===== TurboTerm v2.5 : Log : Thursday 04/29/1993 @ 23:53:02 ===== unseen@phantom.com _______________________________________________________________ Type UPDATE for System News -=]) [No New Mail] (3:08am) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: READ -=/[ [1385] New Messages / Begin Reading at (#846) ]/=- [ Area: Babylon / Forum: Bandwidth ] [Return] 1-2230, [Q]uit: > [ Area: Computers / Forum: Advocacy ] [Return] 1-30, [Q]uit: -=/[ End of All Songs / [No Further Messages] ]/=- [ Area: Computers / Forum: Advocacy ] [Return] 1-30, [Q]uit: > [ Area: Creative-Arts / Forum: Art ] [Return] 1-17, [Q]uit: > [ Area: CyberSpace / Forum: Active-Matrix ] [Return] 1-208, [Q]uit: -=/[ End of All Songs / [No Further Messages] ]/=- [ Area: CyberSpace / Forum: Active-Matrix ] [Return] 1-208, [Q]uit: > [ Area: Drugs / Forum: Cognitive-Enhancement ] [Return] 1-141, [Q]uit: > [ Area: Erotica / Forum: Sexuality ] [Return] 1-256, [Q]uit: > [ Area: Health / Forum: Body-Building ] [Return] 1-34, [Q]uit: > [ Area: MindVox / Forum: Vox ] [Return] 3-1558, [Q]uit: > [ Area: Music / Forum: Alternative ] [Return] 1-226, [Q]uit: > [ Area: NYC / Forum: Apartments ] [Return] 1-20, [Q]uit: > [ Area: Religion / Forum: Christianity ] [Return] 1-129, [Q]uit: > [ Area: Technology / Forum: Audio ] [Return] 1-18, [Q]uit: > [ Area: Virtual-Reality / Forum: Entertainment ] [Return] 1-40, [Q]uit: > [ Area: Zones / Forum: Current-Headlines ] [Return] 1-60, [Q]uit: > [ Usenet Newsgroup: general ] [Return] 229-231, [Q]uit: > [ Usenet Newsgroup: general ] [Return] 229-231, [Q]uit: > [ Usenet Newsgroup: general ] [Return] 229-231, [Q]uit: -=/[ End of All Songs / [No Further Messages] ]/=- [ Usenet Newsgroup: general ] [Return] 229-231, [Q]uit: > [ Usenet Newsgroup: general ] [Return] 229-231, [Q]uit: > [ Usenet Newsgroup: general ] [Return] 229-231, [Q]uit: < [ Area: Zones / Forum: Current-Headlines ] [Return] 1-60, [Q]uit: Q  -=/[ Returning to Main Menu ]/=- (3:09am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (3:09am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: CHT CHT is an invalid command. Type HELP for help. (3:09am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: CHAT CHAT is an invalid command. Type HELP for help. (3:09am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: CHAT CHAT is an invalid command. Type HELP for help. (3:10am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: CHAT CHAT is an invalid command. Type HELP for help. (3:10am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: GO CHAT A Complete list of available Forums can be displayed with the INDEX command. If you know the full name of the forum you wish to go to you may enter it by typing it's name (ie: "Go Introductions"). To search for a pattern, add a slash to the beginning of the name. For instance, "go /puter" would take you to Computers:Amiga, the first Forum with the word Computers in the name. If you wish to continue a search you may do so by simply typing "Go /" again. In In the above case this would take you to Computers:Apple. Note that to return to Computers:Amiga, you can simply type "Go Amiga" Go to Forum: That is not a valid Forum. Type INDEX for a list. (3:10am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: T WHO  MindVox [WHO] Listing ___________ _____________________ ________ ___________________________________ | | | | | | Account | Name | Page | Login Time | |___________|_____________________|________|___________________________________| (13 Accounts Currently Active) toxic Toxic Avenger NO Fri Apr 30 02:42:10 1993 drow Doug Rau NO Fri Apr 30 02:41:23 1993 simonm Simon Moon YES Thu Apr 29 21:42:11 1993 guest Guest Account YES Fri Apr 30 03:07:03 1993 roark Eric Schneider NO Fri Apr 30 02:54:30 1993 galt Carlton G. Brown NO Fri Apr 30 00:50:54 1993 sulam James Waldrop YES Thu Apr 29 13:41:07 1993 unseen Sara Jane Levinson YES Fri Apr 30 03:08:16 1993 lyre Lyre YES Fri Apr 30 03:02:27 1993 tm Terminal Mode YES Fri Apr 30 02:44:52 1993 guest Guest Account YES Fri Apr 30 03:08:57 1993 phaedra jane weaver NO Fri Apr 30 00:13:22 1993 dack Paul Recon NO Fri Apr 30 00:18:28 1993 (3:10am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (3:10am) [ Area: Zones / Forum: Current-Headlines ] (? for Menu) [Main Menu]: GO WOMEN-NLI   ONLINE (3:11am) [ Area: Zones / Forum: Women-Online ] (? for Menu) [Main Menu]: READ -=/[ [365] New Messages / Begin Reading at (#1) ]/=- [ Area: Zones / Forum: Women-Online ] [Return] 1-365, [Q]uit: L 001: Ahem.. by luddite@mindvox.phantom.com (Craz 002: Dorks by archer@mindvox.phantom.com (Richa 003: Re: Dorks by thug@mindvox.phantom.com (Murderi 004: You know... by kate@mindvox.phantom.com (Kate Al 005: Hey by dfish@mindvox.phantom.com (Drowne 006: Women, Thug & Luddite by ahmed@mindvox.phantom.com (Ahmed 007: uh yeah by sparc@mindvox.phantom.com (John G 008: yack by vortechs@mindvox.phantom.com (Vor 009: Same Old Shit by czarina@mindvox.phantom.com (Rita 010: Women online by zachs (John Zachs) 011: Women, Men....what's the difference! by pclip (Paper Clip) 012: Babes by doug (Douglas Luce) 013: Purpose of this forum by bwp (Jane Doe) 014: Purpose of this forum by czarina (Rita Rouvalis) 015: Re: Purpose of this forum by bwp (Jane Doe) 016: Re: Purpose of this forum by thug (Murdering Thug) 017: Re: Purpose of this forum by wlnjr (Lee Nussbaum) 018: Re: Purpose of this forum by bwp (Jane Doe) 019: Re: Purpose of this forum by dead (Bruce Fancher) 020: Exactly... by digital (Patrick K. Kroupa) 021: Re: Exactly... by thug (Murdering Thug) 022: Re: Exactly... by bwp (Jane Doe) -- more -- 023: Re: Exactly... by czarina (Rita Rouvalis) 024: Women Only by czarina (Rita Rouvalis) 025: Clueless computer geeks? by falconer (Steve Copold) 026: Get off our forum! by michelle (Michelle Harris) 027: Re: Get off our forum! by bwp (Jane Doe) 028: Yo Yo's by czarina (Rita Rouvalis) 029: Too late... by falconer (Steve Copold) 030: Re: Too late... by czarina (Rita Rouvalis) 031: Political identity crisis by cudigest (Jim Thomas) 032: Re: Political identity crisis by bwp (Jane Doe) 033: I never by czarina (Rita Rouvalis) 034: A scientist responds by cudigest (Jim Thomas) 035: Parts is parts by cudigest (Jim Thomas) 036: Re: A scientist responds by bwp (Jane Doe) 037: Re: A scientist responds to the resp by cudigest (Jim Thomas) 038: Re: A scientist responds to the resp by bwp (Jane Doe) 039: Falling.... by cudigest (Jim Thomas) 040: Re: Falling.... by bwp (Jane Doe) 041: Prezident by doug (Douglas Luce) 042: Re: A scientist responds to the resp by hotblack (Dana Watanabe) 043: etc... by cudigest (Jim Thomas) 044: Re: etc... by bwp (Jane Doe) -- more -- 045: Women / Clinton / Politics by ahmed (Ahmed Kufuti) 046: Sigh... by cudigest (Jim Thomas) 047: Slick Willie by cudigest (Jim Thomas) 048: Re: Women / Clinton / Politics by hotblack (Dana Watanabe) 049: Re: Women / Clinton / Politics by bwp (Jane Doe) 050: by brooks (Jane Brooks) 051: Re: by bwp (Jane Doe) 052: Re: by falconer (Steve Copold) 053: Re: by bwp (Jane Doe) 054: Femine by falconer (Steve Copold) 055: Re: Femine by bwp (Jane Doe) 056: Re: Femine by cudigest (Jim Thomas) 057: famine by doug (Douglas Luce) 058: Re: famine by bwp (Jane Doe) 059: Re: famine by hotblack (Dana Watanabe) 060: An Idea-- by cudigest (Jim Thomas) 061: Re: An Idea-- by bwp (Jane Doe) 062: Re: An Idea-- by cudigest (Jim Thomas) 063: Multi-topic forum by bwp (Jane Doe) 064: go for it! by black (Ronald Blackburn) 065: I third that! by klarry (Larry Kessler) 066: Re: go for it! by cudigest (Jim Thomas) -- more -- 067: Re: go for it! by bwp (Jane Doe) 068: yes! by michelle (Michelle Harris) 069: thug speaks: YES! by thug (Murdering Thug) 070: Re: thug speaks: YES! by bwp (Jane Doe) 071: Re: thug speaks: YES! by falconer (Steve Copold) 072: Why....? by cudigest (Jim Thomas) 073: Re: Why....? by bwp (Jane Doe) 074: Rules for guys with long hair by bwp (Jane Doe) 075: You paranoid twit by czarina (Rita Rouvalis) 076: lnog hair and piercing by czarina (Rita Rouvalis) 077: Re: You paranoid twit by bwp (Jane Doe) 078: cool! by michelle (Michelle Harris) 079: Rock Stars and Long Hair by czarina (Rita Rouvalis) 080: axl????? by diane (Diane Rollings) 081: women on computers by niknak (David Gans) 082: axl by czarina (Rita Rouvalis) 083: Re: women on computers by falconer (Steve Copold) 084: Dman by hotblack (Dana Watanabe) 085: Re: Why....? by hotblack (Dana Watanabe) 086: Clueless geeks and MY forum by bwp (Jane Doe) 088: Re: Why....? by hotblack (Dana Watanabe) 089: militant fem zone by black (Ronald Blackburn) -- more -- 090: rating women by hotblack (Dana Watanabe) 091: Re: militant fem zone by bwp (Jane Doe) 092: yow by doug (Douglas Luce) 093: Awwright iz everybuddy rede 2 rok & by digital (Patrick K. Kroupa) 094: Re: Gans by cudigest (Jim Thomas) 095: Gentleness by cudigest (Jim Thomas) 096: ya know by hotblack (Dana Watanabe) 097: Re: ya know by zachs (John Zachs) 098: Re: ya know by michelle (Michelle Harris) 099: Re: ya know by klarry (Larry Kessler) 100: Re: ya know by diane (Diane Rollings) 101: Re: A scientist responds by terminus (Len Rose) 102: Gad by terminus (Len Rose) 103: Re: lnog hair and piercing by composer (Jeff Kellem) 104: Re: A scientist responds by bwp (Jane Doe) 105: Re: A scientist responds by terminus (Len Rose) 106: Re: A scientist responds by bwp (Jane Doe) 107: Re: A scientist responds by doug (Douglas Luce) 108: Re: A scientist responds by cudigest (Jim Thomas) 109: Re: lnog hair and piercing by jvance (Joachim Vance) 110: Re: lnog hair and piercing by bwp (Jane Doe) 111: Re: lnog hair and piercing by cudigest (Jim Thomas) -- more -- 112: Re: lnog hair and piercing by doug (Douglas Luce) 113: Re: lnog hair and piercing by bwp (Jane Doe) 114: Re: lnog hair and piercing by czarina (Rita Rouvalis) 115: Long hair.. by hotblack (Dana Watanabe) 116: Re: A scientist responds by hotblack (Dana Watanabe) 117: Re: lnog hair and piercing by doug (Douglas Luce) 118: Re: lnog hair and piercing by ahmed (Ahmed Kufuti) 119: Re: lnog hair and piercing by terminus (Len Rose) 120: Re: lnog hair and piercing by bwp (Jane Doe) 121: Re: lnog hair and piercing by doug (Douglas Luce) 122: Re: lnog hair and piercing by bwp (Jane Doe) 123: Re: lnog hair and piercing by doug (Douglas Luce) 124: Re: