, the leaders will follow.
Resort: A place where the tired grow more tired.
Solve the problems of the world: Vote anarchist.
The best prophet of the future is the past.
The only realities are the atoms and empty space.
I never rise above the noise and confusion.
Marriage, a romance but the hero dies in the 1st chapter.
All rivers run into the sea, yet the sea is not full.
Love and scandal are the best sweeteners of tea.
If you search for the unknown, expect to be surprised.
The meek shall inherit the earth, but no mineral rights.
No one should test the depth of a river with both feet.
Better the shoulder to the wheel than the back to the A If
Nature always sides with the hidden flaw.
Always be smarter than the people who hire you.
I'm lost somehere in the ozone again.
Politics is stealing from the many and giving to the few.
The buck stops here, the doe just visits.
The buck stops at the desk over there.
A true subwoofer makes the concrete shake beneath you.
If you take away the fuel, in time the flames will die.
It's love that makes the world go round.
I think that I'm the friendliest guy in my zipcode.
The bigger the bankroll, the tighter the band around it.
The deeper the sorrow, the less tongue hath it.
The greater the ignorance the greater the dogmatism.
The longer the title, the less important the job.
Society prepares the crime; the criminal commits it.
The incomprehensible thing about the world is that it is.
Pay attention! This is the mother of all taglines.
Press <ESC> to load the BBS, or <ALT>+H for an IQ test.
It's easier to curse the candle than light the darkness.
It's OK to wear the same thing every day: a smile.
Don't try to have the last word.  You might get it.
Surprise due today.  Also the rent.
A little truth helps the lie go down.
Sometimes the truth is the worst horror.
The future's uncertain and the end is always near.
Errors show up in the duplicate while the Boss reads it.
To live well, know the difference between good and evil.
Save the whales. Collect the whole set.
Friend: Anyone who has the same enemies you have.
The client who pays the least, always complains the most.
Bigamist: One who makes the same mistake twice.
The only winner of the War of 1812 was Tchaikovsky.
Your sweet words suck the morning dew off the honeysuckle.
Hospital: A workshop for the repair of faulty humans.
Attack long worms from the rear - that is so much safer.
"Ward, I'm worried about the Beaver."
What can you compare the universe with?
Remember, if you win the rat race, you're still a rat.
Sit down, you're rocking the boat.
Don't hate yourself in the morning - sleep till noon.
Node: Was aware of.  The past tense of "know." 
People, not dogs, sell their souls for money or power.
Programmers do it with their fingers.
Mud slinging politicians clod their way to the top.
No one should hide their true self behind a false face.
Birds are trapped by their feet, people by their tongues.
If you can't convince them, confuse them.
1st Amendment Rights: use them or lose them.
Why do they call them briefings when they take so long?
Onion ring to rule them all, onion ring to bind them.
If people listened to themselves, they would shut up.
Against stupidity, the Gods themselves, contend in vain.
We're all different, but then again we're all the same.
Some nonsense now and then is relished by the wisest men.
First, draw the curve; then, plot the data.
When all think alike, then no one is thinking.
If everyone  thinks alike then somebody isn't thinking.
When everyone thinks alike, then everyone is stupid.
Politicians profit by confusing theories with conditions.
Behind an able man, there are always other able men.
Public opinion flourishes where there are no ideas.
Opinions expressed here or there are not necessarily mine.
If it is not there, it must be here, or it doesn't exist.
Anybody can win, unless there is a second entry.
Can't see it? It's there.  I'm using stealth technology.
Where there's a will, there's an Inheritance Tax.
When you get there, there's no there there.
Does anyone really read these stupid taglines?
Every idiot believes that they are Cassandra.
When agnostics die, do they go to the Great Perhaps?
Angels can fly since they take themselves lightly.
Things are more like they used to be than they are now.
Old musicians never die, they just decompose.
Old soldiers never die, they just fade away..
Tact: Describing others as they see themselves.
Really stupid people believe they are intelligent.
Hire a teenager while they still know it all.
Blessed are the censors; they shall inhibit the earth.
Where are those flashbacks they promised me?
Old programmers never die.  They branch to a new address.
Computers are not intelligent.  They only think they are.
If it was easy, they'd send someone else.
Waste is a terrible thing to mind.
The truth is one thing that nobody will believe.
It's the kind of thing that makes people go "Hmmmmmm.."
There ain't no such thing as a free lunch.
There is no such thing as bravery; only degrees of fear.
Memory is the second thing to go during the human story..
An ass thinks one thing, his rider another.
I only wrote the thing, I don't have to understand it.
Don't sweat the petty things, just pet the sweaty things.
You don't have to think too hard when talking to teachers.
Cogito, ergo Hormel - I think, therefore I Spam.
Golly, Yogi, I don't think Mr. Ranger's gonna like this.
Being punctual makes people think you have nothing to do.
Cogito ergo spud!  (I think, therefore I yam).
I'm a thinker, I think, but I may be wrong.
Shamed be he who thinks evil of it.
Coward:  One who in thinks with his legs.
<tap> <tap> <tap> Is this thing on? 
Do not cut along this line ------------------------------.
Let me know if this message doesn't get through to you.
Okay Okay - right after this one we're BACK to the TOPIC!
The UARTs won't take this speed, Captain.
Gee, I wonder what this key does.
Who's the designated driver? This mouse is loaded.
The only roses without thorns are love and friendship.
The greatest headaches are those we cause ourselves.
Those who can, do.  Those who can't, simulate.
Words are not food, though sometimes we must eat them.
I got lost in thought.  I was in unfamiliar territory.
A penny for your thoughts; $20 to act it out.
A journey of a thousand miles begins with a cash advance.
Red, white, and blue. Three colors that only run forward.
There was this veil through which I could not see.
Trust God, but always tie and watch your camel all night.
My genes are so tight, they may stay with me forever. 
Bug free, cheap, on time, works. Pick two. 
Try to divide your time evenly to keep others happy.
There's no future in time travel.
I don't have the time for a hobby.  I have a computer.
She devotes her spare time to neglecting duties.
Time goes? No.  Alas time stays, we go.
Off by CRASHING COMPUTER. Time Logged:  ^D!@#$%^(*&^%^Z.
Computers also eliminate spare time.
The test: Behavior in times of controversy and challenge.
The best blood at times gets into fools and mosquitoes.
Great minds may at times think alike, if at all.
For sale: Hourglass for timing Windows.
The law of intelligent tinkering: save all the parts.
First rule of intelligent tinkering: save all the parts.
America is a dream to most of the world.
Tax Shelter- A way to spend a buck to save fifty cents.
Keep emotionally active. Cater to your favorite neurosis.
It is always easier to destroy than to create.
One lie always leads to another almost automatically.
Shame is an ornament to the young, a disgrace to the old.
Today, take an astronaut to launch.
Born free and taxed to death.
Old birds are hard to pluck.
All humans are subject to decay.
The best armor is to keep out of range.
All I ask is to prove that money can't make me happy.
Men avoid attributing cleverness to others unless enemies.
It is bad luck to be superstitious.
Mosquito: Designed by God to make flies seem better.
If you can't learn to do it well, enjoy doing it badly.
Why don't cats like to swim?  Why don't many fish fly?
The greatest cunning is to have none at all.
Computer: a device designed to drive human beings insane.
Married politicians do it to wife and country.
It is double pleasure to deceive the deceiver.
Did you ever stop to think, and then forget to restart?
To tolerate everything is to teach nothing.
The greatest fault is to be conscious of none.
Sandwich: An faulty attempt to make both ends meat.
Collector: Person few care to see but ask to call again.
Heaven allows glimpses only to those at a distance.
Can I go back to bed now?
Jury: A group chosen to decide who has the best lawyer.
Only the hand able to  erase can write the truth.
To give happiness is to deserve happiness.
Why should I have to pay a troll just to cross a bridge?
We are in bondage to the law so that we may be free.
A "program" is used to turn data into error messages.
To err is human, to forgive is against company policy.
To iterate is human;  to recurse, divine.
A miser is hard to live with, but makes a fine ancestor.
To speed is human; to get caught, de fine.
The time is right to make new friends.
The world is coming to an end --- please log off now.
The Ranger isn't going to like it, Yogi.
Forget *HIM* it's time to run a *HER* for president.
Nobody else knows what to do either.
Even the lion has to protect himself against flies.
There are many ways to show affection.
Just send my paycheck to MasterCard or VISA.
Angling: The name given to fishing by non-fishermen.
Stealth means never having to say you're sorry.
Another good night not to sleep in a eucalyptus tree.
I do not pretend to know what the ignorant are sure of.
It is not enough to succeed.  Others must fail. 
To risk nothing is to risk everything.
Adult:  One old enough to know better.
To be or not to be...  What a stupid question.
To refuse praise is to seek praise twice.
SYSTEM ERROR:  press F13 to continue.
Obesity: A surplus gone to waist.
Remember, it takes two to play peekaboo.
Remember, it takes two to share a kiss.
Remember, it takes two to dance the tango.
It usually takes weeks to prepare an impromptu speech.
A pitcher that goes to a well too often is broken first.
What is the world to a man when his wife is a widow?
Today is the day to bribe a high-ranking public official.
There was this door to which I found no key.
Everybody wants to go to heaven, but nobody wants to die.
But God told me to use a GOTO.
It's never too late to have a happy childhood.
If you're too old to learn, you were born so.
That's right, try hard to be good at the game of life.
Tweedledum and Tweedledee agreed to have a battle.
There are two sides to a question, politicians take both.
Genealogy: tracing us back to the same brother & sister.
If you want someone to keep a secret, keep it yourself.
Enough research will tend to support your theory.
This fellow's wise enough to play the fool.
Why can't women remember to put the seat back up?
What's the world coming to when your monitor stares back.
Surprise the world.  Get to work on time today.
Meester, do you vant to buy a duck?
This tagline is SHAREWARE! To register, send $20.
Where's there's smoke, there's toast.
Attention K-Mart shoppers, today the special is...
Someone whom you reject today, will reject you tomorrow.
Tell no big lies today.  Small ones are just as effective.
Leakproof seals, will. Quiet toilets, aren't.
Never put off till tomorrow what you can ignore entirely.
I'll worry about it tomorrow.
The pen is the tongue of the mind.
Don't feed the bats tonight.
Mischief all comes from too much opening of the mouth.
Don't follow this message too closely.
Camels have wet dreams too.
Sharper than an asp's tooth to have a thankless child.
I may not be totally perfect, but some parts are OK.
When the going gets tough, the tough go shopping.
I like the 486 tower.  Does it come in red?
The child had every toy his father wanted.
Shake off your heavy trance! And leap into a dance.
90% of any business transaction is selling yourself.
A seminar on Time Travel will be held two weeks ago.
Do not attempt to traverse a chasm in two leaps .
A great many family trees were started by grafting.
Revolutions are not about trifles, but from trifles grow.
BBS: a method to triple your phone bill.
Old age & treachery triumph over youth & vigor.
Prevent computer viruses. Install Trojans!
No generalization is wholly true, not even this one.
The mark of a true MBA : often wrong, but seldom in doubt.
All sentences that seem true should be questioned.
A wise shepherd never trusts his flock to a smiling wolf.
Knowledge rests not on truth alone, but upon error also.
Time is precious, but truth is more so.
Abandon the search for truth: settle on a good fantasy.
To excel when you try, always reach for the brass ring.
Out of string space?  Try Scotch Tape.
Network management is like trying to herd cats.
Piano tuners do it twice a year.
I have to think twice before I give it a second thought.
I just escaped the twilight zone and fell into the 0zone.
No man can serve two masters, yes-men can serve hundreds.
The shortest distance between two puns: a straight line.
Avant-Garde Narrow: a typeface for the broad-minded.
Please don't feed the typesetter.
Where law ends, there tyranny begins.
Madre que consiente engorda una serpiente.
Our future is always uncertain our end is always too near.
A jug is carried under your coat for a dishonest reason.
EXPERT - Some unknown drip under pressure.
Be careful when playing under the anvil tree.
This country needs more unemployed politicians.
Winning is a habit.  Unfortunately, so is losing.
Lurkers of the world unite!
Never tell a lie, unless lying is your strongest point.
The truth doesn't hurt unless it ought to.
Nothing is ever constant, unless it is dead.
Bachelor: Plays the field until the field comes in.
The flogging will continue until the morale improves.
Theater: Holding a mirror up to a keyhole.
Hey, wait, don't pick up that ph#{#!@#$%^&*()=.
Ever since I gave up hope, I feel much better.
As I was going up a stair, I met a man who wasn't there.
Message sent. Destroy immediately upon receipt.
Even a philosopher gets upset with a toothache.
"Scotty. hurry. beam me"  uragg^* NO CARRIER.
The best government teaches us to govern ourselves.
To wake a tiger, use a long stick.
At least I can use his code as a bad example.
If speed scares you, use Windows.
Misspelled?  No way!  I use an error-correcting modem.
Synonym: A word you use when you can't spell the other.
Take what you can use and let the rest go by.
Entropy isn't what it used to be.
Nostalgia isn't what it used to be.
An unbreakable toy is useful for breaking other toys.
Not Ready Error reading user's mind.
The end is what usually justifies the diet.
If stupidity had survival value, he would live forever.
Marriage, is a lifelong venture, approached with caution.
A poet reading his verse in public has a nasty habit.
Folks who have no vices have few virtues.
GIVE: Support the helpless victims of computer error.
Si jeunesse savoit, si vieillesse pouvoit.
Thrift is a wonderful virtue - in an ancestor.
Language is a human virus from outer space.
Oh no, not deja-vu again. Oh no, not deja-vu again. Oh no 
W)here Y)our S)tupid I)nterface W)eathers Y)our G)enius.
O oysters come and walk with us, the walrus did beseech.
One family builds a wall, two families enjoy it.
Give them all they want, and all they will want is more.
For something you really want, the price is always high.
Modem: Deterrent to receiving wanted and unwanted calls.
Winning isn't everything, but wanting to win is.
Conscience: the inner voice warning somebody is looking.
I don't need a warranty. I'll just take it back..
Holy Razorblades, Batman.  That was a close shave.
Climbing my family tree was fun, until the nuts appeared.
Please, forget that, I was just going to start eating.
Desk: A very large wastebasket with drawers.
Most allies must be watched just like the enemy.
A person with two watches is never sure what time it is.
Hot water heaters?    Hot water needs heating?
Blood is thicker than water, and much more tastier.
But you Thaid it wath a PITH helmet!
Curly; " Oooh, short wave?"  Moe: "No, permanent."
Logic is an organized way of going wrong with confidence.
When everything comes your way, you're in the wrong lane.
Be nice on your way up you'll meet again on the way down.
Selfishness is a vice we see it only in others.
We ask advice but we mean approbation.
Other things change, but we start and end with family.
All power corrupts, but we need electricity.
We NEVER grow up, we just get older, and older.
May we kiss those we please, and please those we kiss.
Evil is a hill.  We stand on ours, speak about others.
Toto, I've a feeling we're not in Kansas any more.
Check the dilithium crystals, we've got a cross-echo.
Imagination is the one weapon in the war against reality.
It is better to wear out than to rust out.
Lotus executives do not wear Look & Feel T shirts.
Nudists are people who wear one-button suits.
Smile if you are wearing sexy underwear.
As I said last week, I'll be done tomorrow. 
Nature, like people, sometimes weeps for gladness.
When the going gets weird, the weird turn pro.
All's well that ends well.
Docs? Last time I went, I got nasty tasting medicine.
Really get stoned, drink wet cement.
If I save the whales, where do I keep them?
The law disregards trifles, what is this dessert called?
Read the docs? Wow, what a radical concept.
A billion dollars isn't what it used to be.
We most firmly believe what we least know.
The mind grows by what it feeds upon.
Words and ideas are what change our world.
Anything free is worth what you pay for it.
The future is not what it used to be.
The past is not what it will be.
After they make styrofoam, what do they ship it in?
That will teach exactly what to whom?