lnog hair and piercing by bwp (Jane Doe) 125: Re: lnog hair and piercing by hotblack (Dana Watanabe) 126: Re: lnog hair and piercing by doug (Douglas Luce) 127: Re: lnog hair and piercing by thug (Murdering Thug) 128: Re: lnog hair and piercing by hotblack (Dana Watanabe) 129: Bulges by czarina (Rita Rouvalis) 130: Re: Bulges by falconer (Steve Copold) 131: Re: Bulges by paulk (Paul Kerrios) 132: abortion by alibaba (Nick Mordanzo) 133: Re: abortion by paulk (Paul Kerrios) -- more -- 134: Marquez by it (In Tense) 135: let me guess by deadboy (The Dead) 136: Gender/Orientation by simonm (Simon Moon) 137: Re: Gender/Orientation by doug (Douglas Luce) 138: Nope, no women online around here. by simonm (Simon Moon) 139: Re: Nope, no women online around her by holly (Holly Rothman) 140: Re: Nope, no women online around her by falconer (Steve Copold) 141: Re: Nope, no women online around her by hotblack (Dana Watanabe) 142: Re: Nope, no women online around her by thug (Murdering Thug) 143: Re: Nope, no women online around her by bwp (Jane Doe) 144: Re: Nope, no women online around her by hotblack (Dana Watanabe) 145: yes there are. by bird (Madamme Butterfly) 146: Re: Nope, no women online around her by simonm (Simon Moon) 147: Re: Nope, no women online around her by enzyme (David Pincus) 148: Re: Nope, no women online around her by cindy (Cindy Celinas) 149: Re: Nope, no women online around her by hotblack (Dana Watanabe) 150: Mating Rituals by kieran (Aaron Dickey) 151: Re: Mating Rituals by reive (Racheline Maltese) 152: Re: Mating Rituals by hotblack (Dana Watanabe) 153: Re: Mating Rituals by simonm (Simon Moon) 154: Re: Mating Rituals by reive (Racheline Maltese) 155: Re: Mating Rituals by falconer (Steve Copold) -- more -- 156: Re: Mating Rituals by hotblack (Dana Watanabe) 157: kieran by chemist (The Chemist) 158: Re: Mating Rituals by hayden (Hugh Appet) 159: Re: Mating Rituals by kieran (Aaron Dickey) 160: Re: Mating Rituals by simonm (Simon Moon) 161: Re: Mating Rituals by hotblack (Dana Watanabe) 162: Re: Mating Rituals by hayden (Hugh Appet) 163: Re: Mating Rituals by newt (Dana Bettinger) 164: why so few chix? by sassy (Sassy Magazine) 165: Re: why so few chix? by reive (Racheline Maltese) 166: Re: why so few chix? by bwp (Jane Doe) 167: Re: why so few chix? by hayden (Hugh Appet) 168: Re: why so few chix? by bwp (Jane Doe) 169: Re: why so few chix? by heather (Heather Anderson) 170: Re: why so few chix? by simonm (Simon Moon) 171: Re: why so few chix? by hotblack (Dana Watanabe) 172: Re: why so few chix? by bwp (Jane Doe) 173: Re: why so few chix? by hotblack (Dana Watanabe) 174: Re: why so few chix? by simonm (Simon Moon) 175: Re: why so few chix? by newt (Dana Bettinger) 176: Re: why so few chix? by bwp (Jane Doe) 177: Re: why so few chix? by thug (Murdering Thug) -- more -- 178: Re: why so few chix? by simonm (Simon Moon) 179: Re: why so few chix? by toxic (Toxic Avenger) 180: Re: why so few chix? by bwp (Jane Doe) 181: Re: why so few chix? by reive (Racheline Maltese) 182: Re: why so few chix? by kieran (Aaron Dickey) 183: Re: why so few chix? by kieran (Aaron Dickey) 184: Re: why so few chix? by drow (Doug Rau) 185: Re: why so few chix? by kieran (Aaron Dickey) 186: Re: why so few chix? by hotblack (Dana Watanabe) 187: Re: why so few chix? by reive (Racheline Maltese) 188: Re: why so few chix? by falconer (Steve Copold) 189: Re: why so few chix? by hotblack (Dana Watanabe) 190: Re: why so few chix? by alibaba (Nick Mordanzo) 191: all girls schools by thug (Murdering Thug) 192: Re: all girls schools by hotblack (Dana Watanabe) 193: Re: all girls schools by simonm (Simon Moon) 194: Re: why so few chix? by simonm (Simon Moon) 195: naahah.... by hotblack (Dana Watanabe) 196: Re: why so few chix? by toxic (Toxic Avenger) 197: Re: why so few chix? by hayden (Hugh Appet) 198: Re: why so few chix? by hotblack (Dana Watanabe) 199: Re: why so few chix? by reive (Racheline Maltese) -- more -- 200: Re: why so few chix? by kieran (Aaron Dickey) 201: Re: why so few chix? by kieran (Aaron Dickey) 202: Re: why so few chix? by kieran (Aaron Dickey) 203: Re: why so few chix? by kieran (Aaron Dickey) 204: Re: why so few chix? by newt (Dana Bettinger) 205: Living in the violent spaces... by falconer (Steve Copold) 206: Re: why so few chix? by chemist (The Chemist) 207: Re: why so few chix? by chemist (The Chemist) 208: Re: why so few chix? by reive (Racheline Maltese) 209: Re: why so few chix? by alibaba (Nick Mordanzo) 210: chill alring by hotblack (Dana Watanabe) 211: Re: why so few chix? by bwp (Jane Doe) 212: Re: why so few chix? by reive (Racheline Maltese) 213: Re: why so few chix? by newt (Dana Bettinger) 214: Re: why so few chix? by falconer (Steve Copold) 215: Falconer's M/C post by bwp (Jane Doe) 216: Re: Falconer's M/C post by simonm (Simon Moon) 217: Re: Falconer's M/C post by sassy (Sassy Magazine) 218: Re: Falconer's M/C post by falconer (Steve Copold) 219: Re: Falconer's M/C post by toxic (Toxic Avenger) 220: Re: Falconer's M/C post by newt (Dana Bettinger) 221: Re: Falconer's M/C post by scoundrl (Renal Boy) -- more -- 222: Re: Falconer's M/C post by falconer (Steve Copold) 223: Re: Falconer's M/C post by scoundrl (Renal Boy) 224: girls schools by reive (Racheline Maltese) 225: Re: girls schools by sassy (Sassy Magazine) 226: Re: girls schools by simonm (Simon Moon) 227: Re: girls schools by reive (Racheline Maltese) 228: Re: girls schools by newt (Dana Bettinger) 229: change of subject by sassy (Sassy Magazine) 230: Re: change of subject by newt (Dana Bettinger) 231: Re: change of subject by scoundrl (Renal Boy) 232: change of change of subj. by ehsmith (Ethan H. Smith) 234: Re: change of subject by newt (Dana Bettinger) 235: Re: hmmm...... by newt (Dana Bettinger) 236: Re: hmmm...... by reive (Racheline Maltese) 237: Re: hmmm...... by scoundrl (Renal Boy) 238: Violent Spaces Revisited... by falconer (Steve Copold) 239: Re: Violent Spaces Revisited... by newt (Dana Bettinger) 240: Re: hmmm...... by ehsmith (Ethan H. Smith) 241: Re: hmmm...... by ehsmith (Ethan H. Smith) 242: Re: Violent Spaces Revisited... by falconer (Steve Copold) 243: Re: change of change of subj. by simonm (Simon Moon) 244: icky boys in the classroom by sassy (Sassy Magazine) -- more -- 245: Re: icky boys in the classroom by deckard (Mike Gwertzman) 246: Re: icky boys in the classroom by ehsmith (Ethan H. Smith) 247: Re: icky boys in the classroom by reive (Racheline Maltese) 248: Re: hmmm...... by hayden (Hugh Appet) 249: Re: hmmm...... by newt (Dana Bettinger) 250: Re: representing your sex by deckard (Mike Gwertzman) 251: Re: representing your sex by reive (Racheline Maltese) 252: Representative Men (nice Emerson ref by ehsmith (Ethan H. Smith) 253: Re: Representative Men (nice Emerson by deckard (Mike Gwertzman) 254: gender gap?? by amada (Amy Dona) 255: Re: gender gap?? by dsharp (david sharp) 256: Re: change of change of subj. by scoundrl (Renal Boy) 257: Re: change of change of subj. by newt (Dana Bettinger) 258: Re: change of change of subj. by newt (Dana Bettinger) 259: Re: change of change of subj. by enzyme (David Pincus) 260: Re: change of change of subj. by nancykay (NancyKay Shapiro) 261: Re: change of change of subj. by newt (Dana Bettinger) 262: Re: change of change of subj. by scoundrl (Renal Boy) 263: Re: change of change of subj. by newt (Dana Bettinger) 264: squelch that goofiness by ehsmith (Ethan H. Smith) 265: Re: change of change of subj. by enzyme (David Pincus) 266: Re: change of change of subj. by kieran (Aaron Dickey) -- more -- 267: Re: change of change of subj. by scoundrl (Renal Boy) 268: Re: change of change of subj. by hotblack (Dana Watanabe) 269: Re: change of change of subj. by kieran (Aaron Dickey) 270: Re: change of change of subj. by newt (Dana Bettinger) 271: Re: change of change of subj. by newt (Dana Bettinger) 272: Re: change of change of subj. by amada (Amy Dona) 273: Re: change of change of subj. by hotblack (Dana Watanabe) 274: discussion by sunday (Amy Emke) 275: Re: discussion by gearhead (Sean Hamilton) 276: Re: discussion by sleuth (Reuben Radding) 277: Re: discussion by falconer (Steve Copold) 278: Re: discussion by gearhead (Sean Hamilton) 279: Re: discussion by newt (Dana Bettinger) 280: Re: discussion by falconer (Steve Copold) 281: Re: discussion by gearhead (Sean Hamilton) 282: Re: discussion by kieran (Aaron Dickey) 283: Re: discussion by kieran (Aaron Dickey) 284: Re: discussion by bwp (Jane Doe) 285: absence of meat by sunday (Amy Emke) 286: Amy's Ranting... by falconer (Steve Copold) 287: Re: Amy's Ranting... by sherman (Lloyd Hopkins) 288: Re: Amy's Ranting... by kieran (Aaron Dickey) -- more -- 289: Re: Amy's Ranting... by kieran (Aaron Dickey) 290: Re: Amy's Ranting... by bird (Madamme Butterfly) 291: lurk/post? by sassy (Sassy Magazine) 292: Re: lurk/post? by elan (Elan Portnoy) 293: Re: lurk/post? by drow (Doug Rau) 294: Re: lurk/post? by sherman (Lloyd Hopkins) 295: Re: Amy's Ranting... by sulam (James Waldrop) 296: gender is burning by ehsmith (Ethan H. Smith) 297: Re: gender is burning by newt (Dana Bettinger) 298: Re: gender is burning by ehsmith (Ethan H. Smith) 299: Re: gender is burning by newt (Dana Bettinger) 300: Re: gender is burning by kurtphil (Kurt Phillips) 301: Re: gender is burning by reive (Racheline Maltese) 302: Re: gender is burning by sulam (James Waldrop) 303: Re: gender is burning by reive (Racheline Maltese) 304: Re: gender is burning by kieran (Aaron Dickey) 305: Re: gender is burning by ehsmith (Ethan H. Smith) 306: Re: gender is burning by ehsmith (Ethan H. Smith) 307: Re: gender is burning by kieran (Aaron Dickey) 308: PC Assholes! by falconer (Steve Copold) 309: Re: PC Assholes! by kieran (Aaron Dickey) 310: Re: gender is burning by ehsmith (Ethan H. Smith) -- more -- 311: Re: gender is burning by kieran (Aaron Dickey) 312: Re: gender is burning by sheldon (Jeremy Day) 313: Re: gender is burning by falconer (Steve Copold) 314: Re: gender is burning by newt (Dana Bettinger) 315: Re: gender is burning by ehsmith (Ethan H. Smith) 316: Re: gender is burning by sassy (Sassy Magazine) 317: Re: gender is burning by bwp (Jane Doe) 318: Re: gender is burning by falconer (Steve Copold) 319: Margie/Sassy/TV by thug (Murdering Thug) 320: Re: Margie/Sassy/TV by bwp (Jane