Disco is to music what Etch-a-Sketch is to art.
Too stupid to know what I'm involved in.
When angry, count four; when very angry, swear.
A good dog barks when told.
Good advice is given when too old to set a bad example.
The answer is easier when the question is hypothetical.
Superior firepower is invaluable when negotiations start.
All human life ends when you take a "dirt nap."
Toil is most pleasant when done.
Hunting is no fun when the rabbit has the gun.
PCs are OK except when you use them as bowling balls.
Nothing is very funny when you're underneath it.
Black holes were created when God divided by zero.
Conscience is what hurts when everything else feels good.
A man who smiles when things go wrong knows who to blame.
Experience: what you get when you don't get what you want.
Praise: What you receive when you are no longer alive.
Security is a game where final goal is never reached.
Only I can tell where my own shoe pinches me.
If you don't care where you are, then you can't get lost.
Make two grins grow where there was only a grouch before.
Where no man has.. where no ONE has.. to hell with it.
Psychic Con: You know where and when.
Every why hath a wherefore.
Good night, Mrs. Calabash, wherever you are.
There isn't a door which can stop a lover or a cat.
Brain:  The apparatus with which we think that we think.
Menu: List of dishes which the restaurant has run out of.
Childish Game: One at which your spouse beats you.
Does it really matter which cola I drink?
Dew is the tears which the stars weep.
Faith will not die while seed catalogs are printed.
Oh, my ears and whiskers, how late it's getting.
An alcoholic: A person who drinks more than his physician.
Bureaucrat, n.: A person who cuts red tape sideways.
All hope abandon ye who enter messages here.
Abandon hope, all ye who <ENTER> here.
Only they can conquer who believe they can.
Reality: Crutch for people who can't read science fiction.
Work is for those who have nothing better to do.
Fortune truly helps those who are of good judgment.
An authority is anyone who guessed right more than once.
A professor is one who talks in someone else's sleep.
Strength of mind: Person who can eat one salted peanut.
God dislikes money -- look who he gives it to.
He is no lawyer who cannot take two sides.
Rule of Order: He who shouts the loudest has the floor.
An agreeable person: One who agrees with you.
An honest politician: One who stays bought.
It's a poor workman who blames his tools.
It's a poor cook who cannot lick his own fingers.
Sculptor: A poor unfortunate who makes faces and busts.
Criminal: The poor guy who gets caught.
Sinner: A stupid person who gets found out.
Efficiency takes time.  Frugality: who can afford it?
He is truly wise who gains wisdom from another's mishap.
Money is truthful.  Men who speak of honor must pay cash.
If I were you, who'd be me?
This mouse is loaded, who's the designated driver?
Everybody's a programmer, but who's WRITTEN anything?
Redneck: (n); a person whose family tree doesn't fork.
That man is richest whose pleasures are cheapest.
If God is perfect, why do discontinuous functions exist?
Where are we going? Why am I in this handbasket?
No person ever became wicked all at once.
Dancing with a grass widow brings on hay fever.
Any sufficiently advanced bug will become a feature.
Have an affair.  It will break up the monogamy.
Do well and you will have no need for ancestors.
They who drink beer will think beer.
Day of inquiry.  You will be subpoenaed.
Look after molehills mountains will look after themselves.
Future looks spotty. You will spill soup in late evening.
Blessed our young they will inherit our national debt.
It's not if you win or lose. It's placing the blame.
They that sow the wind, will reap the whirlwind.
Can bankers count? Eight windows and only four tellers?
Solution Series: Works for Windows, Publisher and Money
Error:015 - Unable to exit Windows. Try the door.
One day I'm a windshield, the next day a bug thereon.
If you pull the wings off a fly, does it become a walk?
You will be a winner today. Fight with a four-year-old.
It is Fortune, not wisdom that rules man's life.
It's amazing how mature wisdom resembles being tired.
Are you a good witch, or are you a bad witch?
Hex Dump:  Place for witches to get rid of used curses.
Never hit a man with glasses.  Use your fist.
Ground Beef -- A cow with no legs.
If you can't dazzle with dexterity, feed them a crock.
Every human comes equipped with a brain at no extra cost.
Xerox never comes up with anything original.
Are those cookies made with real Girl Scouts?
An electrical engineer deals with current events.
May the force be with you.
Only adults have difficulty with childproof caps.
Priests do it faithfully with Masses.
I am not arguing with you, I'm telling you.
Master debaters often argue with themselves.
Promises and performances vary with hopes and fears.
Marketing is simply sales with a college education.
I want to live with a synonym girl.
His face was filled with broken commandments.
Software independent: Won't work with ANY software.
To be a human without passion is to be dead.
A gentleman can disagree without being disagreeable.
Good printers do it without wrinkling the sheets.
You cannot kill time without injuring eternity.
Specifications subject to change without notice.
Never trust a smiling wolf to tend your sheep.
Beauty seldom recommends one woman to another.
Eve was the first woman to date a snake.
It's better the world wonder why you *AREN'T* President.
An open mind is wonderful if matching mouth not included.
Don't use a big word where a diminutive one will suffice.
My profession?  Does the word "peon" mean anything to you?
Actions speak louder than words -- but not so often.
Hummingbirds never remember the words to songs.
He compresses the most words into the smallest ideas.
Funny thing.... harder I work, luckier I get.
Other than it doesn't work, it works fantastic for me.
Bless the peacemakers their work will never end.
Greed is good, greed works.
I'm ok, it's the world that's skrewed up.
Among economists, the real world is often a special case.
Be Alert -- what the world needs is more LERTS.
There is always someone worse off than yourself.
Things could only be worse in Cleveland.
If worst comes to worst, you *CAN* turn most things off.
A teetotaller makes the worst drunkard.
Not all bugs are worth fixing.
A verbal contract isn't worth the paper its written on.
Anything worth doing, is worth doing for a profit.
Everything free is usually worth exactly what it cost.
A lawyer's opinion is worth nothing unless paid for.
Trust only those who would lose as you if things go wrong.
Printers do it without wrinkling the sheets.
Those who can't write, write manuals.
Execute program code from Write Only Memory.
A good man gone wrong is usually a bad man found out.
Apology is only egotism wrong side out.
Nothing can go wrong...go wrong...go wro*%$@# NO CARRIER.
I can't believe I wrote that whole thing.
Honi soit qui mal y pense.
It takes about 10 years to get used to how old you are.
Is it OK to yell 'MOVIE' in a crowded firehouse?
Today's "politically correct" = yesterday's McCarthyism.
Life is a yo-yo, and mankind ties knots in the string.
What the !@#$ were you expecting for me to put here?
You tell 'em Chloroform, you can put them to sleep.
You tell 'em Electricity, you can shock 'em.
You tell 'em Cemetery, you are so grave.
You tell 'em Skyscraper, you have more than one story.
You tell 'em Horse, you carry a tale.
You tell 'em Shoemaker, you know awl.
To climb a ladder, you begin with the bottom rung.
To know a culture you must dirty your feet in its soil.
Isn't it about time you backed up your system?
Tell me again why you named your kid "Rasputin?"
To excel at what you do, you must love doing it.
It works better if you plug it in *AND THEN* turn it on.
Sure I can help you out, which way did you come in?
Drop your carrier...We have you surrounded.
Talk is cheap, until you hire a lawyer.
On a clear disk you can seek forever.
Wear old clothes when you fight for truth and liberty.
If you continually give you will continually have.
It's always darkest before you step on the cat.
Tax reform: Don't tax you or me, tax that fellow there.
Celebrate the first day you open the windows.
How time flies, when you have a heap of problems.
Wedding: A funeral where you smell your own flowers.
Anytime things go better, you have overlooked something.
Since life goes on - you might as well get on with it.
I don' gotta show you no steenking tag line.
When you gotta go, you gotta go!
Call waiting, great if you have two friends.
Dilate: What happens when you live too long.
My computer has EMS....Wont you help?
Tonight, no hostages for you and no prisoners for me.
I'm more humble than you are.
A conclusion is where you got tired of thinking.
A friend is something you earn.
Software, hardware, -- is that you talking Sigmund?
You never know unless you ask, answer not guaranteed.
You'll never know until you ask the right source.
It doesn't matter if you win, it's the point spread.
Remember: No matter where you go; there you are.
Recycle: For me, for you, for them, and them, and them.  
How much memory have you got?  One brain, one memory.
If it's more than you need, it's greed.
A person never tells you anything until contradicted.
It's been nice meeting you, and nicer to see you leave.
The luck ordained for you will be coveted by others.
On the other hand, you have different fingers.
Take egotism out, and you castrate the benefactors.
If three people say you are an ass, put on a bridle.
It's 11:56 pm. Do you know where your modem is?
He was so crooked you could use him to pull corks with.
You win some and you lose some. But think qualitatively.
"Honey?" is that what you call this bee barf?
By following the good, you learn to be good.
Its not the thing you fling, its the fling itself.
Never tell them what you wouldn't want to do.
If you throw mud,  you will have dirty hands.
How many times do you need to be tolled anyway?
Never do today what you can delegate tomorrow.
MacIntosh:Computer with training wheels you can't remove.
Beware of true believers you may be duped by a false god.
Resistance is useless,  if you have no volts or amps.
In God we trust, you pay in gold.
Tilting at windmills hurts you more than the windmills.
Thought I wouldn't notice you sneaking off, eh?
You tell 'em Envelope, you're well posted.
You tell 'em Bank, you're safe.
You tell 'em Dictionary, you're full of information.
You tell 'em Dough, you're well bred.
You tell 'em Moon, you're out all night.
You tell 'em Cigarette, you're lit up.
You tell 'em Piano, you're upright and square.
Wherever you came from, you're not there now.
"If he catches you, you're through" - Road Runner.
CPU time flies when you're having fun.
Never eat prunes when you're famished.
"Who cares for you? You're but a deck of cards," -Alice.
You tell 'em Operator, you've got their number.
You tell 'em Clock, you've got the time.
You tell 'em Brake, you've got the drag.
You tell 'em Butcher, you've got a lot of tongue.
You tell 'em Cabbage, you've got the head.
You tell 'em Calendar, you've got lots of dates.
You tell 'em Dentist, you've got the pull.
You tell 'em Doctor, you've got the patience.
You tell 'em Teacher, you've got the class.
You tell 'em Banana, you've been skinned.
You tell 'em Goldfish, you've been around the globe.
You tell 'em Gambler, you've got winning ways.
Screw up your courage!  You've screwed up everything else.
That should clear out your sinuses.
Justice:  A decision in your favor.
Justice: A decision in your favor.
Don't you feel that your salami is on the chopping block?
Choose your friends, allow your enemies to choose you.
Daisy, Daisy, give me your answer true.
Sex is hereditary. If your parents didn't, you won't.
It all hinges on your definition of 'a good time'.
Do you know where your ancestors were and what they did?
Virtual: not knowing where your next byte is coming from.
You are magnetic in your bearing.
Be self-reliant and your success is assured.
Get nowhere: Sit on your butt feeling sorry for yourself.
Overestimation: Thinking that all your geese are swans.
I'm doing this for your own good.
Best way to keep your friends: don't give them away.
I am tolerant of your fruitcake like beliefs.
Someone is unenthusiastic about your work.
Are you waiting for your prey?
Hide when you bite your nails, or everyone will wonder.
Don't sell yourself short, your wisdom is worth 2 cents.
Good health will be yours for a long time.
What is learned in youth is understood in age.
REALITY.SYS corrupted -- Reboot UNIVERSE [Y,n]?
I am Ewmah of Bohg.  Assimiwate da wabbit.
I am Fudd of Borg.  Pwepare to be assimiwated.
I am Flintstone of Borg. You will be yabbadabbasimilated.
I am E.T. of Borg.  Home is irrelevant.
I am Clinton of Borg. Campaign promises are irrelevant.
George Bush of Borg: Read my lips...Resistance is futile.
Robin of Borg: Holy futility, Batman! We're assimilated!
Borg?! Where? I don't see any%Whatever(|!NO CARRIER
It's the Borg!! Quick, everyone try to look useless!
I am Opie of Borg.  Can I assimilate 'em, Pa?
I am Dirty Harry of Borg. Go ahead...resist us...
We are Wayne and Garth of Borg...Resistance is futile Dudes! NOT!
The Borg Bunny....It keeps assimilating and assimilating and assi....
Borgasm: The ecstasy of assimilation.
Borg Mail Reader v2.1a * Tagline theft is futile.
Borg Simpson: Assimilate my shorts!
Borg Spreadsheet Program - Locutus 1-2-3
I am Beavis of Borg. Assimilation is COOL, huh huh huh huh.
I am Homer of Borg. Prepare to be ... oooooohh, doughnuts..
I am McMahon of Borg. You may already have been assimilated
I am Microsoftus of Borg. You shall be slowed.
I am Shakespeare of Borg.  Prepare to be, or not to be assimilated.
I am Socrates of Borg.  You shall be.
I am Tweety of Borg.  I tawt I attimilated a Puddy Tat!
If Humans have orgasms do the Borg have borgasms?
Locutus on Pontiac; speed is irrelevant.
Rush LimBorg: All other opinions are irrelevent.
Your tagline has been assimilated.  -  BorgReader
Inform Starfleet we have engaged the Borg. Wedding on Saturday.
I am Hillary of Borg.  Bill is irrelevant.
I am Barney of Borg.  You will be nauseated.
McBorg:  Over 50 Trillion Assimilated!
I am Gilligan of Borg. Escape from the island is futile
Borger King: We do it our way.  Your way is irrelevant.
You will use Windows. Resistance is Futile. ~ Borg
~ Borg Mail Reader v2.1a   Tagline theft is futile.
Ah'm Bubba o' Boahg.  Y'all fixin' t' be assim'lated.
I am Beavis, a Borg. Assimilation is cool. Heh-heh-heh
~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~  <MM Borg Fleet
"Lubricant. Pennzoil. Steaming hot." * Locutus of Borg
I am ButtHead, a Borg. Duh-Uh, Resistance sucks.
Yoooouuuuu'rreee Irrelevant!   Daffy Duck of Borg
Tennis is irrelevant. - Bjorn of Borg
If Ensign Ro were assimilated, she'd be a Bajoran Borg.
I am Rush of Limborg.  Liberals are irrelevant.
"I Can't Get No Assimilation"   Rolling Stones of BORG
I am Wesley of Borg.  Even THEY don't like me!
Puddy Tat's are iwelevent ~ Tweety of Borg
I am Jordon of Borg.  Gravity is irrelevant.
Barney o Borg:Today we learned that resistance is useless
I am Shakespeare of Borg-To be or not to be, assimilated.
Beware of the SmurfBorgs and Papa Locutus!
I was assimilated by the Borg and all I got was a T-shirt!
!!!teG I sdrawkcaB eroM ehT oG I sdrawroF eroM ehT
!(a+b) = !a * !b =0
"2nd star on the right, then on until morning"
"640K ought to be enough for anybody." - Bill Gate
"Admiral, there be whales here!"  ...  "Scotty, that's a \SLMR\TA
"Apple I" (c) Copyright 1767, Sir Isaac Newton.
"Beautiful story.  Kinda gets you right HERE!"  -- Q
"Besides, it is clearly a bunny rabbit!" -- Data
"Captain, Permission to hook up blender attachments to Mr\SLMR\TA
"Could you continue your petty bickering? I find it most \SLMR\TAGLIN
"Damage control is easy. Reading Klingon -- that's hard."\SLMR\TAG
"Dammit, Jim!  I'm a doctor, not a physician!"  -- McCoy
"Damnit Jim, I'm a doctor not a Tagline..."
"Data does it in serial..."  --Tasha Yar
"Data, I thought you were dead!" "No, sir, I rebooted.."
"Do you know any Klingon opera?"  - Worf
"Don't dispute death unless you've lived through it."  --\SLMR
"Drop the guy with the devil ears." -- NBC, June, 1965.