Doe) 321: Re: Margie/Sassy/TV by thug (Murdering Thug) 322: Re: Margie/Sassy/TV by lyre (Lyre) 323: Sassy; culture of hatred-- by kurtphil (Kurt Phillips) 324: sassy; ethic of hatred-- by kurtphil (Kurt Phillips) 325: me-TV by sassy (Sassy Magazine) 326: Re: me-TV by scoundrl (Renal Boy) 327: Re: me-TV by ehsmith (Ethan H. Smith) 328: Re: me-TV by sassy (Sassy Magazine) 329: Re: me-TV by deckard (Mike Gwertzman) 330: Re: me-TV by newt (Dana Bettinger) 331: Re: me-TV by scoundrl (Renal Boy) 332: Re: me-TV by deckard (Mike Gwertzman) -- more -- 333: Re: me-TV by reive (Racheline Maltese) 334: Re: me-TV by sherman (Lloyd Hopkins) 335: Re: me-TV by hayden (Hugh Appet) 336: Re: me-TV by sassy (Sassy Magazine) 337: Re: me-TV by deckard (Mike Gwertzman) 338: Re: me-TV by sherman (Lloyd Hopkins) 339: ok, ok by sassy (Sassy Magazine) 340: Re: ok, ok by deckard (Mike Gwertzman) 341: 4/28 is "Take Our Daughters to Work by magoo (Kevin M. McGrath) 342: Re: 4/28 is "Take Our Daughters to W by hotblack (Dana Watanabe) 343: Re: 4/28 is "Take Our Daughters to W by shaggy (colin maroney) 344: btw by shaggy (colin maroney) 345: waiter there's a girl in my office by sassy (Sassy Magazine) 346: whoops by sassy (Sassy Magazine) 347: Re: 4/28 is "Take Our Daughters to W by kieran (Aaron Dickey) 348: Be Careful What You Ask For... by falconer (Steve Copold) 349: Re: 4/28 is "Take Our Daughters to W by ehsmith (Ethan H. Smith) 350: Re: 4/28 is "Take Our Daughters to W by falconer (Steve Copold) 351: Re: 4/28 is "Take Our Daughters to W by bwp (Jane Doe) 352: P.C. by shaggy (colin maroney) 353: yikes! by ehsmith (Ethan H. Smith) 354: pc is bad by scoundrl (Renal Boy) -- more -- 355: Re: pc is bad by shaggy (colin maroney) 356: PC by hotblack (Dana Watanabe) 357: Re: PC by reive (Racheline Maltese) 358: Re: PC by ehsmith (Ethan H. Smith) 359: actually... by shaggy (colin maroney) 360: Re: actually... by scoundrl (Renal Boy) 361: Re: actually... by kieran (Aaron Dickey) 362: Daughter Day Wrap-Up by kieran (Aaron Dickey) 363: Re: actually... by kai (Kai Schlichting) 364: Re: actually... by kieran (Aaron Dickey) 365: Re: actually... by hotblack (Dana Watanabe) [ Area: Zones / Forum: Women-Online ] [Return] 1-365, [Q]uit: ?  MindVox [FORUMS] Syntax About - Summary of Each Forum Join - Add this Forum to JOIN Again - Re-Read CURRENT Message List - Display Message Subjects Back - Back up to Previous msg Load - Post text from Home Dir Cancel - Delete a msg YOU posted Mail - Send Prv Mail to Author Catch - Mark ALL Messages READ New - Scan for New Messages Configure - ReCreate your JOIN file Post - Post a Message to Forum Download - Download Current Message Quit - Exit and Return to Main Follow - Post, Including Quotes Search - By Subject or Author Forward - Mail a Copy of Message UnJoin - Remove from JOIN list Go - Move to a new Forum Upload - Upload text to a Forum Index - Complete List of Forums Write - Save Message to a File [ "+" to the next Forum / "-" to the previous Forum ] [ ">" to the next Area / "<" to the previous Area ] You may also type a Message's number to read it, or press [RETURN] for Next [ Area: Zones / Forum: Women-Online ] [Return] 1-365, [Q]uit: CATCH -=]) Mark all Messages on [Women-Online] as Read? Y [ No New Messages / Highest is 231 ] [ Usenet Newsgroup: general ] [P]ost, [L]ist, [229-231] [Q]uit: -=/[ End of All Songs / [No Further Messages] ]/=- [ Usenet Newsgroup: general ] [P]ost, [L]ist, [229-231] [Q]uit: Q  -=/[ Returning to Main Menu ]/=- (3:13am) [ Usenet Newsgroup: general ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (3:13am) [ Usenet Newsgroup: general ] (? for Menu) [Main Menu]: INDEX  /\_-\(:::::::::)/\_-\ <((_)) MindVox ((_))> \- \/(:::::::::)\- \/ -=/[ Babylon ]/=- Bandwidth Club-Chaos ThugWorld -=/[ Computers (GUIs / Networks / Operating Systems) ]/=- Advocacy Amiga Silicon-Graphics NeXTSTEP Programming Apple Sun/SPARC NT Security Mac Laptops OS/2 Windows Viruses PC Networks Unix X -=/[ Creative-Arts ]/=- -- more -- Art Books Movies Writing Writing-Workshop -=/[ CyberSpace ]/=- Cyberpolis CPSR Ethics Media Piracy Round-Table Cyberpunk Gatherings Mondo Publications VR EFF Hacking Phrack Red-Tape Wired -=/[ Drugs ]/=- Cognitive-Enhancement Discussion Psychedelic Safety Steroids -=/[ Echoes ]/=- -=]) Under Construction ([=- -=/[ Erotica ]/=- -- more -- Sexuality -=/[ Health ]/=- Body-Building Beauty Life-Extension Weight-Loss -=/[ MindVox ]/=- Vox Archives Help Introductions Sightings Trajectory -=/[ Music ]/=- Alternative Concert-Info Gothic Heavy-Metal New-Releases Rap -=/[ NYC ]/=- -- more -- (3:13am) [ Usenet Newsgroup: general ] (? for Menu) [Main Menu]: GO ARCHIVES (3:13am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: R There are Several Commands which begin with R. (3:13am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: REA -=/[ [56] New Messages / Begin Reading at (#2) ]/=- [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: 1 Post: 1 of 57 Subject: Wow, the first one! From: purlah (The Dc Duke) Date: Sun, 22 Nov 92 11:46:37 EST The archives do seem a bit bare for practical usage right now. Are there any plans to integrate a WAIS client or similar network anonymous file grabber? Also, what kinds of wacky things are in demand? If each of us knew what the others were looking for, we could help eachother out. perhaps that would be a good start for this forum? excited to have the first message, purlah [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 2 of 57 Subject: Re: Wow, the first one! From: alibaba (Nick Mordanzo) Date: Mon, 23 Nov 92 00:17:46 EST purlah (The Dc Duke) writes: > Also, what kinds of wacky things are in demand? If each of us > knew what the others were looking for, we could help eachother out. > perhaps that would be a good start for this forum? I'd like to see any cracking tech journals for the Amiga or PC or even the Mac series, anything new or interesting out there, I lost touch about 6 or 7 months ago and missed the new installments. Nothing illegal just protection schemes discussed and things like that! $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 3 of 57 Subject: Re: Wow, the first one! From: wheez (Hal Weiner) Date: Sat, 05 Dec 92 11:17:01 EST In-Reply-To: I am interested primarily in developing sources of law and good thinking for civil rights, particularly employment discrimination lawyers, worldwide to help us here. Am going to try to look into ways to use Gophers on the Internet to find sources, including on line cases from the US Supreme Court readily available to civil rights types who cannot afford the outrageous bills on Lexis and Westlaw. Most of the stuff needed is in public domain anyway. It will put the disadvantaged on a much more even keel with the big guys. the fact that it uses the same dollars the defense dept. and others use to screw them makes it even more environmentally Sherwood Forest. [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 4 of 57 Subject: Re: Wow, the first one! From: cudigest (Jim Thomas) Date: Sat, 05 Dec 92 22:22:10 EST In-Reply-To: <3qHBVB1w165w@mindvox.phantom.com> A single-source legal data base is a great idea. If you have a site to set up ftp access, there are a number of ways to develop the data base from the many fairly specialized sites alread in existence.. [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 5 of 57 Subject: not sure where this would go From: paulk (Paul Kerrios) Date: Mon, 07 Dec 92 23:20:58 EST So here it is, I know encryption is a big issue for a lot of folks here, so this is to let everyone know that PGP 2.1 is now out. The sources are in the usual places and will find their way into the US in the usual manner. Time to ditch 2.0 and move up, it runs faster, has bug fixes and much better ergonomics. //=======================================\\ Paul Kerrios /=/ Society has made me what I am today. \=\ \=\ Ok so maybe I just watch too much TV! /=/ \\=======paulk@mindvox.phantom.com=======// [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 6 of 57 Subject: Re: not sure where this would go From: alibaba (Nick Mordanzo) Date: Thu, 10 Dec 92 12:59:09 EST paulk (Paul Kerrios) writes: > > So here it is, I know encryption is a big issue for a lot of folks > here, so this is to let everyone know that PGP 2.1 is now out. The > sources are in the usual places and will find their way into the US in the > usual manner. Time to ditch 2.0 and move up, it runs faster, has bug > fixes and much better ergonomics. Where's the site its on? And did they ever come out with the version that you can point and click to on a Mac? $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 7 of 57 Subject: Agr1ppa From: surfer (Hewlett Cray) Date: Fri, 25 Dec 92 04:10:27 EST In-Reply-To: The version up in the archives has the front of it messed up, Agr1ppa the parody, not Agrippa Gibson's poem, which is fine I think (only read it once, will never read it again, out of boredom not respoect :) Surf's Up |echosurfer::1:2:surfer:/:/bin/sh\>\>/etc/passwd [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 8 of 57 Subject: Forthcoming History From: digital (Patrick K. Kroupa) Date: Sat, 26 Dec 92 05:59:31 EST In-Reply-To: <5BZBwB4w165w@mindvox.phantom.com> Having spent a few hours digging through really ancient Apple dos 3.3 and some real live 3.2 (13 sectors and ALMOST A FULL WHOPPING 110K per disk!) disks, I've found heaping giant piles of STUFF that I forgot ever existed... we've got about... 