"Extra pickles.  A warrior's condiment!"  --Worf
"Extra pickles. A warriors condiment." -Worf
"Fire, Mr. Worf!"  <Worf picks up extinguisher>
"Flowers!  Is there a 'John Luck Pikkerd' here?"  --Q
"For there is no sea, with out the dolphin" -- Oppian
"He was a man, all and all, I shall not look upon his lik\SLMR\TAG
"He's a potato Jim!, Let's gouge out all of his eyes"
"Hey, Worf...I hooked Data up to a Modem...Wanna see?"
"I am programmed in multiple pleasuring techniques."  --D\SL
"I am what I am and that's all that I am" 
"I did it. I killed them all." Timothy
"I don't bite. Well, that's wrong. I do bite."  -K'Ehleyr
"I hate questionarres"-Worf
"I like my species the way it is." - Worf to Locutus
"I never lie when I have sand in my boots!" -- LaForge
"I think not," said Descartes; and promptly disappeared.
"I'm Beverly...","I'm Geordi...","We are Hugh..."
"I'm not the one that misplaced the Deltivid asteroid bel\
"If you prick me, do I not...  Leak?" -- Data
"Is that funny?  Is that a joke?"  --Data
"Is that lemon in your tea?"  "No, s'lime."
"It's comin' apart, Lad!" - Scotty
"Listen, have you seen the dolphins yet?" -Geordi
"Look at all the Indians!" - General Custer
"Modem," said the gardener when he'd finished the lawn..
"Mr. Worf, fire phasers at @FN@" ... Zzzzzap!
"Mr. Worf, fire!"  <Worf picks up extinguisher>
"My favorite part of dinner!"- Riker
"RESISTENCE IS FUTILE...." The Borg
"Scotty!  Beam me aboard!"  "Aye sir!  Will a 2x4 do?"
"Scotty, I've fallen and I can't beam up!"
"Scotty, beam me up another Blue Wave message."
"Scotty, beam us a board!" (2x4 drops from sky)
"Sex is better than reading; no overdue fines."  --Jean-L\SLMR\TAG
"Sir! Klingons on the starboard bow!" "Well, scrape 'em o\SL
"Such grudges.  Give us a kiss, Worf." - Q
"Take my Worf... please."  --Data
"That was the stun setting." <bleep> "This is not."
"That's no tagline!  It's Odo!"
"The Dolphin, ne'er has anything been more divine"-Oppian
"The above Statement is absolutely True." --God
"The security of the Enterprise is of Paramount importanc\
"They are not the hell your whales." - Spock
"We must laugh at man, to avoid crying for him" Napoleon
"Worf!  Still struggling up the evolutionary ladder?" - Q
$1000 reward for finding this man:
'Ah!  I have access.' --Data
'Only a vaRool would use such language in public.' --Rike
'Perhaps you and the jerko here could come with us.' --Lw
'Saddle up, father!' --Alexander, to Worf
'The universe is a spheroid region 705 meters in diameter\SLMR\TAGLIN
'Transporting really is the safest way to travel.' --Geor\S
(((((((HYPNOTIC)))))))(((((((TAGLINE)))))))
(A)bort, (R)etry, or (I)nfluence with hammer.
(C)ontrol (A)lt (B)ye
(Ice rocks hit the hull)  "Captain, we are being hailed."
(beep) Help, I've fallen and can't reach the beer.
* <-- Tribble   o <-- Jean Luc Tribble
* <-Tribble   <-Tribble after a close shave
* <-Tribble   <-Tribble after a close shave.
* This is a tribble.  # This is a tribble on drugs.
*/  <==-- Tribble with a lightsaber
--------------------- cut here --------------------------
----> If you cut here, you'll ruin your monitor. <----
--T-A+G-L-I+N-E--+M-E-A+S-U-R+I-N-G+--G-A+U-G-E--
... Scotty!, Hurry beam me u%#$&      NO CARRIER
... and eliminate and wipe out redundancy!
...and my special thanks to the Other Forty-Nine!
...and then I woke up!
...but what I really want to do is direct.
11th commandment - Covet not thy neighbor's 586.
15 of every stamp is for storage
186,000 miles/sec: Not just a good idea, it's the LAW.
1st we shoot all the lawyers, 2nd we strangle them, 3rd..
24 hours in a day and 24 beers in a case.  Hmmmm.....
2400 Baud makes you want to get out and push!!
320
33mHz ain't fast enough!
4 food groups: fast, frozen, microwaved, and junk
4 food groups: fast, frozen, microwaved, and junk.
43% of all statistics are worthless.
9600bps and under are insults to HST'ers -Hacker's law #5
:.::: ::..: ::.::.  :..:: Tagline in Braille
<%>{ 1 fish, <%>{ 2 fish, <%>{ red fish, <%>{ blue fish
<<---- THIS SPACE FOR SALE ---->>
<ZAP!> That was *not* manual override.  -- Data
>> BEER.CAN not found, USER.EXE not loaded <<
A 100% right of return both ways.
A BBSer's telephone bill knows no bounds...
A Thousand points of Broccoli!
A bird in the hand is safer than one overhead.
A cats worst enemy is a closed door.
A clean desk is a sign of a -sick- mind
A clean desk is a sign of a cluttered desk drawer.
A clean disk is the sign of a warped drive.
A clean, neat, desk is a sign of a very sick mind.
A closed mouth gathers no feet...
A committee has 6 or more legs and no brain.
A friend: someone who likes you even after they know you.
A lie that can be passed off as truth becomes truth.
A little nukie never hurt anyone!
A phaser is the universal communicator.  Worf
A phaser on stun is like a day without orange juice.
A piano is a piano is a piano. Gertrude Steinway.
A seminar on Time Travel will be held two weeks ago
A single fact can spoil a good argument.
A stitch in time would have confused Einstein.
A thick head can do as much damage as a hard heart.
A tribble a day keeps the Klingons away.........
A wise man once said.... I don't know...
A wok is what you throw at a wabbit.
A)bort R)etry G)et a stick and kill it.
AAAAA - American Association Against Acronym Abuse
ASCII and ye shall receive.
ASCII stupid question... get a stupid ANSI!
After we pull the pin, Mr. Grenade is NOT our friend!
Ah, come on, just this one last little feature.
Ah, my trombone.  Let me show you how it works.  Riker
Air Geordis - TNG footwear
Alex, I'll take "Things Only I Know" for $1000.
All I need to know I learned from my cat.
All babies speak Klingonese
All hope abandon, ye who enjoy tax forms.
All hope abandon, ye who enter messages here.
All programers are optimists.
Always proofread carefully to see if you any words out.
An ulcer is what you get mountain climbing over molehills
Ancient Greeks made dolphin-killing punishable by death.
And God said, "I'll buy a vowel."
Another nearly-full box of Smarties!!
Anything not nailed down is a cat toy...
Are they made from real Girl Scouts?
Are those cookies made with real Girl Scouts?
Are you prepared to defend yourself?
Artificial Intelligence is no match for natural stupidity
As I said before, I never repeat myself.
As easy as 3.14159265358979323846264338327950288419716
As long as I can remember, I've had amnesia.
Assumption is the mother of all screwups...
BASIC isn't; C stands for Confusing...
BBS: a method to triple your phone bill.
BREAKFAST.COM Halted... Cereal Port Not Responding.
Back Up My Hard Drive? I Can't Find The Reverse Switch!
Back Up My Hard Drive? I don't have a license yet!
Bad command or file name!  Go stand in the corner.
Barney and Baby Bop MUST DIE!
Be Nice to Your Enemies, It Drives Them Nuts.
Be excellent to each other..
Beam me aboard Scotty.  Aye, will a 2x4 do captain?
Beam me up, Scotty, This planet sucks!
Beam me up, Scotty, but leave the others here.
Beat me, whip me, make me read my Qmail!
Beauty is in the eye of the beer holder....
Beep! Invalid Input.  I take only cash....
Behaviorism is the art of pulling habits out
Behind every succesfull man is woman with nothing to wear
Best file compressor around: DEL *.* (100% compression)
Beware of Geeks bearing gifs.
Beware of programmers who carry screwdrivers.
Beware of quantum ducks.       Quark!     Quark!
Big things come in .QWK packages.
Biography: One of the terrors of death.
Blessed are the Greeks
Blessed our young they will inherit our national debt.
Boldly going Forward because we can't find Reverse!
Boldly going where no modem has gone before...
Borg Empire: Equal opportunity Assimilator!!!!
Borg saying: We came. We absorbed. We left.
Borg spreadsheet program:  Locutus 1-2-3
Borg spreadsheet: Locutus 1-2-3
Borg?  Where?  I don't se*(#$#..NO CARRIER
BorgBurgers - We do it our way; your way is irrelevant.
BorgBurgers: We do it OUR way. Yours is irrelevant
BorgDOS v5.0  - Assimilate Another? [Y/n]
Borger King - We do it our way! Your way is irrelevant!
Both of his feet are firmly planted in the air.
Brain: apparatus used to think we think.
Break up a relationship - buy a computer!!
C program run, C program crash, C programmer cry.
CA bumper sticker: Cover me, I'm changing lanes.
CONgress (n) - Opposite of PROgress
CPAV Warning:(S)top (C)ontinue (B)urn infected disk
CPU - Random number generator
Can you do the Picard Maneuver in a Grand Am?
Can't learn to do it well? Learn to enjoy doing it badly
Can't learn to do it well? Learn to enjoy doing it badly!
Captain, I protest.  I am NOT a merry man! - Worf
Captain, phasers and photons down, get the hand phaser ou\
Captain, the UARTs won't take this Speed!
Cavorting about like that isn't proper behavior.  Picard
Censorship is something   I do  like!
Cereal Killer Strikes Again! Cap'n Crunch found dead...
Children: Pure love contained in soft packages.
Circular Definition: see Definition, Circular.
Claravoiant meeting canceled due to unforseen events.
Clones are people two.
Closing on ship target.  Music on!  Fire away!
Cold pizza:  the generic breakfast
Coming Soon. Mouse Support for Turbo Edlin!
Complaints? Write them here legibly [] <-
Computer Lie #1: You'll never use all that disk space.
Computers are OUR business, our ONLY business
Computers are not intelligent. They only think they are
Computers can never replace human stupidity.
Congratulations Data, it's a girl.  Troy - The Offsprin
Constant change is here to stay.
Constipated Pakleds:  "We look for things, things to make\SLMR\TAGLI
Consult a real expert - Call your mother!
Contentsoftaglinemaysettleduringshipping.
Copywight 1991 Elmer Fudd.  All wights wesewved
Crewman Green, step on that rock!  <BOOM>
Crusher: Worf, have you seen Wesley?   Worf: No, I haven'\
Crusher: Worf, have you seen Wesley? ... Worf: No, I have\SLMR\TAGLIN
Cut my pizza in six slices, please; I can't eat eight.
DO NOT REMOVE THIS TAG (UNDER PENALTY OF LAW)
DOS + Windows + ATM < OS/2 2.0
DOS Tip : Don't use DOS.
DOS is just an operating system that runs Windows 3.1
DOS means never having to live hand-to-mouse
Daddy, what does FORMATTING DRIVE C: mean?
Daddy, what does RESET mea
Dammit Bones, I'm a captain, not a doctor!
Dammit Jim, I'm a doctor, not a tagline writer.
Damn it Jim, I'm a doctor not a doctor! Hey, wait a minut\S
Damn this hobby is expensive!
Damn! Outta Antimatter. I told Geordi $50 wasn't enough
Darmok and Jhilad at Tanagra
Data, data everywhere, and not a byte to eat!
Dead, huh?  Well, that's one less thing.  Beverly
Deadwood. Nineteenth Century Earth. The Ancient West.
Death is proven to be 99.9% fatal to all laboratory rats.
Deep Space Nine:  The Third Coming of Star Trek!
Definition of Terror: A female Klingon with PMS.
Dessert? I'll take a piece of cherry .
Detach the saucer, Data.  Don't spill the tea!
Did you know that no-one ever reads these things?
Discoveries are made by not following instructions.
Divers do it better under pressure.
Divers do it deeper.
Do Androids Dream of Electric Sheep?  Ask Data.
Do Not Attempt to Traverse a Chasm in Two Leaps...
Do not believe in miracles -- rely on them.
Do unto others JUST BEFORE they do unto you!
Does Windows 3.1 come with a Hard Drive?
Does anybody have a ";" Reminder key?
Does history record any case where a majority was right?
Doing my part to preserve order in the universe
Don't drink and park, accidents cause people
Don't take life so seriously.  It won't last.
Don't use a big word where a diminutive one will suffice.
Don't worry, I'm fluent in weirdo...
Dr. McCoy, I hate your #*@%ing human guts.  Discussion?
Dr. Soong did not intend me to be used this way.  Data
Drive C: Error, (A)bort (R)etry (I)gnore (K)ick (S)cream
Duh. . . I didn't know FORMAT C: did that!?
Dumb luck beats sound planning every time.  Trust me.
ERROR: Unable to come up with a good tagline.
Eagles Soar!, but weasels arn't sucked into jets!
Earthquakes are Earth's way of saying, WAKE UP !!!!!!!!!!
Eat any good books lately  Q
Efficiency takes time!  Frugality: who can afford it?
Ensign Pillsbury:  He's bread Jim!
Error - [A]bort, [R]etry, [F]ake like it's working...
Error 216: Tagline out of paper
Eschew obfuscation!
Ever stop to think, and forget to start again?
Every little BYTE helps
Every man's work is a portrait of himself.
Everybody remember where we parked.  -- Kirk
Everything that is not mandatory is forbidden.
Evil Grin #13  <<<<<GRIN>>>>>
Evolution is RELIGIOUS because it can't be proven!
Exam is a four-letter word for torture...
Excuse me, do you mind if I squish in here?  - Odo
Experience is a good teacher but her fees are high
Experience: What you get when you don't get what you want
FILE NOT FOUND..... Should I fake it? [Y/n].........
Fax me no questions, I'll Fax you no lies!
Feed your faith and starve your doubts to death.
Feet Smell?  Nose Run?  Hey, you're upside down!
Fiddle: Friction of a horse's tail on a cat's entrails.
Fine, Fine...Have your Klingon servent get some chairs!
Fire at Will!  >ZAP<  THANK you Data...I mean, 'Number On\SLMR\TAGLIN
For at the end of history lies the undiscovered country.
For discussion only. Not to be relied upon.
Format all 10?  Only 3 fit in the slot.
Fraud(n): A telephone number starting with "1-900"
Freedom of religion is also freedom FROM religion. . .
From the creative workshops of Soong, Inc.
G=Guns, PG=Plenty of Guns, PG-13=More than 12 guns...
Geneology: chasing your own tale.
Get off my kitchen floor...will ya!
Get your grubby hands off my tagline! I stole it first!
Ghosts are merely unsubstantiated roomers.
God has always been hard on the poor.
Going tagless has been a freeing experience!
Going to fly?  Walk, you'll get there faster!
Good day for flying but bad day for landings....
Got arrested for going 14400 in a 2400 zone.
Ground yourself, THEN hug your motherboard!
Growing old is mandatory; growing up is optional!!
Guess who's coming to dinner.  -- Chekov
Guinan's secret power:  her hat is a solar panel.
Happiness is a twit filter...
Happiness is finding special characters 
Happiness is your favorite program moving to Windows.
Hard work never killed anyone but why take a risk?
Have the boy sent to the bridge. - Picard
He that hath ears to hear, let him hear.
He who laughs, lasts.
He's alive, Jim.  Should I shoot him again?
He's dead Jim.  You get his tricorder,  I'll get his wall\S
He's dead Jim.  You take his phaser and I'll get his wall\SL
He's dead Jim... Grab his wallet!
He's got a magnet!!!  Everybody BACKUP!!!!!!!!
He's not dead, Jim, he's just metabolically challenged.
Hell with Pascal and C.  I am a QuickBasic Snob.
Hello, I am part number ޺۳ݳݳ
Help!  I'm parked diagonally in a parallel universe.
Help, I'm modeming! And I can't hang up!
Her last birthday cake looked like a prairie fire!
Here Tag! C'mon Tag! Good Tag. Good boy!
Hey Odo, got any more of that Jell-O in the 'fridge? ...O\SLMR\TAGL
Hey!  Your Trakball is upside down!
Hi! I'm a tagline virus! Steal me & join in the fun!
Hire the morally handicapped
Hiya, Doc! What's cookin'? - Data
Hold on - wait, maybe the answer's looking for you.
Honor would be better served if I were your mate.  Worf
Housework can kill you if done right.
How come all the buttons keep flying off my shirt?
How could I have downloaded a virus?!?!  It said NO CARRI
How do frogs die? Ker-mit suicide
How many of you believe in telekinesis?  Raise MY hand!
How much can I get away with and still go to heaven?
How'm I flyin'?  Dial 1-800-BORG-YOU. -Borg
How's this for diplomacy?  Shoot them all!  --Kirk
Human Intelligence. The greatest oxymoron ever!
Humans: The species that should have never been...
I AM RELAXED! - Worf
I BBS because no one can read my handwriting
I DO NOT...I do not yell.  -- Worf
I Had A Life Once, Now I Have A Computer
I Have To Stop Now, My Fingers Are Getting Hoarse!
I Just can not resist a little fun along the way.  :-)
I am Locutus of Borg.  Do you have any Grey Poupon?
I am Locutus of Borg. I demand Earl Grey tea - for 10000.
I am afraid that is beyond my design parameters.  Data
I am. Therefore, I think.  I think.
I believe I will take this opportunity to remove my ears.
I call my computer "Hole in the Desk"
I came. I saw. I charged it.
I can SPELL, I just can't TYPE worth a hoot !
I can assure you that size will not be a problem.  Worf
I can't be overdrawn, I still have more checks!
I can't believe my computer's on fire.
I can't, Doctor. I might hurt you.  Worf
I could be arguing in my spare time.
I didn't know it was impossible when I did it.
I do know a few things about anatomy, Jean-Luc.  Beverly
I don't know much about panda bears, Number One.  Picard
I don't steal taglines -- I replicate them.
I don't want to think.  I just want to be...
I fear you must blame your own perverse urges.  Picard
I feel fine.....Everything seems a little smaller. - Pica\S
I find push buttons very depressing......
I got it all together, then forgot where I put it.
I had a handle on life, but it broke.
I had a life once... Now I have a computer.
I hate making predictions; especially about the future!
I have a mind like a steel...uh...thingamajig...
I have a speech impediment....my foot!!!
I have something BETTER than chocolate.  Riker
I idiot-proof my programs,but along comes a bigger idiot.
I just play here.
I just steal 'em, I don't explain 'em.
I just steal them, I don't write them.
I know so little, but I know it fluently...
I like Boolean logic. NOT!
I love my computer. It's made in Taiwa~##$ ` #@
I may not always be perfect, but I'm always me.
I only counted 100 dalmatians...!!!
I prefer the company of equals. - Riker
I remember the words. I don't understand.
I remember when Saturns were rockets, not cars.
I sense... *SLAP*  Not while we're on the bridge, Will!
I still miss my ex-wife - but my aim is improving!
I tell them there's no problems...Only Solutions...
I thought DEL *.* -really- deleted the files!
I took thee for thy better.  Take thy fortune.
I used to be indecisive.  Now I'm not sure.
I used to have a handle on life, then DOS closed it...
I used to watch TV, then I bought a modem.
I want everything; do you have it??
I was going to procrastinate, but I put it off....
I was just stopped by the LAPD and boy am I beat !
I wasn't always like this, Lieutenant.  Picard
I wish I had a snappy Trek Tagline to put here...
I wish life had a scroll-back buffer.....
I would ask that you stop fiddling with my ears.  Data
I wouldn't touch the Metric System with a 3.048m pole!
I wrote my own benchmark, my machine is now 500MHz
I'd like to live like a poor person with lots of money.
I'd really like to lay one across your teeth.  Beverly
I'll have one brain on drugs with bacon, toast and juice.
I'll have what the guy on the floor is having...
I'll jump off that bridge when I come to it.
I'll see you in hell before I'd do that.  Ro
I'm SO confused...
I'm an absolute, off-the-wall fanatical moderate.
I'm at the corner of Walk and Don't Walk.
I'm bloody sick of standing here every day.  O'Brien
I'm dangerous when I know what I'm doing.
I'm fascinated by the way memory diffuses fact.
I'm in shape ... Rounds a shape isn't it?
I'm leaving my body to science fiction.
I'm losin' it! - Geordi
I'm no stranger, just a friend you haven't met...
I'm not a complete idiotseveral parts are missing.
I'm not dead. I'm electroencephelographically challenged.
I'm not dead; I'm "metabolically challenged."
I'm not just one of your snuggle-girls, Will.  Beverly
I'm not lost!  I'm "locationally challenged."
I'm not nearly as think as you confused I am.
I'm not schizophrenic.  It's this guy beside me!
I'm on the corner of Walk and Don't Walk
I'm on the corner of Walk and Don't Walk!
I'm out of bed and dressed.  What more do you want?
I'm saving my money for when they get Phaser Printers!
I'm sorry, this tagline is not an apology!
I'm spending a year dead for Tax Purposes
I'm sure it's in the manual somewhere...
I'm the person your mother warned you about...
I'm too skeptical to deny the possibility of anything...
I'm writing a book. I've got the page numbers done.
I've fallen...but I'll be back...Arnold Schwarzeneg
I've got 256K of RAM, so why can't I run Windows 3.0?
I've got a mind like a... a... what's that thing called?
I've used Basic so long, my brain has gonesub permanently
I@love~my$computer,;It's%made in Taiwa~##$ ` #@
If At First You Don't Succeed Ignore The Docs
If At First You Don't Succeed Ignore The Docs...
If Data is "fully functional," can he get a woman pregnan\S
If I save the whales, where do I keep them?
If I save time, when do I get it back ?
If I want your opinion I'll beat it from you
If I were you, who'd be me?
If Q was female, would he be called O?
If Q were castrated would he become ... O ???
If Q were castrated, would he become O?
If anything -can't- go wrong, it will
If at first you don't succeed, call it Ver 1.0
If at first you don't succeed, try skydiving ...
If humans have orgasms, do the Borg have Borgasms?
If it ain't broke, break it and charge for repair.
If it works, rip it apart and find out why!
If it's not broke, let me take a crack at it.
If it's stupid, but it works, then it's not stupid.
If only Einstein had a 486DX-33....   like I do...
If plugging it in doesn't help, turn it on.
If rabbits feet are so lucky, what happened to the rabbit
If rabbits feet are so lucky,what happened to the rabbit
If speed scares you, try Micro$oft Windows.
If speed scares you, try Windows...
If the shoe fits, put it in your mouth.
If there was a nuclear bombing, would I be alive to care?
If there was a wait for Q to show up, would there be a Q \SLMR\
If there's one thing I can't stand, it's intolerance.
If this were an actual tagline, it would be funny.
If we left the bones out it wouldn't be crunchy.
If winning isn't important then why keep score?
If you can read this, you're irrelevant. -Borg
If you can't beat em', mod em'.
If you need a calculator, its too complex.
If your ship doesn't come in, swim out to it!
Ifyoucanreadthis,youspendtoomuchtimefiguringouttaglines.
Illiterate?  Write for a free brochure!
Immorality will continue until beatings improve.
In case of fire, yell "FIRE!"
In it's former life, my computer was a Cray...
Indeed, Captain Picard, you have found him.  Spock
Insanity is just a state of mind.
Insanity runs in my family; it practically gallops...
Insert disk with \HURTME.COM and strike Worf when ready.
Intriguing. I did not know humans were so capable.  Data
Is it still paranoia if they ARE ALL out to get me?
Is it still paranoia if they ARE ALL out to get me???
Is this yours?  Your dog left it on my lawn...
Is this yours? Your dog left it on my lawn ...
It can't be full...I STILL HAVE SUBDIRECTORIES !
It depends on which end he tries to light...
It doesn't work, but it looks pretty.
It has many other uses as well.  Allow me.  Worf
It is better to be brief than boring.
It is fatal to live too long.
It is, after all,  only a moment in the infinity of time.
It said "insert disk #3" - but onty two will fit...
It works better when you turn the brightness up.
It's a fine line between fishing & standing still
It's dj vu all over again.
It's not GEEK - it's SOCIALLY CHALLENGED, dammit!
It's not a person, damnit! It's a Borg!
It's not easy having an overbearing parent! - Troi
It's not in the manual !!!!!
It's not the money I want, it's the stuff.
It's only a hobby ... only a hobby ... only a
It's raining, it's pouring, the old man is...dead, Jim.
It's worse than that, it's physics, Jim!
Jesus saves...Passes to Moses..Shoots....Scores!
Join the Group Mind - become a Borg
Joseph Stalin's grave was a Communist Plot.
Junk: stuff we throw away.  Stuff: junk we keep.
Just another inmate in this ASYLUM!!!
Just cannot resist a little fun along the way.  :-)
Just for today..... do not anger.
Just give me what the Dr.ordered..OHHOOO Dr Pepper..
KPLA, Klingon radio:  All glory, all the time!
Kids-They're not sleeping, they're recharging!
Kill them all!  .... Let God sort them out.
Kill'em All ... Let God Sort Them Out.
Klingon Thanksgiving Grace:  "Let us prey..."
LOTUS - Let Only The Users Suffer
Laddie, ya think ya might like ta ... rephrase that?
Last yur I kudnt spel modjerater now I are won.
Law of Insurance and Taxes - Whatever goes up, stays up.
Let's organize this thing and take all the fun out of it.
Lets all take the TIME to really LISTEN 2 r KIDS
Life - brief interlude between nothingness and etern
Life Facts..Death, Taxes, and "THEY" will Tax us to Death
Life can be great if you live it to the fullest!
Life is a banquet & most suckers are starving!
Like, I think my bottle absorbed my Beer, eh.
Liposuction will destroy your FAT
Little boats should keep near the shore.
Lore: Takes a licking and keeps on twitching.
MFM/RLL/SCSI/ESDI/IDE.... what's next
MS-DOS....DR DOS' Sister.
MacIntosh:Computer with training wheels you can't remove.
Madness takes its toll - please have exact change
Make Headlines..use a corduroy pillow....
Make me an offer. I have a computer to support!!
Make me an offer. I have a computer to support!!
Make me breakfast and perhaps I'll consider it.  Troi
Man looks into the abyss, and sees himself.
Man who eats too many prunes, sits on toilet, many moons!
Marriage isn't a word, it's a sentence.
Mary had a little lamb.  The doctor was surprised.
Master of all I survey (at the moment, empty pizza boxes)
McBorg:  Over 50 million assimilated!
Meditation is not what you Think.
Meet the new Boss--same as the old Boss...
Member: International Brotherhood of Tagline Thieves!
Memory is a thing we forget with.
Mental Floss prevents Moral Decay.
Method acting.. I'm vaguely aware of it. - Picard
Microbrain, growl for me, let me know you still care. Q
Military intelligence is a contradiction of terms.
Minds are like parachutes, they only work when open.
Miracle owes its origin to the negation of thought.
Misspelled?  Impossible.  My modem is error correcting.
Monday is the root of all evil!
Money Not Found: Abort, Retry, break out Quicken?
Money is the root of all wealth.
More like Woody Woodpecker with a perm!
Mr Worf! Do you intend to blast a hole in the viewscreen?
Mr Worf... Fire at Will.. >BZZZT< ... Hey, where'd Riker \SL
Mr. Scott, energize.  Hey! Where'd that pink bunny come f\SLM
Multitasking causes schizophrenia..
My Dog ate my REP Packet!!!
My Mother loves ME!  It's the computer she hates.
My dad hit me only once - with the Buick
My hat covers my head.... Just like hair used to!!
My haystack had no needle!
My mother is NEVER on time! - Worf
My other vehicle is a Galaxy Class Starship ...
My other vehicle is a galaxy class starship.
My reality check just bounced.
My systems are only programmed for one at a time.  Data
My teeth aren't the sharpest in the world.  Ro
NAVY: Never Again Volunteer Yourself
Name:޺۳ݳݳ Rank:޺۳ݳ Serial No:޺۳
Never eat more than you can lift.
Never enough time, unless you're serving it.
Never park your hard disk in a tow-away zone.
Never test for an error you don't know how to handle.
New Mexico?  Sorry, we don't do ship to foreign countries
New strain of system-trashing virus : WINDOWS
Nietzche is pietzche, but Sartre is smartre.
Night of the living dead chipmunks
No person ever became wicked all at once.
No wanna work.  Wanna bang on keyboard.
No, I'm from Iowa. I only work in Outer Space.
No, Q, I meant a BUD light!
Noah!  Come quick!  There's water in the basement!
Nobody roots for Goliath.
Nonsense, no man I know can do it that way.  O'Brien
Northern Exposure: Watch out for the frostbite!
Not a scrap. I was deliberately wasting your time, sir.
Not, I think, today, Commander. - Picard
Nothing is 100% certain, bug free or IBM compatible.
Nothing is so smiple that it can't get screwed up.
Notice how easily it detaches.  Ro
Now that I've given up hope I feel much better...
Null modems were created when God got no handshake.
OK Scotty, NOW!  Detonate and energize!  I mean.......
OK, I'm weird! But I'm saving up to be eccentric.
OPERATOR ERROR: Nyah, Nyah, Nyah, Nyah, Nyah!
OPINION: Where "moderation" means "attack."
OS/2 2 ..Will it send DOS & Windows the way of CP/M ?????
OS/2 VirusScan - "Windows found: Remove it? (Y/y)"
OS/2...Opens up Windows, shuts up Gates.
Of course I'm running Windows NO CARRIER
Oh Tasha, See Me, Feel Me, Touch Me!
Oh no, not another learning experience!
Oh very clever Worf, eat any good books lately?
Oh, Picard, I will enjoy you morning, noon and night!
Oh, well... never mind!
Okay - right after this one we're BACK to the TOPIC!
Old age is better than the alternative.
On the other hand..you have five different fingers
Once you understand your computer it is obsolete
One Klingon Flea to another...Meet you on the next ridge.
One person's <grin> is another's <groan>.
One way to better your lot is to do a lot better...
Only in your dreams, Commander.  Troi
Oops, time for Ponn Farr!
Our OS which art in CPU - UNIX be thy name .....
Our necessities are few but our wants are endless...
Outlaw junk mail, and save the trees!
Ow. I believe I have overexerted myself.- Data
Oxymorons... "military intelligence" and "tech support"!
PATH=harddrive;drawer;desktop;pocket;boxincloset;boxunder
Parallel processors share the task.
Pardon me, do you have any grey poop on?
Path = Wandering Considerably.
People can be very frightened of change.        Kirk STVI
People! Can't live with em, Can't live without em!
People! Can't live with em,Can't live without em
Peter Norton is the "Betty Crocker" of software!
Pets are not just for Christmas, but for a LIFETIME!!!!
Pets: pure love contained in soft packages.
Phasers don't kill people...Unless you set them too high
Picard to Lwaxana: "Not THAT kind of 'Engage'!"
Picard to bridge, where am I?
Plagarism prohibited.  Derive carefully.
Plasma is another matter.
Please Tell Me if you Don't Get This Message
Please recycle this tagline.  Once is not enough.
Please think when you drink....
Please, doctor, not while my wife is on board.  O'Brien
Political Correctness is a Borg plot.
Pound forehead on keyboard to continue.
Power corrupts.  Absolute power is kind of neat.
Power corrupts.  Absolute power is kinda neat....
Prejudice is the reason of fools. Voltaire.
Press any key to continue or any other key to quit
Pro & con are opposites, what about progress & congress?
Proceed with Caution - Twisted Mind Under Construction!
Procrastination means never having to say you're sorry.
Program too small to fit into memory.
Proofread carefully to see if you any words out.
Prune Juice. A warriors drink!