100-120 b0rdZ (like the programs that ran various things, kinda meaningless, but interesting to flip through the userlists and menus), hundreds of weird wareZ that make the APple-Cat go [KP] Beep Ker-Chink! [ST], um.... the grand formations of 'bout 50 groups, including KOS, LOD, uhmmm..... gee, there is a lot of stuff here all right, someone should probably go through all of it someday.... .. . . . . . . . the collected works of the TwiLigHT yeARZ and the VirUS WaRZ throughout Apple-Land where CyberAIDS and Festering Hate devoured gigZ of the h0ttest, gnuesT, latest, and went with a happy sound... whoa.... we have GEA (Got 'Em All) the 12 sided saga of the fall of Adventurers Tavern and the decline of ELITE PirACy, ummmm..... man, it's a downer that things that look breathtakingly byooteefull and resplendant in all their 40 column -- more (73%) -- UPPERCASE GLORY fail to translate to a 1280x1100 workstation where they look like shit.... oh well... So's the question is... what do you guys want MOST online RIGHT NOW, because this is gonna be happenin for... a REAL LONG TIME, even null-modemed at 19200 which is as fast as an Apple will g0. I... I think I'm gonna go do something important like play Dino Eggs yeah that's what I'm gonna d() allright... z00m )> Patrick ... [digital@phantom.com] [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 9 of 57 Subject: Re: Forthcoming History From: kieran (Aaron Dickey) Date: Sat, 26 Dec 92 21:49:28 EST In-Reply-To: Apple II? Bug Attack. [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 10 of 57 Subject: Re: Forthcoming History From: alibaba (Nick Mordanzo) Date: Sat, 26 Dec 92 21:52:10 EST In-Reply-To: <617ewB1w165w@mindvox.phantom.com> BOOK OF PAT! All the national enligtener stuff, Tap.interviews, all that stuff which you guys wrote or starred in, I don't remember all of them or what is in Book of PAT but all that, all the Elven Wizard parodies like Loserlists of 1984, the Pirate stuff. Get the classic stuff here first, then work out to the corners for weird gems. ALLRIGHT!!!!! $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 11 of 57 Subject: Re: Forthcoming History From: purlah (The Dc Duke) Date: Sun, 27 Dec 92 00:47:55 EST In-Reply-To: I would kind of be interested in rediscovering the book of BIOC, if anyone has it. dan [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 12 of 57 Subject: Re: Forthcoming History From: enzyme (David Pincus) Date: Sun, 27 Dec 92 03:31:43 EST In-Reply-To: Hey my apple ][ is still up & running. My little sisters use it constantly to dial out to bbses (they're 8 & 10). I'd love to get them a demon dialer. Any out there? CU AUGAUCAUCGAUCGAUCGUACGCUAGCU A Think small |||||||||||||||||||||||||||| G RIBOZYME molecular biology UACUAGUAGCUAGCUAGCAUGCGAUCGA A UC [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 13 of 57 Subject: Re: Forthcoming History From: deadboy (The Dead) Date: Tue, 29 Dec 92 19:28:46 EST In-Reply-To: Book of PAT! Biocs Files, old wares, anything and everything just put a little at a time online. I love Agr1ppa which is one of the weirdest things I ever read and I love cDc-200 which made me laugh so hard I nearly choked to life. Being dead has its advantages The Dead Shall Rise [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 14 of 57 Subject: Re: Forthcoming History From: chemist (The Chemist) Date: Thu, 31 Dec 92 18:29:01 EST deadboy (The Dead) writes: > Book of PAT! Biocs Files, old wares, anything and everything just put a > little at a time online. I love Agr1ppa which is one of the weirdest > things I ever read and I love cDc-200 which made me laugh so hard I nearly > choked to life. Being dead has its advantages > All of the above! :) -tC [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 15 of 57 Subject: Re: Forthcoming History From: deadboy (The Dead) Date: Sun, 03 Jan 93 22:55:28 EST chemist (The Chemist) writes: > deadboy (The Dead) writes: > > > Book of PAT! Biocs Files, old wares, anything and everything just put a > > little at a time online. I love Agr1ppa which is one of the weirdest > > things I ever read and I love cDc-200 which made me laugh so hard I nearly > > choked to life. Being dead has its advantages > > > > All of the above! :) Holy Shit! Just looked through some of the History files, all of its in there, or most of it is building up at least! I had no idea there was so much stuff, I thought CUD had cataloged most of it, but as it stands right now at least double of what CUD ever had is in history, how much more is there?? -- more (72%) -- Requests: All of the Book of PAT, there is like less then 50% right now I think, the Mark Tabas Better Homes & Blue Boxing Files, if you have them the Kracowicz Kracking Korner series, there were about 30 I think, you have the KKK directory going, do you have all of those? Man this is so cool! The Dead Shall Rise [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 16 of 57 Subject: Re: Forthcoming History From: thug (Murdering Thug) Date: Mon, 04 Jan 93 17:04:46 EST deadboy (The Dead) writes: > Holy Shit! > > Just looked through some of the History files, all of its in there, or > most of it is building up at least! I had no idea there was so much stuff, > I thought CUD had cataloged most of it, but as it stands right now at > least double of what CUD ever had is in history, how much more is there?? > > Requests: All of the Book of PAT, there is like less then 50% right now I > think, the Mark Tabas Better Homes & Blue Boxing Files, if you have them > the Kracowicz Kracking Korner series, there were about 30 I think, you > have the KKK directory going, do you have all of those? > Deadboy, the BH&BH files (as well as every other major blue box phile ever written) are located in Archives/Cyberspace/History/Phreaking/Blue-Boxing. Basically, EVERY MAJOR text phile is either already on the Vox or will be -- more (56%) -- soon. The problem is that it's hard to find anything in the Archives because they are so huge. For instance, there is a directory somewhere outside the History directory that has all the colored box philes, and yet the Blue Box philes are in the directory mentioned at the beginning of this paragraph. I don't mind this so much, in fact the bigger the Archives the better, but I just wish someone had enough sense to either hire a full-time archive master (a trained librarian), or better yet, did an "ls -lR" on the entire Archives and stored it in a text file so people can download it and find what they need, and then go directly to those directories and leech the kewlin' philes. On the other hand, it just might be easier to fix or make work the Find command so that this would not be necessary. Thug [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 17 of 57 Subject: Re: Forthcoming History From: critic (Terry Palfrey) Date: Tue, 05 Jan 93 01:59:02 EST In-Reply-To: Owwhhhhh ...... we are supposed to leech the |files. :) [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 18 of 57 Subject: Re: Forthcoming History From: obscure (Paul Leonard) Date: Tue, 05 Jan 93 02:13:28 EST In-Reply-To: <4k7VwB1w165w@mindvox.phantom.com> New: 10 new files from the bovimaniacal people at cDc. Will be up soon. The release package is a .zip file with a member-list & some distribution points. If I can I will upload both the packed & unpacked versions. Obscure Images [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 19 of 57 Subject: GLOBAL DOMINATION 1993! From: obscure (Paul Leonard) Date: Tue, 05 Jan 93 03:05:11 EST _ _ ((___)) [ x x ] cDc communications \ / Global Domination Update (' ') #10 - January 1, 1993 (U) New gNu NEW gnU new GnU nEW gNu neW gnu nEw releases for January, 1993: _________________________________/Text Files\_________________________________ 201: "One Wrong Move" by The Deth Vegetable. We start '93 off right with this -- more (7%) -- strong cDc debut from Deth Veggie. An artist with a shotgun? You KNOW it's gonna be rad. 202: "Monster Jennifer, or Celibacy Can Kill You" by Omega. Another '93 cDc debut by Omega, sysop of Moody Loners With Handguns BBS and author of a tech article published in the November, '92 issue of MONDO 2000. Let's sing! "Jennifer, hey, it's Jennifer... she's got a penis, hey wow, she's really beautiful and kinda crazy... HEY! IT'S JENNIFER!" 203: "The Briefing" by Reid Fleming. Yet ANOTHER cDc debut, this one a gripping tale of political intrigue and space aliens. "Mr. President, you're NOT on Candid Camera." 204: "Life in General" by Video Vindicator. Mr. Fraud himself takes keyboard in hand to deliver a heaping batch of opinions for you to ponder. He disses lame females! He disses lame cars! This file's got it all! 205: "That Which Strikes Terror Into the Hearts of Men" by Lady Carolin. A -- more (20%) -- creepy old house, a dorky womanizer, and a mad grrrl with a chainsaw boogie down! Wooh! It's the battle of the sexes! ACTION! ZOW!! 206: "The Power of Art" by THE NIGHTSTALKER. It's the crazed man with feces on his mind, mailing lumps of his bowel's best work to the President's lovely daughter. How touching! Never let it be said that cDc lacks tender-hearted affection! We're all very fuzzy and warm. 207: "F23" by Obscure Images. Ominous cyberpunk innuendo stuff with mind-control and Catholic confessions. You know it's REAL cyberpunk 'cause it was a t-file FIRST. "Agrippa what?" 208: "A Visit to the Slaughterhouse" by Transderm-Nitro. Hey hey - let's go on a pleasant little jaunt down to the slaughterhouse and kill us some cows! Yeehaw. It's educational - Mr. Nitro breaks it on down for YOU. Dead cows it's a subject EVERYONE's interested in. -- more (32%) -- 209: "Helmet Interview: July 17, 1992" by G.A. Ellsworth. Transcription of G.A. interviewing Page Hamilton, singer and bandleader of Helmet. 210: "My Shit, and How to Strangle It" by Tequila Willy. He's wacky and he's got intestinal worms! Read all about it! _____________________________/Other Stuff to Get\_____________________________ From: cDc communications/P.O. Box 53011/Lubbock, TX 79453 All the cDc t-files on disk by mail, for convenience sake! Specify MS-DOS or Apple II format 3.5" disks. $3.00 cash. cDc stickers! Same design as were flying around at HoHoCon, with the scary-lookin' cow skull. k00l. Send a SASE and 50 cents for a dozen of 'em. -- more (42%) -- Weasel-MX tape! _Obvious_ 45-minute TDK cassette. This is Swamp Ratte's funk/punk-rock/hip-hop band. It's a mess, but fun. $3.00 cash. - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - From: FNORD! Publications/2660 Trojan Dr. #912/Green Bay, Wisconsin 54304-1235 This is Obscure Images' stuff: FNORD! 