Push any key. Then push the any other key.
Put it to the wall, Mr. LaForge. - Picard
Put your hard drive to your ear. Can you hear the C: ?
Qagh -- it's not just for breakfast anymore!
Quick! Close your mind!! Something might get in.
RAM = Rarely Adequate Memory
REAL programmers use undocumented DOS calls
RIP... This tagline had now been ripped off.....
Rainy days and automatic weapons get me down....
Read the docs. Wow, what a radical concept!
Real Trekkers work out at the He's Dead Gym.
Reality is for people who can't handle Star Trek.
Reduce Carbon Dioxide emmissions - STOP Breathing
Reduce brain fat.  Eat Moral Fiber.
Riker, AKA "Number One." A spy for the Borg?
Ronald Regan: Milli Vanilli of presidents.
Rule #167: niether a borrower nor a lender be. --Robin Le\SLM
S met ing's hap ening t  my k ybo rd . .
SEGA and Nintendo are combining, they call it Windows NT
STICK \'stik\ n. 1: A boomerang that doesn't work.
STRING space corrupt?  But I always use TAPE!
SYSTEM ERROR:  press F13 to continue...
Salvation is only a Beer Bottle away.......
Same to you and whatever you meant by that!
Sane?  Hell, if I was sane why would I be here?
Schizophrenia beats sysoping alone.
Scott me up, Beamie!
Scotty! Hurry, beam me u....*       NO CARRIER
Second star to the right and straight on till morning.
Sector Not Found (A)bort, (R)etry, (C)offee?
Security, confine Ensign @LN@ to the brig.
Security, get that floozy off my bridge.  Picard
Send more tourists..... the last ones were delicious!
Set phasers on tickle!
Set phasers to extreme itching!
She canna take anneh more, Cap'n!
She sells C shells
Shh! Be vewy quiet, I'm hunting wuntime errors!
Shoot your program and put it out of its memory!
Shoplifters with the runs take Clepto Bismol
Show me a sane man.  I'll cure him for you.
Shut up, Spock!  We're rescuing you!  --McCoy
Shut up, kid.  -- Guinan
Silly Wabbit, QWKs are for kids!
Sir, I've been meaning to dicuss these feelings.  Troi
Six megs, two monitors, and an attitude
Smash forehead on keyboard to continue...
Smile!  You're on Candid Modem!
Smile, but sharpen your knives.
Smile... people will wonder what you've been up to.
So many idiots... too few flame-throwers...
So many lawyers, so few bullets.
So, my brother is human after all. - Robert Picard
Society like air, is necessary but not complete for life.
Some Do, Some Don't, Some Will and Some Won't.
Some minds should be cultivated, others plowed under...
Some people are, through no fault of their own, sane.
Somebody got up on the wrong side this morning.  Riker
Somehow, I can't see myself doing it for money.  Geordi
Sorry, I forgot all about the Amnesia Conference!
Sorry... my mind has a few bad sectors.
Southern DOS:  Y'all reckon? [yep/nope]
Southern DOS: Y'all Reckon? (Yep/Nope)
Spaghetti code means job security.
Spare time?  You're lookin' at it.
Speak softly and carry a two-handed sword.
Spice up your love life....kiss a Klingon today!
Split personality?  Who, us?
Stand down from battle stations, and Ensign change your p\SLMR
Standards are wonderful: so many from which to choose!
Star Trek XXVII - The Search for Shatner's Teeth.
Start slow and taper off.
Stay back! I have a modem and I know how to use it!!
Stealing a rhinoceros should not be attempted lightly.
Stick to your talent and the cows will be well tended.
Still going!  Nothing outlasts Data!  He keeps going and \SLMR
Stop tagline theft! Copyright your tagline (c)
Stop what you're doing and TAKE A SHOWER!!!
Stress- n. Doing a tight 180-dregree U-turn at Warp 9.5.
Support wildlife, throw a party.
Sure, Patrick, but will the Pontiac do warp nine?!
Sure, drinking kills brain cells, but only the weak ones.
Sure, we just route the main sensor through Data's cat.
TROI: I feel pain, GREAT pain! ... RIKER: Glad you liked \SL
TWO THINGS ARE UNIVERSAL. HYDROGEN AND STUPIDITY.
Tagline Lotto: <- Scratch here for prize.
Tagline error.  Contact your systems programmer.
Tagline frequencies are Open....
Tagline theft is a compliment.
Tagline wanted. Apply within ====================>
Taglines  \'tag-linz \  The bumperstickers of BBS'ing.
Taglines are irrelevant. You will be assimilated into the\SLMR
Taglines...the electronic "bumper sticker"...
Take a bite out of crime .. Abolish the IRS!
Take no friends and leave no enemies.
Take two crows and caw me in the morning.
Tell me more about these "habits".  Beverly
Thank you, God. Keep it up!!!
That was so fast, can you show me one more time?  Troi
That's enough, Data!
That's the nuttiest idea you've had, Counselor.  Geordi
The 486SX: Intel's test of your gullibility
The 486SX: Intel's test of your gullibility!
The Away Team went on a mission and all I got was this lo\SLMR\TAGLIN
The Borg are coming!  Quick!!  Try and look useless!!!
The Borg assimilated my race and all I got was this lousy\SLMR\TAG
The Counselor and I will be indisposed today.  Riker
The Dead Shall Walk the Earth and Dine on Flesh
The Electric Chair Choice: Regular or Extra Crispy?
The USS Reagan -- "To boldly ... um ... I forget..."
The best defense is to stay out of range.
The buck doesn't even slow down here.
The current death rate?  One per person, of course.
The days of the digital watch are numbered
The evidence before the court is incontrovertible...
The fewer the facts, the stronger the opinion.
The future is like the present, only longer.
The future isn't what it used to be.
The heart is wiser than the intellect...
The hell with the prime directive, let's kill something.
The highest bidder catches the most politicians.
The immoratal words of Socrates -- "I drank what?"
The irony of life is that no one gets out alive
The irony of life is that no one gets out alive...
The moving cat sheds, and having shed, moves on...
The number you call from has been disconnected.
The occipital area of my head seems to have impacted...
The only thing shorter than a weekend is a vacation.
The past should be a springboard, not a hammock.
The pen is the tongue of the mind.
The price of purity is purists.
The road to success is under construction...
The surest way to be late is to have plenty of time.
The trick in overcoming temptation, is to play dead.
The ultimate Turn on.  When they shoot at you.. and miss!
The universe is laughing behind your back
The worst thing about censorship is .
Their are trhee things wrong here.
There are times when I long for a Klingon woman.  Worf
There is a tiny plant here, murmuring "water, water".
There is intelligent life on Earth, but we are just visit\SLM
There is no gravity--The earth sucks!
There is one God, but which one is He?
There once was a [ ] from [ ] whose [ ] was
There's always 1 more SOB than you counted on
Thesaurus: ancient reptile with an excellent vocabulary.
These aren't my shorts -- they bend !
These things on my nose aren't just for show.  Ro
They DO make 'em like they used to.
They're baaack!
Thin may be in, but fat's where it's at!
Things are not as bad as they seem - they're worse
Third of Five, six of one, half a dozen of the other
This Charlie Brown must have been a very wise man.
This game is exceedingly simple.  Data
This guy has blown me off for the last time.  Geordi
This information fills a much needed gap
This is a Ferengi Tagline.  You owe me 500 credits for re\SLMR\TAG
This is a Tagline mirror><rorrim enilgaT a si sihT
This is a hell of a time for a walk in the park.  Geordi
This is our only tag line.
This isn't a holodeck, darling, this is real.  O'Brien
This message cleared by Iraqi censors.
This message is $hareWare! To register, please send $20
This message is SHAREWARE!  To Register, send $5.
This message written by Dolphin Boy.
This message written by Sandy. A highly trained dolphin.
This message written by Zippy the Dolphin.
This meszage has bin spel chequed.
This never would've happened if I were captain.  Riker
This sentence is a !!! premature punctuator
This space left blankish.
This tagline was reclaimed and is not yet stolen.
Those who can, do.  Those who can't, supervise!
Tick - Tock, Tick - Tock. Time is wasting away...
Time takes time.
Time travel gives me nosebleeds. - LaForge
Tis but a flesh wound...
To err is human, to forgive is against FidoNet policy.
To register this tagline, send $29 to ....
To shoot a mime, do you use a silencer?
Today is the tomorrow you worried about yesterday.
Transporter room, beam that tagline up immediately!
Transporting really is the safest way to travel.
Trek Classic -- Who Needs Another Generation?
Trek excuse #1: The Prime Directive clearly forbids it!
Tried to play my shoehorn... all I got was footnotes!
Trust in God, but backup your hard disk TODAY!!!
Truth is just another misconception.
Trying to think of a good tagline...
Two Wrongs Don't Make A Right, But Three Lefts Do.
Ultimate oxymoron:  "Cash Surplus"
Unable to load REALITY.SYS -- Invalid Parameter: /UTOPIA
Unable to locate TEAEARLGREY.HOT -- Enterprise halted!
Unix?  I can't even do ONE thing at once.
Used Iraqi rifles for sale: Dropped once, never fired...
User - a technical term used by computer pros. See idiot.
VCR's are a way to defeat time.....
Vamoose ya little varmint! - Data
Vuja De - The Feeling You've Never Been Here
Vulgarity: The conduct of others.
V!  W d't gt  tkg v!!!
WARNING... drinking tap water may kill your thirst!
WOM - Write only memory
Walk through doors, don't crawl through Windows.
Warp 5 ... engage.  No, no, Mr. Data, more clutch!
Was Beehtoven's 1st movement done in the toilet or privy?
Was Tasha Yar the Enterprise's expert on Data entry?
Watch where you go... remember where you've been...
Watch where you go...remember where you've been...
We can't go back, and we can't stay here.  -- Picard
We come in peace.  Shoot to kill.
We do what we can but it's never enough.
We secretly replaced the dilithium with Folger's Crystals
We will get along fine as soon as you realize that I'm Go
We'll get along fine as soon as you realize that I'm God!
We're all bozos on this bus.
We're kick'n some ASCII now
We're lost, but we're making good time.
We've secretly replaced their dilithium with new Folger's\SLMR\TAGL
Well, I did a backup three weeks ago...
Well...my cray is in the shop.
Whaddya mean you don't STAPLE diskette labels on?
What Are You Looking For?  Nothing's Here!
What can you do at 3 AM?   Psssttt - got a modem??
What happened to my tagline?
What if there were no hypothetical situations?
What man doesn't like to stare once in a while?  O'Brien
What part of "ten-line limit" don't you understand? 
What would McGyver do now?
What's another word for "thesaurus"?
What's shorter then a weekend?  A Vacation.
Whatever happened to "Why is the sky blue?"
Whatever you do, you'll regret it.
When I want your opinion I'll give it to you!
When I was a kid, I was an imaginary playmate.
When all else fails, blame it on Dan.
When all else fails, blame it on the guy next to you!
When all else fails, read the docs.
When all else fails, take a nap!
When in danger,when in doubt,run in circles,yell & shout!
When in doubt, mumble.
When it comes to humility, I'm the very BEST there is!
When you discover you are dead, avoid driving a car.
Where are we going?... and why am I in this handbasket?
Where is the tagline supposed to go???
Where quality is just a word we like to use.
Where there's a will, there's an Inheritance Tax.
Where you stand depends on where you sit.
Who can say what's around the corner?
Who needs a house out in Hackensack?
Who the Dickens wrote "Oliver Twist", anyway?
Why USA fails? Radio Shack=USA's Technology Store!!
Why are apartments so close together?
Why are you wasting your time reading taglines?
Why is "easy listening" so hard to listen to?
Will Windows 3.1 come with a Hard Drive?
Windows 3.0: from the people that brought you EDLIN
Windows 3.1 coming to the rescue! Wait for FedEx!!!!!!!
Windows 3.1: from the people that brought you EDLIN!!
Windows 3.1: the best $99 solitare game I've ever seen!
Windows is to OS/2 as Etch-A-Scetch is to Art.
Windows isn't a virus -- viruses do something!
Windows may be slow, but at least it takes up a lot of
Windows may be slow, but at least it takes up a lot of ro
Windows: 80486 to 8088 conversion made painful...
Wit is educated insolence.
With all due respect, I'd like to go for a swim.  Riker
With every wish there comes a curse.
With my Stealth Modem, you'll never see me coming!
XT at 8 Mhz. = 386 at 25 Mhz. + Windose !!!
XT/8 Mhz = 386/25 Mhz + Windose !!!
Yawn a more Roman way.
Yeah?  Well, tell that to her parents.  Geordi
Yes my son, long ago mail was read 1 packet at a time.
Yes, I admit, *I* steal taglines!?!?!
Yes, I know I'm off-topic.  Thank you for your concern.
You are only young once, but you can be immature forever.
You are smart.  Can you make us go?
You can say you're (excrement) out of luck!
You cannot kill time without assaulting eternity.
You do not need a needle for ruptured pigs.
You gotta know when to hold 'em, know when to fold 'em.
You may be recognized soon.  Perhaps you should hide?
You should've heard me before you got here.  Ro
You showed admirable restraint for one so small.  Worf
You're never a loser until you quit trying.
You're on report, Ensign.  My quarters, 1900 hrs.  Riker
You're one to tell me what I can and can't sense.  Troi
You're twisted and sick; I like that in a person!
You're twisted, perverted, & sick. I like that
You're twisted, perverted, & sick. I like that!
Your cat's missing?  Have you checked my bumper?
Your statement fully describes the situation partially.
Zmodem has bigger bits, softer blocks, and tighter ASCII
[\] At 200' No One Can Hear You Scream...[\]
[dignified silence]
taH pagh taHbe' - Thought Master William epetai-Shakespea
tagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtag
thistaglineproducedbypkzip
No decorations necessary.
Dulce bellum inexpertis.
JUST ROOTIN' AROUND.
Common sense isn't.
C'est la vie.
I'm in shape ... round's a shape isn't it?
((wrong && wrong) != right) 
Quoth the Raven, "Eat My Shorts."
"Said the fly, "Let us flee." Said the flea "Let us fly."
Diplomacy is saying "nice doggy" until you find a rock. 
I just steal 'em, I don't explain 'em.
Just My Opinion (But I'm Right!)
Wanna giggle? Try (EDITOR=EDLIN !) in anything.
Backup not found: (P) Panic (Any Other Key) Panic.
Youth + confidence + myopia = naivete.
Press <CTRL>-<ALT>-<DEL> to continue ... 
Buy a 486-33 you can reboot faster..
An appeaser feeds a crocodile, hoping to be eaten last.
Success is just a matter of luck.  Ask any failure.
Irony: Giving father a billfold for Christmas.
Every politician has a price, some hold bargain sales.
The world is a beautiful book, for those who can read it.
A person in a passion rides a mad horse.
Hard work has a future payoff.  Laziness pays off now.
Celery raw develops a jaw. But stewed, is quietly chewed
Where there is a stink feces there is the odor of being.
A yawn is a silent shout.
"A newspaper is a collection of half-injustices"
If this is a battle, then you have already lost.
"Every why hath a wherefore."
An optimist is a guy without much experience... 
Life is not a spectacle or a feast, it is a predicament.
A person is a lion in his own cause.
Today has been a long year!!!!!!!!!!
Any certainty is a delusion.
"Beulah, peel me a grape." 
I sighed as a lover, I obeyed as a child.
Every crowd has a silver lining.
Old MacDonald had a computer with EIA I/O.
Dammit Jim, I'm a doctor, not a tagline writer.
Strange but not a stranger...
He bellows like a cow standing on her tit.
Good luck is a lazy man's estimate of a worker's success.
Fiddle: Friction of a horse's tail on a cat's entrails.
In this world a man must either be anvil or hammer.
When you see a snake, never mind where he came from.
Better to marry a man who loves you than one you love.
Some men without a god are like fish without bicycles.
A person without a navel lives within all of us.
The trouble with a kitten is that, eventually it's a cat.
To avoid seeing a fool, break your mirror.
"Woman must be a genius to create a good husband." Balzac
The wife of a careless man is almost a widow.
The mouse with a single hole is quickly caught by the cat
I am not a dictator.  It's just I have a grumpy face.
Misfortunes always enter a door left open for them.
"Too much of a good thing is wonderful." <Mae West> 
Self-made man: A horrible example of unskilled labor.
COFFEE.COM not found: A)dd more, R)eheat F)reak out.
The more known about people, the more to admire in dogs.
The worst thing about censorship is . 
I never rise above the noise and confusion...
Prosperity makes friends, adversity tries them.
The best defense against logic is stupidity.
The arrogance of age must submit to be taught by youth.
Time goes? No.  Alas time stays, we go.
When everyone thinks alike, then everyone is stupid.
When all think alike, then no one is thinking.
As for me, all I know is that I know nothing.
Manuals out, after all possible keystrokes have failed.
"May you live all the days of your life." Swift
Waiting to overcome all objections, results in nothing.
Overestimation: Thinking that all your geese are swans.
Be suspicious of all native-born Esperanto speakers.
No answer is also an answer.
Round numbers are always false.
Friendships are not always preserved in alcohol.
Our future is always uncertain our end is always too near
A farmer is always going to be rich next year.
God heals, but always someone else wants a fee.
One who is always in a stew generally goes to pot.
The wrong way always seems the more reasonable.
Bureaucracy: That place always in need of a laxative.
Sysoping, not just an adventure, sometimes it's emesis.
A hen is an egg's way of making another egg.
I am not an animal!  I am ... well, not an animal. 
If this were an actual tagline, it might be funny.
If this were an actual tagline, it _might_ be funny.
O Oysters come and walk with us, the Walrus did beseech.
Surly to bed, and surly to rise.
Take two crows and caw me in the morning
"Help! I've fallen and can't get up." A. Tree
Beware! I'm armed and have suffered from PMS all my life.
Wisdom of many and the wit of a half.
Man loves little and often, woman much and rarely.
Some nonsense now and then is relished by the wisest men
Take egotism out, and you castrate the benefactors.
Words, words, words.  And no place to put them all!
There are no answers at best a few possibly good guesses.
When you find anything that works, it usually fails.
Adam ate the apple, and our teeth still ache.
Pedestrian: The most approachable chap in the world.
Shhhhhh.....the topic cops are coming
Words and ideas are what change our world.
Actions from sanity are not necessarily from feeling.
Silly rabbit, tricks are for hookers!
"All humans things are subject to decay."
The only realities are the atoms and empty space.
Silly Wabbit, QWKs are for kids. 
"But once you are real, you can't become unreal again." 
"Men, in general, are but great great children" Napoleon
Noble deeds that are concealed are most esteemed.
I am not arguing with you, I'm telling you.
Window-screen: An arrangement for keeping flies in.
*FLASH* Energizer Bunny arrested, charged with battery.
Architecture is the art of how to waste space.
A nose in artificial manure is not studying nature.
Actions are neither as good nor as evil as impulses.
"With our judgements as our watches, none go just alike."
No one does as much harm as one going about doing good.
I'm as innocent as a new-laid egg.
Sharper than an asp's tooth to have a thankless child.
All reality is aspect dependent.
Today, take an astronaut to launch.
The best blood at times gets into fools and mosquitoes.
Hasten to laugh at everything lest you be obliged to weep
Childish Game: One at which your spouse beats you.
Please don't yell at me.  I'm new at this. 
"We must laugh at man, to avoid crying for him" Napoleon
Sandwich: An faulty attempt to make both ends meat.
That's a smug aura of respectability you see in a mirror?
Genealogy: tracing us back to the same brother and sister
Memoirs are the backstairs of history.
Since GOD spelled backwards is DOG, is my poodle Satan? 
Modesty is good bait when fishing for praise.
You tell 'em, Bald Head, You're smooth.
You tell 'em Banana, You've been skinned.
You tell 'em Bank, You're safe.
Look out for barking dogs that bite.
A good dog barks when told.
This door is baroque; please call Bach later.
I may not be perfect, but I am all I got!
Most allies must be watched just like the enemy.
Caution:  Breathing may be hazardous to your health.
Things could only be worse in Cleveland.
Every child should be given the desire to learn.
You tell 'em Bean, He's stringing you.
A thing of beauty is in the eye of the beholder.
Save trees, eat  beavers. 
No person ever became wicked all at once.
History repeats itself because nobody listens
Envy is thin because it bites but never eats.
Misery brings strange bedfellows.
They who drink beer will think beer.
Where do honey bees go potty?  At a BP station naturally.
The woman cries before the wedding; the man afterward.
Honesty: Fear of being caught.
It's hard to believe it, but some teens are humans.
A liar isn't believed even when he speaks the truth.
Beware of true believers you may be duped by a false god.
Some thoughts are best guillotined before actions result.
Sex isn't the best nor the worst thing in the world.
We're off doing beta, the wonderful beta of oooz
Old age is better than the alternative.
Is wetter REALLY better?
Monologue: A conversation between realtor and prospect.
Don't use a big word where a diminutive one will suffice.
If you can't bite, don't show your teeth.
ZMODEM has bigger bits, softer blocks, and tighter ASCII.
When no wind blows, even the weather vane has character.
We are in bondage to the law so that we may be free.
If it ain't borken, don't fix it.
Boys will be boys, and so will a lot of middle-aged men.
Fat heads, lean brains.
You tell 'em Brake, You've got the drag.
Please!  Do not break character! 
The only heavy breathing I ever hear is after aerobics.
Engraving is, in brief terms, the art of scratch.
Politics: Passing the buck or passing the doe.
An actor without buck teeth can play the Easter Bunny.
That's not a bug, that's a feature.
We ask advice but we mean approbation.
Love thy neighbor, but keep the hedge in tact.
I'm incredibly jealous, but still glad for you.
I'm terribly sorry, but I'm afraid you're just a mirage. 
Time is precious, but truth is more so.
Marriage, a romance but the hero dies in the 1st chapter.
OK, I'm weird! But I'm saving up to become eccentric.
You tell 'em Butcher, You've got a lot of tongue.
Hm..what's this red button foNO CARRIER
Bad officials: elected by good citizens who fail to vote.
<<< Tagline deleted by Natl Endowment for the Arts >>>
The mind grows by what it feeds upon.
Birds are trapped by their feet, people by their tongues.
This tagline stolen by Silly Little Mail Reader!
You tell 'em cabbage, You've got the head.
You tell 'em calendar, You've got lots of dates.
It's okay to call someone stupid; just don't prove it.
Only the stupidest calves chose their own butcher.
Even the blind can see money.
Of course I can cook, but I never do it on the first date
A thick head can do as much damage as a hard heart.
A red nose can be the result of sunshine or moonshine.
Few of us can stand prosperity -- someone else's.
Genius: One who can do anything except earn a living.
By trying we can learn to endure another's adversity.
A good tree cannot bring forth evil fruit.
Without fingers you cannot even thumb your nose.
"Oh captain! my captain! our fearful trip is done." WW
Collector: Person few care to see but ask to call again.
If you don't care where you are, then you can't get lost.
Judge not a carpenter on how fast chips fly.
A jug is carried under your coat for a dishonest reason.
You tell 'em Cashier, I'm a poor teller.
To the old cat, the tender mouse.
You tell 'em Cat, That's what you're fur.
Gotta run, the cat's caught in the printer.
If one cannot catch a bird of paradise, grab a wet hen.
The highest bidder catches the most politicians.
You tell 'em Cemetery, You are so grave.
Adventure is the champagne of life.
Getting a second chance is never a certainty.
Everything changes except change itself.
When in doubt; Cheat !
"Man's the bad child of the universe." Oppenheim
HELP! Protect America's children, soil, and water today.
You tell 'em Chloroform, You can put them to sleep.
Jury: A group chosen to decide who has the best lawyer.
You tell 'em Church Bell, I told you.
You tell 'em Cigarette, You're lit up.
The devil can cite Scripture for his purpose.
To be too clever is to be stupid.
Choose heaven for climate, hell for society.
You tell 'em Clock, You've got the time.
Unable to locate Coffee -- Operator Halted!
It was so cold, I almost got married.
Save the whales. Collect the whole set.
When the bad combine, the good must associate.
The World: A comedy for thinkers; a tragedy for feelers.
The world is coming to an end!
Don't steal.....Politicians hate competition.
Born crying, live complaining, die disappointed.
Whatever is well conceived can be well expressed.
Reality: Only a concept and the home of the brave.
Only hey can conquer who believe they can.
Nothing is ever constant, unless it is dead. 
We have resumed control...we have resumed control...
It's a poor cook who cannot lick his own fingers.
A sleeping fox counts hens in his dreams.
Pants: Trousers' country cousins.
Many would be cowards if they had courage enough.
Society prepares the crime; the criminal commits it.
Straight trees have crooked roots.
A good rooster crows in any hen house.
What youth deemed crystal, age finds was dew.
You tell 'em Cucumber, I've been pickled.
No medicine can cure a vulgar person.
It's easier to curse the candle than light the darkness.
You tell 'em Custard Pie, You've got the crust.
Other times, other customs.
Cynicism is intellectual dandyism.
Clever father, clever daughter; clever mother, clever son
Today is a day for making firm decisions!!!!!  Or is it?
Each day a day goes by.
I've had BETA days ... and nights!!!
Happy couple: A deaf husband and a blind wife.
Skeptics are seldom deceived.
Let no good deed go unpunished.
There is no defense except stupidity against a new idea.
Fishing is a delusion surrounded by liars in old clothes.
Living: The best demonstration of victory over mortality.
You tell 'em Dentist, You've got the pull.
You tell 'em Dictionary, You're full of information.
"Old soldiers never die, they just fade away.."
Old musicians never die, they just decompose.
Not everything more difficult is more meritorious.
A gentleman can disagree without being disagreeable.
America was not discovered by Americans, shame on them.
Talking is another disease of age.
On a clear disk you can seek forever.
I had a dislocated funny bone, <OUCH> but it's better now
Detour: The roughest distance between two points.
Those without heads do not need hats.
How many times do you need to be tolled anyway? 
It's 11:56 pm. Do you know where your modem is?
Those who can, Do. Those who can't, Criticize.
You tell 'em Doctor, You've got the patience.
Raising your voice does not reinforce your argument.
Dachshund: Half a dog high by a dog and a half long.
Even a noseless dog can stink.
An inch of dog is better than a mile of pedigree.
You tell 'em Dough, You're well bred.
When we can't dream the time for death has arrived.
America is a dream to most of the world.
Camels have wet dreams too.
Only in your dreams are you really free.
Time is the dressmaker specializing in alterations.
What soberness conceals, drunkenness reveals.
Users: Keep them dry and don't feed them after midnight.
And God said: E = mv - Ze/r ...and there *WAS* light!
"Earth was not earth before her sons appeared."
Character is much easier kept than recovered.
If you don't eat garlic, they'll never smell it on you.
Cats, proof that eating and sleeping isn't all bad.
Dan Quayle: the EDLIN of Vice-Presidents.
Scrute the inscrutable;  eff the ineffable.
Every hard-boiled egg is yellow inside.
Apology is only egotism wrong side out.
You tell 'em Electricity, You can shock 'em.
Silence is more eloquent at times than words.
Outside noisy, inside empty.
Madre que consiente engorda una serpiente.
This fellow's wise enough to play the fool.
Adult:  One old enough to know better.
Excess is never enough.
You tell 'em Envelope, You're well posted.
The cautious seldom err.
The child had every toy his father wanted.
Communication.. without it, everyone's a mushroom.
I can resist everything except temptation.
I can resist everything/anything except temptation.
PCs are OK except when you use them as bowling balls.
Stupidity is no excuse for not thinking.
Assassination is the extreme form of censorship.
Poker Face: The face that launched a thousand chips.
If you don't fall down, you're not trying!
The ripest fruit falls first..
"Modesty died when false modesty was born." Mark Twain
A great many family trees were started by grafting.
The greatest of faults is to be conscious of none.
Both of his feet are firmly planted in the air.
Bachelor: Plays the field until the field comes in.
His face was filled with broken commandments.
Don't knock President Fillmore; he kept us out of VietNam
Notice: All incoming fire has the right of way.
To live now, first come to terms with your past.
God made the first garden, Cain the first city.
Ivo Andric - Yugoslavia's First Nobel Laureate.
Learning makes people fit company for themselves.
Where are those flashbacks they promised me?
"Don't worry, I'm fluent in weirdo"
"Oh could I fly, I'd fly with thee ..."
Seek not to follow footsteps but what they sought.
Words are not food, though sometimes we must eat them.
Meetings are indispensable for not doing anything.
SHIN - A device for finding furniture in the dark.
Nickel: Once good for getting the wrong number with.
Solution Series: Works for Windows, Publisher and Money
A fool searches for a greater fool to find admiration.
Are you waiting for your prey?
What are friends for? - R.M. Nixon
Wait!  That's the FORBIDDEN dance! 
You aren't here forever, Enjoy each day as a miracle.
Life is lived forwards, but understood backwards.
Swell-head: Nature's frantic effort to fill a vacuum.
"A book, a friend, a song, a glass, a chaste loving lass"
A pest: A friend in need.
Young gorillas are friendly, but they soon learn.
Mischief all comes from too much opening of the mouth.
Genealogy. Tracing descent from someone who didn't.
Cats are like furry dilettanti, or the reverse? 
You tell 'em Gambler, You've got winning ways.
Security is a game but the final goal is never reached.
The thing most generally raised on land is taxes.
Everyone is a genius at least once a year.
Criminal: One who gets caught.
Even a philosopher gets upset with a toothache.
Monotheism is a gift from the gods!
Angling: The name given to fishing by non-fishermen.
Remember................. Wherever you go, there you are.
Mosquito: Designed by God to make flies seem better.
Those whom the gods love grow young.
"I thank whatever gods may be for my unconquerable soul."
Against stupidity, the Gods themselves, contend in vain !
A pitcher that goes to a well too often is broken first.
As I was going up the stair, I met a man who wasn't there
You tell 'em Goldfish, You've been around the globe.
Obesity: A surplus gone to waist.
This is a good day to let down old friends who need help.
Women take to good hearted men. Also from.
Hero-worship: Idol gossip.
No person should govern another without their permission.
Misteaching: Telling one's grandmother how to suck eggs.
Dancing with a grass widow brings on hay fever.
Always do right: Gratify some and astonish the rest.
Epitaph on a gravestone: Cheerio, see you soon.
Many foxes grow gray, but few grow good.
"Life has a great deal up its sleeve." 
Greed is good, greed works.
Make two grins grow where there was only a grouch before.
Today I have grown taller from walking with the trees.
I wish Adam had died with all his ribs in his body.
If youth only had a chance or old age any brains.
Well begun is half done.
A big enough hammer fixes anything
Use your enemy's hand to catch a snake.
Politics: The glad hand and the marble heart.
Many kiss the hand that they wish cut off.
Money can't buy happiness, but allows a choice of misery.
Freedom is a hard-bought thing - A gift no man can give.
A miser is hard to live with, but makes a fine ancestor. 
A miser is hard to live with, but makes a fine ancestor. 
Old birds are hard to pluck.
That's right, try hard to be good at the game of life.
You tell 'em Hard-Boiled Egg, You're hard to beat.
Back Up My Hard Drive? I Can't Find The Reverse Switch! 
Carelessness does more harm than a want of knowledge.
A KGB keyboard has no <ESC> key!
Even the lion has to protect himself against flies.
The Caldecott Tunnel has less traffic than that vagina.
Friend: Anyone who has the same enemies you have.
How much memory have you got?  One brain, one memory.
Some settling may have occurred in shipping. 
Thousands of journeys have a start but no end.
Drop your carrier...We have you surrounded! 
Sir Lancelot, you have chain mail in Knight's Conf
Only the rich have distant relatives.