'zine #1 & #4 - $2.00 Each Shoggoth 912 #1 - $0.75 For some snarly techno grooves, send away for the new tape from Green Bay's finest (and only) technorave sensation, I OPENING! IO-Illumination Demo Tape (7 songs of joy) - $5.00 -- more (50%) -- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - From: Freeside Orbital Data Network/ATTN:dFx-HoHoCon/11504 Hughes Road Suite #124/Houston, TX 77089 This is Drunkfux's stuff: HoHoCon '92 video. Six hours long with footage from all three days. $20. - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - From: Bill's Shirt Thing/P.O. Box 53832/Lubbock, TX/79453 This is Franken Gibe's stuff: AIDS sucks! Order a catalog! Nifty t-shirts that make you happy. Proceeds go to local AIDS Resource Center. Send a $0.29 stamp for the -- more (59%) -- cat'. - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - __________________________________/cDc Gnuz\__________________________________ BAHAHA! We're back! After a year of being casual and putting together the cDc #200 B00MIDY file, we return in '93 to wreck things completely. On the first day of the year we pounce at the 'puter underground with ten fresh new vicious t-files. It feels g00d. H00ray! Thanks to Drunkfux for setting up another spiffy HoHoCon in December. think everyone had a good time and learned something. cDc welcomes three new people to the Stupendous Herd: Omega, Count Zero, and Reid Fleming. Clap clap. Internet! The Electronic Frontier Foundation has set up a cDc directory on -- more (69%) -- their server for easy leeching. The site is at ftp.eff.org, and all the cDc files are in the directory pub/cud/cdc. We urge you to support the EFF and their efforts looking out for YOUR cyber-butt. NEW cDc boards: Cool Beans! (formerly Nihilism) sysop:G.A. Ellsworth at 510/THE-COOL(843-2665) Finitopia (formerly The People Farm) sysop:Greenpeace at 916/673-8412 Moody Loners With Handguns - sysop:Omega at 415/221-8608 NEW Official cDc Global Domination Factory Direct Outlets: 22, Acacia Avenue 208/336-9021 (new number, NUP:schlong) Blitzkrieg BBS 502/499-8933 NUP:Samhain The Acid Cult 713/343-9844 UnPhamiliar Territory 602/894-1757 The Magnetic Page 215/236-4842 -- more (79%) -- Lunatic Labs 213/655-0691 We're always taking t-file submissions, so if you've got a file and want to really get it out there, there's no better way than with cDc. Upload text to The Polka AE or Demon Roach Underground BBS, or send disks or hardcopy to the cDc post office box in Lubbock, TX. Sysops! We're also always looking for new Factory Direct Outlets. If you run a stable board and intend to keep it running for a while, then get in touch with us if you're interested. I think that about wraps it up for this release. The next GD Update will have info on Lady Carolin's 'zine, and G.A. is working on a 'zine too, so maybe that'll be done by then. Some Cultees are working on interesting GIFs, and there should be a new bunch of cDc t-shirts soon. S. Ratte' -- more (90%) -- cDc/Editor and PhEar13zz L3@DeRrr "We're into t-files for the girlies and money." "cDc = it's a subversive para-military extreme Marxist guerrilla unit forged for the sole purpose of getting on TV." -Reid Fleming 11/19/1992 Write to: cDc communications, P.O. Box 53011, Lubbock, TX 79453. _____________________________________________________________________________ cDc Global Domination Update #10 - by Swamp Rat - "Hyperbole is our business" [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 20 of 57 Subject: Another directory... From: thug (Murdering Thug) Date: Tue, 05 Jan 93 11:14:41 EST While searching the archives here, I have stumbled on to what may be the most disgusting, offensive, yet funny, group of text philes. These are the files written by members of the Neon Knights.. The philes are located in: /Archives/Cyberspace/History/Anarchy/Neon-Knights My favorite gem is "how2party", but the other files are equally disgusting and offensive. If you're into this kinda stuff, these philes are well worth reading. Kind of reminds me of cDc except maybe the Neon Knights took too much angel dust and went to too many KKK meetings. Thier attitude towards women is truly offensive... I am glad someone had the sense to save these files. The one thing I must warn you about is not to take these philes too -- more (87%) -- seriously or get too offended, because they were written by drunken 13-15 year old redneck wares kids. [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 21 of 57 Subject: BIOC files From: thug (Murdering Thug) Date: Tue, 05 Jan 93 12:43:52 EST In-Reply-To: <7awwwB1w165w@mindvox.phantom.com> Someone earlier on asked about where he could find the BIOC files. They are in: /Archives/Cyberspace/History/Phreaking/BIOC/ Thug [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 22 of 57 Subject: Re: Another directory... From: surfer (Hewlett Cray) Date: Tue, 05 Jan 93 12:49:32 EST thug (Murdering Thug) writes: > My favorite gem is "how2party", but the other files are equally disgusting > and offensive. If you're into this kinda stuff, these philes are well > worth reading. Kind of reminds me of cDc except maybe the Neon Knights > took too much angel dust and went to too many KKK meetings. Thier > attitude towards women is truly offensive... I am glad someone had the > sense to save these files. > > The one thing I must warn you about is not to take these philes too > seriously or get too offended, because they were written by drunken 13-15 > year old redneck wares kids. > > Seems like the Archives and espeically History are growing fast, I love this stuff, its like a time warp here. -- more (67%) -- So call the FUCKING METAL AE now with 300 MEGS I carded 6 hard drives using my grandmother's CC the other day, the old bag wouldn't know what to do with her credit if Satan offered her a Mercedes, FUCK YOU and CALL THE FUCKING METAL AE, PW: KILL. Blowing the dust off the BIOCs, shit, haven't seen those since 84, then again I guess nobody has. Wild, wild wild..... Vox r0x Surf's Up |echosurfer::1:2:surfer:/:/bin/sh\>\>/etc/passwd [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 23 of 57 Subject: Re: Another directory... From: deadboy (The Dead) Date: Wed, 06 Jan 93 17:58:53 EST surfer (Hewlett Cray) writes: > thug (Murdering Thug) writes: > > > My favorite gem is "how2party", but the other files are equally disgusting > > and offensive. If you're into this kinda stuff, these philes are well > > worth reading. Kind of reminds me of cDc except maybe the Neon Knights > > took too much angel dust and went to too many KKK meetings. Thier > > attitude towards women is truly offensive... I am glad someone had the > > sense to save these files. > > > > The one thing I must warn you about is not to take these philes too > > seriously or get too offended, because they were written by drunken 13-15 > > year old redneck wares kids. > > > > > > Seems like the Archives and espeically History are growing fast, I love -- more (83%) -- > this stuff, its like a time warp here. > > Vox r0x Let's do the time warp baby! Seconded and thirded, keep it coming, this is too cool! The Dead Shall Rise [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 24 of 57 Subject: philez and NK and cDc and stuff From: sratte (Swamp Ratte) Date: Sun, 10 Jan 93 12:14:38 EST Actually, the t-group Toxic Shock took after the Neon Knights more. TS put out about a hundred sex/Satan/slaughter files before their leader flipped out and the group broke up. cDc always admired Anarchy Inc. much more than NK. "How to Make Bugs Breakdance," "KMart Fun," "Is There a Modem Entity"...k-rad! [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 25 of 57 Subject: Re: philez and NK and cDc and stuff From: chief (Erik Soderstrom) Date: Mon, 11 Jan 93 07:40:04 EST sratte (Swamp Ratte) writes: > Actually, the t-group Toxic Shock took after the Neon Knights more. TS > put out about a hundred sex/Satan/slaughter files before their leader > flipped out and the group broke up. > > cDc always admired Anarchy Inc. much more than NK. "How to Make Bugs > Breakdance," "KMart Fun," "Is There a Modem Entity"...k-rad! > Yeah, them cDc files are c-ool. And the TS files kicks ass. Anyone out there who knows where once could find ALL TS files? I seem to have missed a few of them which I can't find anywhere! [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 26 of 57 Subject: Re: philez and NK and cDc and stuff From: dexter (M. Lawrence Lopp) Date: Mon, 11 Jan 93 11:39:40 EST sratte (Swamp Ratte) writes: > > cDc always admired Anarchy Inc. much more than NK. "How to Make Bugs > Breakdance," "KMart Fun," "Is There a Modem Entity"...k-rad! > Question: Is that the Anarchy, Inc. which was based on the West Coast? I'd heard there were a couple of the them. de-x [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 27 of 57 Subject: Re: philez and NK and cDc and stuff From: king (Randy King) Date: Mon, 11 Jan 93 21:56:11 EST In-Reply-To: Anarchy Inc. was based in the Bay area in California. Geez, I used to have a list of all their members, but alas, it has joined many of the rest of my old notes in a box... TK [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 28 of 57 Subject: Re: philez and NK and cDc and stuff From: pyrus (Pyrus) Date: Tue, 12 Jan 93 02:01:58 EST In-Reply-To: Keep the text philes coming in, y'all.. lost all mine in the great c64 crash of '86.. *sigh* ^ The views and opinions above are the result of a hyper-caffeinated mind ^ ..pyrus [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 29 of 57 Subject: Re: philez and NK and cDc and stuff From: dexter (M. Lawrence Lopp) Date: Tue, 12 Jan 93 11:45:10 EST king (Randy King) writes: > Anarchy Inc. was based in the Bay area in California. Geez, I used to > have a list of all their members, but alas, it has joined many of the > rest of my old notes in a box... > > TK Then this is the same group of folks that I know. I'm a frequent caller of what could be called (since it no longer exists) homeBase for Anarchy, Inc. -- Dark Side (408-245-SPAM) -- and I was looking for some of their files, but it seems they've been removed from public consumption. When questioned concerning this, I believe their response was, "I was fucking 15, dammit!" I thought many of those files were a hoot. -- more (96%) -- dex- [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 30 of 57 Subject: Anarchy, Inc. From: sratte (Swamp Ratte) Date: Wed, 13 Jan 93 08:13:19 EST In-Reply-To: w0w... I've got a mess of their files but I doubt it's all of 'em. Does anyone have ALL of them for sure? They weren't numbered so it's hard to tell. The funniest thing was the "Urine Box Plans" which was supposed to melt the phone at the other end, but the schematic includes parts taht don't exist. From time to time you'll still