Teaching: Appearing to have known your subject forever.
Do well, you hear it never. Do ill, hear it forever.
"Shake off your heavy trance! And leap into a dance."
A little truth helps the lie go down.
What we have here is a failure to communicate.
So crowded in here, I must go outside to change my mind!
If I were here more often, I wouldn't be gone so much.
Evil is a hill.  We stand on ours, speak about others.
To a dog his owner is Napoleon; hence their popularity.
It's only a hobby ... only a hobby ... only a.
Fiction: It can't hold a scandal to biography.
Charity begins at home, and mostly ends where it begins.
Fishing rod: a hook at one end, a fool at the other.
You tell 'em Horse, You carry a tale.
If wishes were horses, beggars would ride.
Tact is knowing how far to go in going too far.
To be a human without passion is to be dead.
You tell 'em Hunter, I'm game.
The truth doesn't hurt unless it ought to.
Fear not, for I have given you authority 
To the Caliph I am dirt, but to dirt, I am Caliph.
"Frankly my dear, I don't give a download!" -Rhett Sysop
If I die, I forgive you, if I recover, we shall see.
Not now ... I have to go mow the laundry.
As long as I live, I shall be, myself, no other, just me.
Trust me, would I lie to you..... TWICE?
To whom should I go to for some self-help?
Shut up, or I'll nail your other foot to the floor.
"I'm so bored, I'm starting to miss my husband."
I think that I'm the friendliest guy in my zipcode.
--T-A+G-L-I+N-E--+M-E-A+S-U-R+I-N-G+--G-A+U-G-E--.
It works better if you plug it in *AND THEN* turn it on.
Youngsters remember anything if it happened or not.
It works better if you plug it in where it should be.
Is it progress if a cannibal uses a knife and fork?
The greater the ignorance the greater the dogmatism.
Power is an illusion; only stupidity is real.
Planned parenthood --- the impossible dream.
We all live in a yellow subroutine.
One who is in peril thinks with their legs.
Blessings never come in pairs; misfortunes never alone.
It is hereditary in my family to have no children.
What is learned in youth is understood in age.
ROM wasn't built in a day.
He who falls in love with himself will have no rivals.
Don't hate yourself in the morning - sleep till noon.
Do not sleep in a eucalyptus tree tonight.
There's no skeletons in my closet! 
A jerk present in a group indicates a jerk in charge.
When uncertain, or in doubt, run in circles and scream.
"A Robin redbreast in a cage puts all heaven in a rage."
Instinct is intelligence incapable of self-consciousness.
Corruption. The most infallible symptom of liberty.
Human Being: An ingenious assembly of portable plumbing.
Tact is the intelligence of the heart.
Worry is the interest paid on trouble in advance.
All rivers run into the sea, yet the sea is not full.
Travel important today;  IRS men arrive tomorrow.
A learned fool is more foolish than an ignorant fool.
At 19, everything is possible; tomorrow looks friendly.
The greatest fault is to be conscious of none.
When all else is lost, the future still remains.
Living on earth is better than loafing around Hades.
The worst hatred is that of relatives.
One person's <grin> is another's <groan>.
To tolerate everything is to teach nothing.
The greatest cunning is to have none at all.
Talking of bulls is not like being in the bull ring.
The shortest answer is doing.
A good memory is one trained to forget the trivial.
The only certainty is that nothing is certain.
Hi.  My name is Rover, I'll paint your car yellow free.
A belly button is for salt when you eat celery in bed.
Society like air, is necessary but not complete for life.
The best armor is to keep out of range.
Too often justice is incidental to law and order.
Not to know is bad, but not to wish to know is worse.
The best doctor is the one you run for and can't find.
Non-fiction often is more unrealistic than fiction.
The trodden path is the safest.
Rebellion to tyrants is obedience to God.
An accommodating vice is better than an obstinate virtue.
Firmness in politics is called obstinacy in a donkey.
Learning without thought is labor lost.
A good scare is better than good advice.
A leap year is never a good sheep year.
A lawyer's opinion is worth nothing unless paid for.
A hen tomorrow is more valuable than an egg today.
A leap year is never a good sheep year.
To do nothing is in every person's power.
Unless to thought is added will, Apollo is an imbecile.
Acting without thinking is like shooting without aiming.
The living world is a continuum in each and every aspect.
A verbal contract isn't worth the paper its written on
If you find it, it is always in the last place you look.
Love your enemies -- it makes them so damned mad.
What good does it do an ass to be called a lion?
I finally got it all together, but forgot where I put it
Good printers do it without wrinkling the sheets.
Money is round, it rolls away.
Your sin, was it of omission, commission, or emission?
I don't want it now, I want it RIGHT now!
"To live long, it is necessary to live slowly." Cicero
Difficult? I wish it had been impossible!
Yield to temptation; It may not pass your way again.
Spaghetti code = job security.
There is no joy in Mudville, mighty Casey has struck out.
The Day of Judgement is approaching, or it is not.
You tell 'em June, And don't July.
My reality check just bounced.
What the heck just happened here? 
Poker: It's darkest just before you've drawn.
Santa's elves are just a bunch of subordinate Clauses.
Nobody can be just like me. Even I have trouble.
Retreat hell! We're just fighting in another direction.
Humpty Dumpty DOS - Just a shell of himself.
Little boats should keep near the shore.
DANGER! Human at keyboard! 
Drink! for you know not whence you came, nor why...
To live well, know the difference between good and evil.
Psychic Con: You know where and when 
Drink! for you know not why you go, nor where...
A child prodigy knows not to bother with it.
To climb a ladder, you begin with the first rung.
Tact: Recalling a lady's birthday but forgetting her age.
No wonder can last more than three days.
Consistency is the last refuge of the unimaginative.
"Our first and last love is -- self-love." Bovee
Happiness is no laughing matter.
Custom is the law of fools.
He is no lawyer who cannot take two sides. 
A hen who lays an egg cackles as if it was an asteroid.
Philosophy: A route leading from nowhere to nothing.
One lie always leads to another.
I'd give my left arm to be ambidextrous 
ATTENTION ..............Elvis has left the echo.
"And God said, Let there be light: and there was light."
Beware when God lets loose a thinker on this planet.
The tree of liberty is watered with the blood of tyrants.
A beard signifies lice, not brains.
Art is a lie that makes us realize the truth.
"What is a lie but the truth in masquerade." Byron
All your future lies beneath your hat.
A well-written life is as rare as a well-spent one.
That concept looks like a chicken in a windstorm.
Nobody can be like me. Even I have trouble doing so.
Network management is like trying to herd cats... 
Things are more like they used to be than they are now.
The earth is like a tiny grain of sand, only heavier
The world is like a cactus except the pricks are inside.
Stupidity has no limits, genius does.
Let's have a little fun, let's do a pun.
Better to understand little than misunderstand a lot.
Think much, speak little, and write less.
I'd like to live like a poor person with lots of money.
I want to live with a synonym girl... 
God dislikes money -- look who he gives it to.
Civilized people need love for full sexual satisfaction.
It's love, it's love that makes the world go round.
Everyone as they loveth, some people kiss cows.
Usually insane; in lucid moments merely stupid.
It is bad luck to be superstitious.
Diplomacy: The patriotic lying for one's country.
We are as made by God us, and often a great deal worse. 
If you can't make it work, make a statistic of it.
When you can't make it GOOD, make it BIG!
Two writes don't make a novel!
Silver and gold make even pigs seem clean.
The wildest colts make the best steeds.
Too many pages make a tome.
Money: A mint makes it first and we try to make it last.
Bigamist: One who makes the same mistake twice.
Behind every successful man stands a surprised MIL.
A truly wise man never plays leapfrog with a moose.
"A man's a man for a' that!" Burns
A worthless wise man always charms the rabble.
Man's inhumanity to man makes countless thousands mourn.
You tell 'em Manicurist, I've been trimmed.
He has too many lice to feel an itch.
"Every woman should marry -- and no man." Disraeli
"All clowns are masked, all personae flow from choices"
Fame: Chiefly a matter of dying at the right moment.
Does it really matter which cola I drink?
What a day may bring, a day may take away.
Scotty! Hurry! Beam me uragg^* NO CARRIER
Do you like me for my brain, or my BAUD?
Never agree with me, it shakes my self confidence.
Where you've been means much less than where you're going
Blessed are the meek, for they make great scapegoats.
"Love -- a grave mental disease."  Plato
"Maytag" is my middle name; I'm an agitator.
To keep your milk sweet, leave it in the cow.
Theater: Holding a mirror up to a keyhole.
To understand other's miseries, look at their pleasures.
Man is the missing link between apes and human beings.
Computers don't make mistakes, but foolish people do.
Flattery is counterfeit money, circulated by vanity.
You tell 'em Moon, You're out all night.
"Everything's got a moral if only you can find it." 
What fools these morals be!
There's always 1 more SOB than you counted on
The wise learn more from fools than fools from the wise.
Cow's breath attracts mosquitoes and tsetse flies!
He is the most sensible looking man talking nonsense.
Leisure is the mother of philosophy.
Russian Express Card motto: Don't leave home!
You tell 'em Mountain, I'm only a bluff.
An elephant: A mouse built to government specifications.
Honey in the mouth and knives in the heart.
Civilization is a movement, it is a voyage not a harbor.
You must know much before you know how little you know.
You learn as much by writing as you do by reading.
If you throw mud,  you will have dirty hands.
None but a mule denies his family.
Mister!  Here's your mule! 
Rap is to music as Etch-A-Sketch is to art. 
With foxes we must play the fox.
Philosophic enjoyment = mutual  misunderstanding.
I may have my faults, but being wrong ain't one of them.
I haven't lost my mind..It must be backed-up somewhere.
I use windows...on my car, on my house, but not on my...
If you want my advice, pay me!
hAS ANYONE SEEN MY cAPSLOCK KEY?
Ethics is not necessarily the handmaiden of theology.
Children have more need of models than of critics.
What this country needs is a good five-cent nickel.
Remember, the end never justifies the meanness.
The sun is never the worse for shining on a dunghill.
Women and elephants never forget real or supposed injury.
"Women and elephants never forget." Parker
Just got a new car for my wife... Great trade... 
"God said, "Let Newton be!" and all was light." Pope
Homo sum; humani nihil a me alienum puto.
An atheist has no invisible means of support.
Beauty faded has no second spring.
Judicial reform is no sport for the short-winded.
Where there is no shame, there is no honor.
En boca cerrada no entran moscas.
Easy as pie, no fuss, no muss, no crust....
Dios tarda pero no olvida.
When we are not sure, we are alive.
The past is not what it will be.
The cinema is not a slice of life but a piece of cake.
Closed eyes are not always sleeping. 
The future is not what it used to be.
The consumer is not a moron, it is your spouse.
Incorrigible punster -- do not incorrige!
"The law hath not been dead, though it hath slept." Shake
The city is not a concrete jungle.  It is a human zoo.
5" floppy is not better than 3" hard.
Education which is not modern, faces the organic fate.
A crappie is not a sunfish found in a toilet.
Honesty pays, but not enough for some.
It's nobody's business, not even mine.
A mother is not a dust rag.
A bigot will not reason, a fool cannot, a slave dare not.
Art is vision not expression.
One crow will not peck out another crow's eyes.
All things change, nothing is extinguished.
A hole is nothing, but you can break your neck in it.
Man: There is nothing more miserable and more arrogant.
God gives the nuts, but He does not crack them.
Penguin: The headwaiter of the Antarctic.
This open hand of desire wants everything.
Vulgarity: The conduct of others.
Oh well, half of one, six dozen of the other. 
In the country of the blind, the one-eyed man is king.
A living example of Artificial Intelligence.
Graveyards are full of the indispensable.
Shake, a man of note, wrote so many things to quote.
.... a deluge of words and drop of sense.
The only winner of the War of 1812 was Tchaikovsky.
A male rite of passage: Writing your name in the snow.
Often the test of courage is not to die but to live.
The eventual supremacy of reason should be accepted.
Admiration: Polite recognition of self-reflection.
Psychoceramics: The study of crackpots.
Solve the problems of the world: Vote anarchist.
Rainforest: a scarcity of animals a plethora of tourists.
Endocannibalism: The result of a really hungry cannibal.
"The first sigh of love is the last of wisdom." Bret
Every valuable idea offends someone.
Lean books are often larded with the fat of others' works
Blond Mating Call:  Oh, I'm so drunk [giggle]!!
If you're too old to learn, you were born so.
Marriages are based on believing you won the arguments.
Since life goes on - you might as well get on with it.
The Devil falls on account of his gravity.
If God lived on earth, people would break his windows.
Knowledge rests not on truth alone, but upon error also.
The truth is one thing that nobody will believe.
All for one; one for all; ME above all!
An ass thinks one thing, his rider another.
"Let's win this one and go home." - George A. Custer 
An agreeable person: One who agrees with you.
Life is an onion and one peels it crying.
Don't shoot! I'm only the Casio player! 
Everybody is ignorant, only on different subjects.
This tagline is only for the living.
He is not only dull within, but causes dullness without.
Many receive advice, only the wise profit by it.
People are the only creatures with the power of laughter.
America is the only country founded on a good idea.
Marriage is the only adventure open to the cowardly.
You tell 'em Operator, You've got their number.
Drama in her opinion is knowing how to fill a sweater.
Radical: Anyone whose opinion differs from ours.
Beware of the opinion of someone without any facts.
Ever wonder why Oprah spelled backwards is Harpo?
Lunatic asylum: where optimism most flourishes.
Either he's dead or my watch has stopped.
Adam's Rib: The original bone of contention.
Shame is an ornament to the young, a disgrace to the old.
The best way out of a difficulty is through it.
When puns are outlawed only outlaws will have puns
"The only victory over love is flight."  Napoleon
I can't be overdrawn, I still have checks! 
You tell 'em Owl, You're wise.
We make our own fortunes and call them our fate.
Quien da el pan impone la ley.
Love truth but pardon error.
Chance makes our parents, but choice makes our friends.
Hello, I am part number ޺۳ݳݳ.
Confirmation of the past is often the greatest surprise.
Tips: Wages we pay other people's hired help.
Mountains culminate in peaks, and nations in people.
All words are pegs on which to hang ideas.
All words are pegs on which to hang ideas.
Guns don't kill people, off-line readers do.
Of all the people I have met, you are certainly one
Whenever Possible, Put People On Hold 
Sinner: A stupid person who gets found out.
Strength of mind: Person who can eat one salted peanut.
No sense being pessimistic.  It wouldn't work anyway. 
You tell 'em Piano, You're upright and square.
Hollywood is like Picasso's bathroom.
"Man is a piece of the universe made alive." Emerson
Whoso diggeth a pit shall fall therein.
Restaurant: An eating place that does not sell drugs.
Art is either plagiarism or revolution.
Originality is undetected plagiarism.
You tell 'em playing cards, You know the joker.
Reader not found, please notify tagline.
It is double pleasure to deceive the deceiver.
"A pound of pluck is worth a ton of luck."  Garfield
*NOW* is a point in time that is already gone.
That was a pointing device? My cat thought it was dinner.
Bedfellows make strange politicians.
The purification of politics is an iridescent dream. 
Ambition destroys its possessor.
Never underestimate the power of human stupidity.
Keyboard not connected, press <F1> to continue.
I do not pretend to know what the ignorant are sure of.
A ounce of pretension = a pound of manure!
You tell 'em Printer, I'm not your type.
As lacking in privacy as a goldfish.
Morality is a private and costly luxury.
College: Guarantee the quality of the product or return.
Assumption #1: Dan Quayle is smarter than broccoli.
Dime de lo que blasonas, y te dire de lo quwe careces.
Fax me no questions, I'll Fax you no lies!
"Heaven has no rage like love to hatred turned." Congreve
You tell 'em Railroad, It's not along my line.
Sailors curse the rain that farmers prayed for in vain.
f u cn rd ths, u cn gt a gd jb n cmptr prgmmng 
I used to read books.  Now I read .qwk files. 
Prejudice is the reason of fools. Voltaire.
Praise: What you receive when you are no longer alive.
We are all related...relatively speaking 
Computers can never replace human stupidity.
Art does not reproduce the visible; it makes visible.
Disease is the retribution of an outraged nature.
Actions are usually right, but the reasons seldom are.
To know the road ahead, ask those coming back.
Doubt is the root of education, not faith.
Once uttered, words run faster than the horses i bet on.
Ostrich: He often runs so fast he leaves himself behind.
Carasvemos, corazones no sabemos.
Self-sacrifice: to sacrifice others without blushing.
Art for art's sake is a philosophy of the well-fed.
Nobody shoots at Santa Claus.
Stulti timent fortunam sapientes ferunit.
Being able to say NO is the root to reclaiming your life.
If three people say you are an ass, put on a bridle.
Today is the scene of the accident.
Iron sharpens iron; scholar, the scholar.
Art is I; Science is We.
Sub omni lapide scorpio dormit.
"Beam me aboard, Scotty." "Sure. Will a 2x10 do?"
Quien con perros se acuesta con pulgas se levanta.
Put on your seatbelt. I'm gonna try something new. 
All sentences that seem true should be questioned.
A wise person sees as much as ought, not as much can.
He is a self-made man, and worships his creator.
"Everyone lives by selling something." - R.L. Stevenson 
You tell 'em September Morn, No one has anything on you.
How do I set my Laser Printer to "Stun"?
Boot & ye shall see. Replace & all will be made clear.
Let art alone. She's got enough guys sleeping with her.
He is a sheep in sheep's clothing.
You tell 'em Shoemaker, You know awl.
You realize how short a month when you pay alimony.
God gave burdens shoulders also.
Si jeunesse savoit, si vieillesse pouvoit.
Movement To Ban Silly Tag Lines; Send Donations to:
You tell 'em Simon, I'll Legree.
It is a sin peculiar to people to hate their victims.
Angels can fly since they take themselves lightly.
Money is the sinews of both love and war.
Of all thirty-six alternatives, running away is best.
If the family skeleton must remain, make it dance.
There is a skeleton in every old house.
Doctrine is the skin of truth set up and stuffed.
Never trust a skinny cook. 
You tell 'em Skyscraper, You have more than one story.
Nothing is so smiple that it can't get screwed up.
Don't be a snob. Never lie when truth is more profitable.
Old age isn't so bad when you consider the alternative.
My mind ain't so open that anything can crawl right in. 
Subway: A place so crowded even men can't all get seats.
Why are there so many gnarly limbs on my family tree? 
if you want someone to keep a secret, keep it yourself.
Teamwork gives you someone else to blame.
Nature, like people sometimes weeps for gladness.
The deeper the sorrow, the less tongue hath it.
It's a poor sort of memory that only works backwards.
You may be Southern -- but you're no Comfort.
Computers also eliminate spare time.
She devotes her spare time to neglecting duties.
Wit is the spice of conversation, not the food.
Army food: The spoils of war.
A word fitly spoken is like a beautiful apple of gold.
All wiyht.  Rho sritched mg kegtops awound?
43% of all statistics are totally worthless !!!
Isn't there a statute of limitations on stupidity?
DANGER DANGER Computer store ahead...hide wallet.
A true diplomat struts sitting down.
I can't be stupid, I completed third grade!
I may be stupid, but that still makes me smarter than you
Ignorance is temporary; stupid is forever.
The race from stupidity is to the driven, not the swift.
Malice is merely stupidity raised to a higher power.
You tell 'em Submarine, I can't seaplane.
Earth: A solid substance, much desired by the seasick.
There is no such thing as bravery; only degrees of fear.
Your sweet words suck the morning dew off the honeysuckle
I would have suffered a lot more if understood.
"And when fate summons monarchs must obey;"
A day without sunshine is like night.
Error reading FAT Table...Try Skinny one ? (Y/N)
Let's see your tagline hunting permit, sir.
To steal this tagline press <CTL> <ALT> <DEL> now. 
Not a real tagline, but an incredible soy substitute.
The UARTs won't take this speed, Captain.
Stick to your talent and the cows will be well tended.
You tell 'em teacher, You've got the class.
Dew is the tears which the stars weep.
"No, I didn't." - Teddy Kennedy
Only I can tell where my own shoe pinches me.
Any fool can tell the truth, it takes sense to lie well.
A person never tells you anything until contradicted.
Enough research will tend to support your theory. 
"A lie is terminological inexactitude." Churchill
Sysoping: More fun than being beaten with a sledgehammer.
Actions speak louder than words -- but not so often.
I'm more humble than you are!
Prevention is better than cure.
Blood is thicker than water, and much more tastier.
Software, hardware, -- is that you talking Sigmund?
SYSOP: The guy that is laughing at your typing!
Been there, done that, got the T-shirt.
Committee: A body that keeps minutes and wastes hours.
A thief believes that everybody steals.
Only the hand that erases can write the true thing.
Prune: A plum that has seen better days.
Dan Quayle thinks that Cheerios are donut seeds.
It's a tragedy that no man become like their mothers.
Echo: Only thing that cheats some out of the last word.
You can't do that. It's been digitally cursed. 
Th-th-th-that's all, folks!
"Logic is logic. That's all I say." Holmes
Hot air sometimes thaws out a cold reception.
Indiscriminate study bloats the mind.
Hmmm, When is the last time the Tooth Fairy visited you?
Every person is the architect of their own fortune.
The young know the rules, the old know the exceptions.
(A)bort, (R)etry, (S)mack the @#$&*~ thing!
It runs in the blood like wooden legs.
Feather by feather the goose is plucked.
A bachelor enjoys the chase but doesn't eat the game.
The fish in the sea are as good as the fish removed.
A bird in the hand's better than one overhead.
Ancient custom has the force of law.
Bastard toadflax: not the result nearsighted horny toads.
A pain in the butt may be a friend in need.
A bird in the bush can't make a mess in your hand.
The pen is the tongue of the mind.
"Look at all the Indians!" - General Custer
Good taste is the flower of good sense.
Applied emotion is the key to success with happiness.
A book is the only immortality.
So dumb: Chewing the stick, not sucking the lollipop.
The hole and the patch should be commensurate.
A teetotaller makes the worst drunkard.
TV advertising is the rattling inside a swill bucket.
We have met the enemy, and he's all yours!
The proof is the phylogeny of plant-animal interactions.
"Forgotten men at the bottom of the economic pyramid" FDR
If I save the whales, where do I keep them?
The footprint of the owner is the best manure.
A statesman shears the sheep; the politician skins them.
"Fountains mingle with the river, rivers with the ocean."
Live so that the family parrot can live afterwards.
Celery farmers play the stalk market.
To live in the hearts we leave behind, is not to die.
Parents: One of the hardships of a minor's life.
I only wrote the thing, I don't have to understand it!
Biography: One of the terrors of death.
Hospitals: Places where the run down wind up.
"The welfare of the people is the chief law."  Cicero
Yeah, but what's the speed of DARK? 
A vote on the tally sheet is worth two in the box.
No one test the depth of a river with both feet.
I have seen the future and it is now the past.
Forget RTFM - Call The Author At Home! (@ 23:45)
Every person constructs their own bed of nails.
Where law ends, there tyranny begins.
Where's there's smoke, there's toast. 
I think ... therefore I am overqualified.
Mistrust first impulses, they are always good.
Blessed our young they will inherit our national debt.
"How wise are they that are but fools in love!" Cooke
Unbelief in one thing springs = blind belief in another.
Postscript: The only thing of interest in some letters.
there are three things that come next, uh four... 
Nobody notices when things go right, I'm always noticed. 
Nobody notices when things go right, and I'm noticed. 
Facts are stubborn things.
No one can think clearly with clenched fists.
The characters in this message are recyclable
That was then, this is now.
May we kiss those we please, and please those we kiss.
He says a thousand pleasant things, but never "Adieu."
Hollywood: A trip through a sewer in a glass bottom boat.
Put off procrastinating till a later time.
Yawn: The only time some men get to open their mouths.
Mr. Bullfrog says: Time is fun when you're having flies. 
The longer the title, the less important the job.
It is easier to catch flies with honey than with vinegar.
It is easy to propose impossible remedies.
If worst comes to worst, you *CAN* turn most things off.
It is easier to admire hard work if you don't do it.
Modem.... A deterrent to phone solicitors. 
It is meaningless to speak of domesticating a child.
It is dangerous to confuse children with angels.
Uh, yeah...I MEANT to do that!
A noisy exhaust to some almost amounts to a mating call.
Every person gets to heaven in their own way.
When you go to the market, use your eyes, not your ears.
Women's clothes: Go to extremes, seldom to extremities.
It is hard to believe that even his friends like him.
Never lean forward to push an invisible object.
Luxury: Costs $7.69 to make and $20.00 to market.
Everyone IS entitled to my opinion.
Dogmatism: Puppyism come to its full growth.
Cleanliness is next to "clean-limbed," in the dictionary.
Everyone is entitled to my opinion.
What garlic is to salad, insanity is to art.
Press any key to continue or any other key to quit.
It is better to know useless things than to know nothing.
If people listened to themselves, they would shut up.
It is better to know nothing than to know what ain't so.
The only way to get rid of a temptation is to yield to it
The only way to judge the future is by knowing the past.
We hired you to baby sit. You cooked and ate them BOTH? 
'Tis the season to be punny......
If you want to hide your face, walk naked.
Flattery: Cologne water, to smell but not swallow.
Are we supposed to be having fun yet? 
Here I run, to steal the secret of the sun.
Is it OK to yell 'MOVIE' in a crowded firehouse? 
A person slow to anger is better than the mighty.
Maybe it's right to be nervous now... 
If you try to be too sharp, you will cut yourself.
The best way to save face is to keep the lower part shut.
It takes two to make a bargain.
What grammar is to speech, logic is to reason.
Stupid: Being unable to find your own butt in the dark.
Here today, dawn tomorrow.
Bubble, Bubble..Am I too late to jump the ship ??
You cannot be too careful in the choice of your enemies.
"Men know life too early, women too late" Wilde
He who talks too much commits a sin.
Seeing is believing, Touching is convincing..
The first step towards philosophy is incredulity.
Life is a tragedy for feelers and a comedy for thinkers.
If it isn't true, at least it is a happy invention.
Legal Marijuana needs true glaucoma patients. 
The course of true anything never does run smooth.
What is the True meaning of DOS?
Without love and trust all you can be in life is alone.
In God we trust; all others must pay cash.
Autobiography: Unrivalled telling truth about others.
America is a tune.  It must be sung together.
You can't step twice in the same river.
When choosing between two evils, select the newer one.
Hypocrisy is the type of homage vice pays to virtue.
This tagline is umop apisdn.
She has been under more drunken sailors than a head.
With consequences,  the unexpected always predominate.
Sculptor: A poor unfortunate who makes faces and busts.
Always remember you're unique - just like everyone else.
Reality.Sys corrupted -- Reboot Universe (Y/N)?
Anybody can win, unless there is a second entry.
Talk is cheap, until you hire a lawyer.
It's not over until the FAT table sings
We NEVER grow up, we just get older, and older, and ...
Hey! Don't pick up that phoׯች  NO CARRIER 
Contraceptives: to be used on all conceivable occasions.
*  <|-)  User is Chinese.
*  :-*   User just ate something sour.
What results from using spot remover on your dog Spot?
A father is usually a banker provided by nature.
This tagline no verb.
Se non e vero, e molto ben trovato.
Seriousness is the very next step to being dull.
Two of perfect virtue: one dead, the other yet unborn.
No wanna work.  Wanna bang on keyboard. 
Do I even WANT ancestors? Some found I wish I could lose.
The fewer our wants, the more we resemble the gods.
The bird of war is not the eagle but the stork.
Oh, pardon me, was that *your* culture? So sorry.
Oh that?  It was playing leap frog with a unicorn.
"To love her was a liberal education." Steele
WARNING... drinking tap water may kill your thirst!
Everyone meets their Waterloo at last.
Hug: A roundabout way of expressing affection.
Hick: Looks both ways before crossing a one-way street.
The world, as we know it, has come to an end!!
Madam, an error, we did a hysterectomy on your husband
We're lost, but we're making good time.
Illustrate your Sermons! Wear "far side" ties. 
My Hard Disk went on a diet and lost it's FAT
What if there were no hypothetical situations?
To excel at what you do, you must love doing it.
Used Car: Not what it is jacked up to be.
MacIntosh:Computer with training wheels you can't remove.
How time flies, when you are in a heap of problems..
Wear old clothes when you fight for truth and liberty.
Public opinion flourishes where there are no ideas.
Wedding: A funeral where you smell your own flowers.
A conclusion is where you got tired of thinking.
You always swat where he's not, or if he is aha! a spot.
Resort: A place where the tired grow more tired.
Laundry: A place where clothes are mangled.
Gnaw the bone which has fallen to thy lot.
Think hard now!  Which one is Shinola?
Never trust anyone who speaks well of everyone.
Yes-men: Fellows who hang around the man nobody noes.
Creditor: A man who has a longer memory than a debtor.
"They also serve who only stand and wait."
Hobo: A person who builds palaces and lives in shacks.
They are slaves who fear to speak for the fallen & weak.
Bore: A person who talks when you wish him to listen.
Golfer: A person who hits and tells.
Honest Politician: One who stays bought.
No generalization is wholly true, not even this one.
Religious people are wicked, how would they be without?
Cities, like cats, will reveal themselves at night.
Faint hearts never win in love nor sell life insurance.
From listening comes wisdom, from speaking, repentance.
Many possess the wisdom of many and only the wit of one.
Adversity makes people wise but not rich.
Some are weather-wise, some are otherwise.
How dieth the wise man? As the fool.
"But, if ye wish her gratefu' prayer, Gie her a haggis!"
Think carefully before wishing, it might just come true.
I'm a hero with coward's legs.
(A)bort (R)etry (I)nfluence with large hammer.
Repartee: An insult with a suit and tie on.
The only argument with the wind is to put on a coat.
Tabloid: A newspaper with a permanent crime wave.
Kibitzer: A person with an interferiority complex.
"You spotted snakes with double tongue... be not seen."
Memories keep the wolf of insignificance from the door.
"Man, born of woman is of few days; full of trouble." Job
Think and you won't sink.
Please! Take my word for it.
Software independent: Won't work with ANY software.
Minds, like parachutes, work only when open.
Shareware it only works if you pay.
It's better the world wonder why you *AREN'T* President.
What is the world to a man when his wife is a widow?
"Men die and worms eat them - but not for love"  Shake
Some cures are worse than the disease.
If it's not worth doing, it's not worth doing well.
A hangover  the wrath of grapes 
Biography should be written by an acute enemy.
Abandon all hope, ye who press  here 
All hope abandon, ye who enter messages here.
Dollars cannot buy yesterday.
Do well and you will have no need for ancestors.
The hard disk you save may be your own.
At all ages you are certain you still have another year.
A gun gives you the body, not the bird.
I be nibble, you be quick, he jumped over the Joystick.
If at first you don't succeed; Blame everyone else
If at first you don't succeed, skydiving is not for you.
If at first you doubt, doubt again.
It's what inside you, not the outside that counts.
If at first you don't succeed: Blame everyone else.
Simple rule: If you don't treat me right, shame on you.
If at first you doubt, doubt again, and again ...
Youthful figure: What you get when asking a woman's age.
Hotel: A place you give good dollars for bad quarters.
If I were you, who'd be me?
No matter where you go, there you are.
It is when you take for yourself that you truly take.
Synonym: A word you use when you can't spell the other.
Spring makes everything young again except humans.
You can close your eyes to reality but not to memories.
A penny for your thoughts; $20 to act it out.
Without my ignorance, your knowledge would be meaningless
You can't eat your friends and have them too.
Be nice on your way up, you'll meet on the way down.
Middle age: When your age starts to show at your middle.
Before advising "Be yourself!" reassess his character.