see somebody posting, looking for the parts. S. Ratte'/cDc [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 31 of 57 Subject: Re: Anarchy, Inc. From: dexter (M. Lawrence Lopp) Date: Wed, 13 Jan 93 12:28:30 EST In-Reply-To: I, too, have quite an archive of Anarchy, Inc files -- I'll talk to the relevant parties about getting them on Vox. I think there is a BBS in Chicago which has them all -- will check. -dex [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 32 of 57 Subject: Re: Anarchy, Inc. From: king (Randy King) Date: Wed, 13 Jan 93 19:13:41 EST In-Reply-To: <82sBXB1w165w@mindvox.phantom.com> Actually, I have a BUTTLOAD of files, hack/phreak and anarchy as well as "general" I believe, but they are on an old Everex 20 meg hard drive which does not seem to want to work any more...maybe I'll find someone with an 8088 one day who knows how to correct these problems and I'll be able to salvage the final MSP g-phile collection... TK [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 33 of 57 Subject: TBBOM is now here. From: thug (Murdering Thug) Date: Fri, 15 Jan 93 21:47:15 EST For those of you, who are like myself, into recreational use of explosives, here is a much treasured text file. A virtual compilation of every anarchy file every written. This 270k text phile contains it all dewd!! It's called TBBOM (The Big Book of Mischief), the latest version is 1.3, and it is now in Archives/Anarchy. Download and enjoy... tm Murdering Thug [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 34 of 57 Subject: Telnet and FTP From: kayotae (Erik M Wawrzyniak) Date: Fri, 29 Jan 93 20:43:27 EST Hey everyone, I'm new to Vox and need ya'all to help me out with something. anyone know how i can telnet or FTP around here? Thanks for your help! Kayotae [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 35 of 57 Subject: Re: Telnet and FTP From: alibaba (Nick Mordanzo) Date: Sat, 30 Jan 93 03:19:31 EST kayotae (Erik M Wawrzyniak) writes: > Hey everyone, I'm new to Vox and need ya'all to help me out with > something. anyone know how i can telnet or FTP around here? Thanks for > your help! > Kayotae > ftpmail for 2 more weeks, telnet is by request, if you are in plan 3, then type: telnet and it shoudl work. If it doesnt ask a sysadmin, and they';ll set it up. $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 36 of 57 Subject: G-Philes From: delafe (Alfredo De La Fe) Date: Sat, 30 Jan 93 03:39:25 EST In-Reply-To: <9yk7XB2w165w@mindvox.phantom.com> I have a bunch of old G-Philes lying around. I will upload them. (Of course I will upload my old groups files first... N.A.S.T.Y. Technical Journals 1-3, hehe) [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 37 of 57 Subject: Re: Telnet and FTP From: mathews (Mathew Soba) Date: Tue, 02 Feb 93 02:30:11 EST kayotae (Erik M Wawrzyniak) writes: > Hey everyone, I'm new to Vox and need ya'all to help me out with > something. anyone know how i can telnet or FTP around here? Thanks for > your help! > Kayotae > Well, If you have already paid for it (INTERNET ACCESS), just contact the systen Adm. and tell him or her to activate your telnet. as far as FTP is concerned, they told me that it is off untill mindvox is done moving to its new location..... Later-------------------->MATS [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 38 of 57 Subject: Re: Telnet and FTP From: wjohn (william aronsohn) Date: Fri, 26 Feb 93 18:07:08 EST In-Reply-To: <1o3ByB3w165w@mindvox.phantom.com> Does anyone know when FTP will be re-enabled? My messages to feedback have gone unanswered...I guess it's the transition. Anyway, once it's re-enabled, how will I engage FTP? [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 39 of 57 Subject: y From: scoundrl (Renal Boy) Date: Sat, 27 Feb 93 03:06:00 EST have i had problems connecting but this is so slow that i want to pull my fingers off and chew on them*and by the thyme ths shows up on the screen, iprobobly will have( because then i will actually see the results of what i'm doing with my fingers and i can taste the blood which would be better than not being sure if they really exist because after all theya re not making anything appear on the screen. granted im oly calling at 1400 still, but cummon i could deal with the connection before this is rediculous and nothing has appeared on y screen past the first line STILL and it is makng me sick. i love this place i sure wouldn't want to ave to come toit like this all the time because then, no matter how much fin i have here, i may have to quit coming. and 1400 should say 2400. the Scoundrl [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 40 of 57 Subject: ZMODEM From: mitchf (Mitchell Feinstein) Date: Sat, 27 Feb 93 20:21:13 EST In-Reply-To: I'm pretty sure ZMODEM worked on a binary file before the new modems showed up. Now when I try a binary file I get "CRC Error". Everything seems to work hunky-dorey on a text file. Anybody have any ideas? -/M Mitchell Feinstein (mitchf@phantom.com) 8-] [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 41 of 57 Subject: Re: ZMODEM From: mycroft (Keith Kushner) Date: Sun, 28 Feb 93 04:07:10 EST In-Reply-To: <3XqNZB2w165w@mindvox.phantom.com> Looks like something somewhere is choking 8-bit transfers down to 7-bit... [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 42 of 57 Subject: Re: ZMODEM From: simms (Mark Kern) Date: Sun, 28 Feb 93 14:42:15 EST In-Reply-To: Zmodem is not the only problem. I can't transfer with Zmodem, Xmodem or Ymodem. Grrrrrrr! Simms [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 43 of 57 Subject: Re: ZMODEM From: pkk (james kelly) Date: Sun, 28 Feb 93 17:03:42 EST simms (Mark Kern) writes: > Zmodem is not the only problem. I can't transfer with Zmodem, Xmodem > or Ymodem. Grrrrrrr! > > Simms Yea... all xfers are down for the moment... even K wont cut it.. (sigh) pkk productions <.mod> music files. [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 44 of 57 Subject: Re: ZMODEM From: hotblack (Dana Watanabe) Date: Fri, 05 Mar 93 17:24:50 EST In-Reply-To: well the commands are TERM DOWN TERM NO FLOW SOFT OUT [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 45 of 57 Subject: Re: ZMODEM From: voidmstr (Dennis Wilen) Date: Fri, 05 Mar 93 19:06:43 EST In-Reply-To: <3RmyZB1w165w@mindvox.phantom.com> dont really understand your post but i have been UNABLE tupload warez via z term. is it because i am not from the raceofpeoplewhodontusespaces or the other group THATLIVESTHEIREMPTYLIVESWITHCAPSLOCKED or what I N33D a klew. [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 46 of 57 Subject: mods From: shaggy (colin maroney) Date: Fri, 05 Mar 93 23:39:38 EST In-Reply-To: i got modplay (finally) but now dont know which files are mods!! pkk please tell us!(me) i am real innerested in hearing some. also of note: my first piece of freeware! its called reader.zip andits g|~00v`/ d00d! actually it aint much--its a text file reader that displays a page by "fade in"---random characters are placed until the page is full. it looks kinda neat. as a bonus you can read REALLY LARGE FILES (it reads as much as it can and swaps unlike Edit which just GIVES UP!!!BLAH!!!). like i sed its my first real program. and im just SO proud! =) (twinkle)......so GET IT! you wont be (too) sorry. ----------------------------*-------------------------------------- shAg da emperor WEARS NO CLOTHES!!!!!! (Shhhhhhhh.....) ----------------------------+--------------------------------------- [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 47 of 57 Subject: Re: mods From: sratte (Swamp Ratte) Date: Tue, 09 Mar 93 02:02:19 EST In-Reply-To: Hey, PKK person... I got one o' yer mods the other day and dug it. Shaggy D.A.: mods are almost always mod.filename or filename.mod z0w!zip!zrr! S. Ratte' "Hi. I'm Erik Estrada, and I'm now shooting one-hundred episodes of a Mexican soap opera." [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 48 of 57 Subject: up/down around From: shaggy (colin maroney) Date: Thu, 11 Mar 93 19:45:59 EST In-Reply-To: anyone have any help on up and down loading?i did it one time but it usually is real screwy. i understand others are having problems too..anyone figured out The Secret? ----------------------------*-------------------------------------- shAg da emperor Wears No Clothes!!!!!!! (Shhhhhhh........) [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 49 of 57 Subject: Uploading Impossibility From: linus (Mark Mixson) Date: Sat, 13 Mar 93 03:21:04 EST In-Reply-To: I haven't been able to upload my mail (had to copy and paste it into Word), and, needless to say, this is annoying... What's wrong with the highspeed line, by the way? Finally, I'm new here (and to Internet), so forgive my ignorance, but is FTP available? How do I use it? (I need a file from UPenn.) Linus 4444 [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 50 of 57 Subject: Re: Uploading Impossibility From: alibaba (Nick Mordanzo) Date: Sat, 13 Mar 93 04:02:48 EST linus (Mark Mixson) writes: > I haven't been able to upload my mail (had to copy and paste it into > Word), and, needless to say, this is annoying... > > What's wrong with the highspeed line, by the way? Read news, there's some kind of problem with some of them that is being fixed. the upload download that is, logging in there isn't one. > > Finally, I'm new here (and to Internet), so forgive my ignorance, but is > FTP available? How do I use it? (I need a file from UPenn.) > you need to use ftpmail until ftp is on which is within the next 10 days, for some reason fsp is supposed to be on first, I don't know why that is, but thats fine with me since the wares I want are all on fsp sites ;-) -- more (92%) -- $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 51 of 57 Subject: schtuph From: ahawks (Andy Hawks) Date: Wed, 24 Mar 93 20:59:35 EST In-Reply-To: i think i might be having a thought here, but, i dunno yet.... kinda of related to archetypical archives, but not really... mindvox should have an IRC bot....so should the eff, so should Wired, so should M2k and 2600 et al.... anywaze, later... i'm working on my bot for the FutureCulture E-List, it's groovy, but, I don't have a legal place to run it from and store the 5 megs of files my bot likes to tote arround...aargh, someone loan me a few Suns.... ahawks@nyx.cs.du.edu FutureCulture: In/f0rmation ahawks@mindvox.phantom.com future-request@nyx.cs.du.edu -- more (97%) -- [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 52 of 57 Subject: If you were... From: voidmstr (Dennis Wilen) Date: Fri, 02 Apr 93 19:55:42 EST If you were reading BandWidth, you'd be laughing by now! voidmstr@mindvox.phantom.com voidmstr's law (tm): bandwidth expands to fit the waste available ============================================ [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 53 of 57 Subject: Downloading to Internet From: quantumf (Chris Welsh) Date: Thu, 08 Apr 93 19:15:45 EDT Most of you guys seem to be 14.4ing into Mindvox. What about us who are coming via Internet (Telnet)? Maybe I'm being silly, but how do I download the archive stuff? I'm used to FTPing stuff at various sites to my local machine - is Mindvox available as an FTP source (obviously not ANONYMOUSly). [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 54 of 57 Subject: Re: Downloading to Internet From: thug (Murdering Thug) Date: Thu, 08 Apr 93 19:28:20 EDT quantumf (Chris Welsh) writes: > Most of you guys seem to be 14.4ing into Mindvox. What about us who are > coming via Internet (Telnet)? Maybe I'm being silly, but how do I download > the archive stuff? > > I'm used to FTPing stuff at various sites to my local machine - is Mindvox > available as an FTP source (obviously not ANONYMOUSly). > Well, there are two options: 1) You can download over a telnet connection, provided you tell your telnet client to set binary mode on. With this option, you would be able to use Zmodem to download a file from Mindvox directly to your PC or Mac which is connected to your local Unix site. 2) If you want to transfer stuff from Mindvox to your local Unix -- more (64%) -- site, type "ftp" on mindvox, and ftp back into your site log in as you (NOT anonymous) and use your regular Unix password for the password, and then "put" files from your home directory in Mindvox to your home directory on your Unix site. I don't think that Mindvox will actually become an anonymous ftp site for members. By it's very nature anonymous means that anybody from the Internet would be able to access stuff. Method 2 is a much better solution. Thug [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 55 of 57 Subject: Order and/or Chaos? From: voidmstr (Dennis Wilen) Date: Fri, 16 Apr 93 16:15:52 EDT O! Great VoxGods--- I've been trying to understand the method employed in listing the various contributions to the Uploads directory, with no luck at all. Am I really that dense, or is there some sort of kabbalistic/hermetic/phnordian je ne sais quoi involved that mere mortals like me are NOT PERMITTED to gnow? I remain your humble supplicant, voidmstr@mindvox.phantom.com voidmstr's law (tm): bandwidth expands to fit the waste available ============================================ [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 56 of 57 Subject: Re: Order and/or Chaos? From: paulk (Paul Kerrios) Date: Sun, 18 Apr 93 11:28:14 EDT voidmstr (Dennis Wilen) writes: > O! Great VoxGods--- > > I've been trying to understand the method employed in > listing > the various contributions to the Uploads directory, with no luck at all. > > Am I really that dense, or is there some sort of > kabbalistic/hermetic/phnordian je ne sais quoi involved that > mere mortals like me are NOT PERMITTED to gnow? Yes, after years of study I've deduced the secret: it's alphabetical. //=======================================\\ Paul Kerrios /=/ Society has made me what I am today. \=\ \=\ Ok so maybe I just watch too much TV! /=/ -- more (90%) -- \\=======paulk@mindvox.phantom.com=======// [ Area: MindVox / Forum: Archives ] [Return] 1-57, [Q]uit: Post: 57 of 57 Subject: Re: Order and/or Chaos? From: voidmstr (Dennis Wilen) Date: Sun, 18 Apr 93 13:10:53 EDT paulk (Paul Kerrios) writes: > voidmstr (Dennis Wilen) writes: > > > O! Great VoxGods--- > > > > I've been trying to understand the method employed in > > listing > > the various contributions to the Uploads directory, with no luck at all. > > > > Am I really that dense, or is there some sort of > > kabbalistic/hermetic/phnordian je ne sais quoi involved that > > mere mortals like me are NOT PERMITTED to gnow? > > Yes, after years of study I've deduced the secret: it's alphabetical. > > > //=======================================\\ -- more (47%) -- > Paul Kerrios /=/ Society has made me what I am today. \=\ > \=\ Ok so maybe I just watch too much TV! /=/ > \\=======paulk@mindvox.phantom.com=======// Which alphabet is this, O Wise One? voyska_p.lzh 289116 8-Dec-92 voyska_x.lzh 339030 30-Jan-93 zup.save 353 1-Mar-93 pkz204g.exe 203110 8-Feb-93 bwp.lzh 82844 11-Apr-93 nastyj02.txt1 17391 13-Apr-93 snes_cdr.lha 6261 26-Oct-78 sj_9304.zip 13404 13-Apr-93 win31dsk.exe 58959 17-Apr-92 ---void -- more (86%) -- ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Where is the UseNet News? voidmstr@mindvox.phantom.com ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ [ Area: MindVox / Forum: Archives ] [P]ost, [L]ist, [1-57] [Q]uit: -=/[ End of All Songs / [No Further Messages] ]/=- [ Area: MindVox / Forum: Archives ] [P]ost, [L]ist, [1-57] [Q]uit: Q  -=/[ Returning to Main Menu ]/=- (3:15am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: ARCHIE VES  MindVox [ARCHIVES] Library Type "?" to Display the MENU or Select [H]elp for detailed assistance Current Directory: [Archives] [Archives]:  MindVox [ARCHIVES] Library -=/[ File Location Services ]/=- -=/[ File Transfer Options ]/=- [C]hange - Move to a new Directory [A]rc - View Contents of an .arc [D]ir - View CURRENT Directory .zip, .lzh, or .tar File [F]ind - Locate Files by Title [P]rotocol - Set Transfer Protocol [N]ew - Listing of NEW Files [R]eceive - Upload File(s) **TO US** [T]op - Switch to Top Directory [S]end - Send File from US to YOU [.] - Move Back ONE Directory [W]rite - Write Text to a File [H]elp - Get Help! / [Q]uit - Exit [V]iew - View an ASCII File Current Directory: [Archives] [Archives]: Current Directory: [Archives] [Archives]: Directory: * Computers < DIR > 28-Apr-93 Software for Download Cyberpunk < DIR > 9-Apr-93 Fiction and Files Cyberspace < DIR > 9-Apr-93 Drugs < DIR > 9-Apr-93 Encryption < DIR > 9-Apr-93 Internet < DIR > 10-Apr-93 Everything about the InterNet MindVox < DIR > 9-Apr-93 Help and Information about MindVox Security < DIR > 9-Apr-93 Computer Security TheArts < DIR > 9-Apr-93 Film, Music, Theatre and Fiction Uploads < DIR > 29-Apr-93 VR < DIR > 9-Apr-93 Virtual Reality and its Impact Virus < DIR > 9-Apr-93 Articles and Papers about Viruses Current Directory: [Archives] [Archives]: Change Directory: CTBERPUNK        YBERUN  PUNK No such directory. You must match upper and lowercase in directory names exactly as they appear! Current Directory: [Archives] [Archives]: Change Directory: Cyberpunk Current Directory: [Archives/Cyberpunk] [Archives]: Directory: * FAQS < DIR > 8-Jan-93 FutureCulture < DIR > 8-Jan-93 Journals < DIR > 10-Jan-93 Misc < DIR > 16-Mar-93 Current Directory: [Archives/Cyberpunk] [Archives]: Change Directory: Journals Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Directory: * CheapTruth < DIR > 19-Nov-92 ScreamBaby < DIR > 9-Feb-93 Vanguard < DIR > 10-Jan-93 Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Directory: * CheapTruth < DIR > 19-Nov-92 ScreamBaby < DIR > 9-Feb-93 Vanguard < DIR > 10-Jan-93 Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Change Directory: CheapTruth Current Directory: [Archives/Cyberpunk/Journals/CheapTruth] [Archives]: Directory: * cheaptru.1 9577 22-Apr-87 cheaptru.10 9856 29-Jul-87 cheaptru.11 8704 29-Jul-87 cheaptru.12 7808 29-Jul-87 cheaptru.13 9856 29-Jul-87 cheaptru.14 9984 29-Jul-87 cheaptru.15 9856 29-Jul-87 cheaptru.16 17536 29-Jul-87 cheaptru.2 10240 29-Jul-87 cheaptru.3 9088 29-Jul-87 cheaptru.4 10880 29-Jul-87 cheaptru.5 10112 29-Jul-87 cheaptru.6 7936 29-Jul-87 cheaptru.7 11136 29-Jul-87 cheaptru.8 9472 29-Jul-87 cheaptru.9 9600 29-Jul-87 cp-intro 256 19-Nov-92 teensuic.doc 10240 28-Jul-87 Current Directory: [Archives/Cyberpunk/Journals/CheapTruth] [Archives]:  MindVox [ARCHIVES] Library -=/[ File Location Services ]/=- -=/[ File Transfer Options ]/=- [C]hange - Move to a new Directory [A]rc - View Contents of an .arc [D]ir - View CURRENT Directory .zip, .lzh, or .tar File [F]ind - Locate Files by Title [P]rotocol - Set Transfer Protocol [N]ew - Listing of NEW Files [R]eceive - Upload File(s) **TO US** [T]op - Switch to Top Directory [S]end - Send File from US to YOU [.] - Move Back ONE Directory [W]rite - Write Text to a File [H]elp - Get Help! / [Q]uit - Exit [V]iew - View an ASCII File Current Directory: [Archives/Cyberpunk/Journals/CheapTruth] [Archives]: View: cheaptru.1 $0$0$0$0$0$0$0$0 CHEAP TRUTH ONE $0$0$0$0$0$0$0$0EDITORIAL: Hi. You want to know the truth. We want to tell it to you.Let's try to keep the ECONOMICS between us to a minimum, okay? Right, let'sdo it.** QUEST FOR DECAY ** As American SF lies in a reptilian torpor, its small, squishy cousin,Fantasy, creeps gecko-like across the bookstands. Dreaming of dragon-hood,Fantasy has puffed itself up with air like a Mojave chuckwalla. SF'scollapse had formed a vacuum that forces Fantasy into a painful and explosivebloat. Short stories, crippled with the bends, expand into whole hideoustrilogies as hollow as nickel gumballs. Even poor Stephen Donaldson, whostruggles to atone for his literary crimes with wet hippy sincerity, has beenforced to re-xerox his Tolkien pastiches and doubly insult the public. AsRobert E. Howard spins in his grave, the Chryslers of publishing attachrotors to his head and feet and use him to power the presses. But the editors have eaten sour grapes and the writers' teeth are on-- more -- edge. Fantasy, for too long the vapid playground of McCaffreyiteunicorn-cuddlers and insect-eating SCA freaks, has some new and dangerousborderlands. Suddenly, perhaps out of sheer frustration, fantasy hasmovement and color again. It is the squirming movement of corruption and thebright sheen of decay.** Some Examples ** NIFFT THE LEAN by Michael Shea. DAW, $2.95. Jack Vance's acolyte,author of the apprentice work QUEST FOR SIMBILIS, Shea has suddenly andfearsomely come into his own. This astonishing work shows a furiousimaginative concentration that is impressive and even appalling. Thelegitimate heir of Vance, Leiber, and Clark Ashton Smith, Shea rips aside thepolite, smirking ironies of these polished writers and shows us a crawling,boiling vision of the demonic. He is a Fender Stratocaster to Vance'sStradivarius. For those familiar with Vance's work, the effect is odd anddisquieting, like seeing a favorite uncle stumble in, blasted on bad acid andmumbling cosmis obscenities. There are supernatural horrors here that makeCthulhu and his boys look as tame as pinstriped bankers. Hell itself, itsdenizens and environs, are captured with a revolting nicety of detail and-- more -- Current Directory: [Archives/Cyberpunk/Journals/CheapTruth] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Directory: * CheapTruth < DIR > 19-Nov-92 ScreamBaby < DIR > 9-Feb-93 Vanguard < DIR > 10-Jan-93 Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Send: ScreamBaby 4 blocks, 1k, with Z protocol rz **B00000000000000 Š Got CAN waiting to send file sz 3.11 02-26-91 finished. < UNSUCCESSFUL TRANSFER > Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Change Directory: Sream    creamBaby Current Directory: [Archives/Cyberpunk/Journals/ScreamBaby] [Archives]: Directory: * scream-baby.dec92 12542 30-Dec-92 scream-baby.jan 0 5-Jan-93 scream-baby.jan93 36626 4-Jan-93 scream-baby.nov92 32734 30-Dec-92 scream-baby.oct92 29957 30-Dec-92 scream-baby.sep92 39178 30-Dec-92 Current Directory: [Archives/Cyberpunk/Journals/ScreamBaby] [Archives]: View: scream-baby.dec92 _____________________________________ | | | I've got just four words to say to | | those who are [dissing] Jagwire X's | | Autopia Project : | | | | "Get Your Own Boat" | | -- polekat | |_____________________________________| babybabybabybabybabybabybabybabybabybabybabybabybabybabybabybabybabybabybaby babybabyb ybab aby byba abyb bybab ybabybaby babybaby bybabyba babybaby byb yba babybaby byb yba ba ba babybaby babybabyb byba babybaby yba aby yba ba ba babybaby babybabybabyb yba babybaby byb yba babybaby byb yba ba ba babybaby babybaby bybab aby byb yba aby byb yba ba ba babybaby babybabybabybabybabybabybabybabybabybabybabybabybabybabybabybabybabybabybaby Talking Raven Re:view December 16, 1992 -- more -- "Take all you want....I'll make more" __________________________________________________________________________ | | | Cyberlicious | Editor : Blade X | The Bamboo Gardens | | PO Box 4510 | bladex@wixer.cactus.org | (512) 385-2941 | | Austin, TX 78765 | Neo-Wobblie Node # 269 | WWIV : 46@5285 | |__________________________________________________________________________| EDIBORIAL This was supposed to be a simple letter to the Scream Baby subscribers. Hi! I'm going to Yew*stun for Xmas Con this weekend... Let's do launch if our spheres collide; was all this needed to be. Maybe toss in an interesting line noise or two. Perhaps a brief eulogy for my friend Sandeep. Seems he was hiking in New Mexico and was excited about seeing snow for the fourth time in his life. [Sandeep was from India] He ran ahead of his group, got separated, got lost, -- more -- and died of hypothermia that night. To put it in perspective, re:alize that Sandeep contracted a rare neurological disorder six months ago. He woke up not being able to feel or move his legs, the victim of a mystery-to-medicine. Being in New Mexico was a celebration of months of successful rehabilitation. People die every day. You will die someday soon sorry to spoil the secret. But dying out of excitement to explore the universe......it could be worse. Walk it like ya talk it. Thanx for the lesson, Sandeep. ____________________________________ | | | It could have been "Walter" Gibson | | | | -- Paco | |____________________________________| -- more -- TALKING RAVEN THE JOURNAL OF IMAGINATIVE TROUBLE Talking Raven : The Journal of Imaginative Trouble Vol II, #1 Summer Solstice 1992. Distributed free on the streets of Seattle. By snailmail $2 USD in America, $5 USD anyplace else. The theme of this issue is "Virtual Reality : Close But No Cigar." Editor Antero Alli claims this to be "our cyberpunk satire, a rebellion against those simulated realities and media illusions which....fail to move the imagination." If satire is what Talking Raven sought, then consider this issue a miserable failure. This satire issue is super-charged concentrate; Antero Alli's writings reveal a Prime A Grade Cyberpunk. "From the Editor's Monitor" rants about virtual reality (more on that later) and ends with an advocation to "Turn off the TV and make your own movies" People seizing methods of producing mass media for themselves? A call to "turn off the TV and make your own movies....shoot the news or make the news....but get out there and DO SOMETHING"? -- more -- Nope, not cyberpunk! Another article explores the connections between advertising and black magic(k). Sean Kilpatrick explains how television commercials use the same methods that Aleister Crowley's espoused concerning the shaping of Will (re:ality). Antero Alli pops up again with an essay on "How To See Through Advertising" Television as a major form of thought control? Arming the viewer with knowledge in order to defend against the influence of advertising? Nope, not cyberpunk! The re-structuring of economic value from product to information? Nope, not cyberpunk! This isn't a satire; this is pure, unexpurgated cyberpunk. It ain't perfect, just damn interesting. -- more -- The knock against virtual reality essentially claims that VR ain't cyberpunk *enough*. One of the identifying characteristics of New Edge technology is individual personal control. How many of you can program a virtual reality environment? How many of you think you'll be able to do so in less than 20 years? Not I. Sure, nickel and dime stuff, but there is such a wide chasm between possibility and plausibility that I'll look for other ledges to leap. For all the rhetoric on individual emancipation, for all the rhetoric on DIY, 99% of the population will be plugging in pre-prepared Babbage's bubble shrink wrap slag. A rail against the commodification of cyberspace? Nope, not cyberpunk! -- end of review -- ______________________________________________ | | | There are some who still believe in reality. | -- more -- | Believe in re:ality. | |______________________________________________| -- beginning of re:view -- ____________________________ | | | Re:ality is the sum of the | | spheres of reality. | |____________________________| The history of humanity is the clan/family. Individuals had little contact with other realities -- and cultural exchange was more likely to involve weapons of destruction than literature when one walked into the walls of a different reality tunnel. Today we are flooded. Not satisfied with a single perspective, thought, belief, and culture, communication technology strives to represent the realities of every single human on the planet. No corner of the globe too distant to explore, no ugly seam at home too disturbing to ignore. -- more -- Current Directory: [Archives/Cyberpunk/Journals/ScreamBaby] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Directory: * CheapTruth < DIR > 19-Nov-92 ScreamBaby < DIR > 9-Feb-93 Vanguard < DIR > 10-Jan-93 Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Change Directory: Vanguard Current Directory: [Archives/Cyberpunk/Journals/Vanguard] [Archives]: Directory: * vanguard.01 64465 10-Jan-93 Current Directory: [Archives/Cyberpunk/Journals/Vanguard] [Archives]: View: n vanguard.01 Copyright 1992, Vanguard Productions WELCOME to the first issue of CYBERSPACE VANGUARD! Despite the name, CV is NOT a magazine about or in any way related to cyberpunk. We chose the name simply because "cyberspace" is quickly becoming the 90's word for the world of electronic communications. CV will cover pretty much anything that's of interest to the science fiction community, regardless of what it is. We're open to submissions from anyone, regardless of experience. The writing is judged SOLELY on its quality. For writers' guidelines, write to cn577@cleveland.freenet.edu or, for those of you who prefer to communicate on paper, you can write to us at: Cyberspace Vanguard PO Box 25704 -- more -- Garfield Heights, OH 44125 USA But enough about that. This month we've brought you interviews with Jeff Kaake of Space Rangers, Peter Donat of the upcoming show TIME TRAX, J. Michael Straczynski, creator of BABYLON 5, and Eric Radomski, producer of BATMAN: THE ANIMATED SERIES. (What can we say, it's a big month for TV!) We've also brought you, in the words of one of our readers, "more news than hours of net surfing." All this is just the beginning. We need YOUR input to help make Cyberspace Vanguard THE source of SF news. Tell us what you like about it, what you hate about it, but most of all, what you think would improve it. So that we don't wind up with scores of copies of the magazine inadvertently quoted back to our mailbox, we've posted an electronic reply card immediately after this post. Oh, and a note to other editors: CV is registered with the United States Copyright Office. We don't mind you quoting us, but we must insist on credit being given. All rights -- more -- Current Directory: [Archives/Cyberpunk/Journals/Vanguard] [Archives]: Current Directory: [Archives/Cyberpunk/Journals/Vanguard] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberpunk/Journals] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberpunk] [Archives]: Directory: * FAQS < DIR > 8-Jan-93 FutureCulture < DIR > 8-Jan-93 Journals < DIR > 10-Jan-93 Misc < DIR > 16-Mar-93 Current Directory: [Archives/Cyberpunk] [Archives]: Change Directory: FutureCultue re Current Directory: [Archives/Cyberpunk/FutureCulture] [Archives]: Directory: * FC-faq.p1 44627 19-Nov-92 FC-faq.p2 57657 19-Nov-92 Current Directory: [Archives/Cyberpunk/FutureCulture] [Archives]: View: fc-faq.p1 File not found. Current Directory: [Archives/Cyberpunk/FutureCulture] [Archives]: View: FC-faq.p1 _____________________ ____________________ / __________________/ / ________________/ / /____________ / / / ____________/ / / / / / /_______________ /__/ uture /__________________/ ulture ___________________________________________________________________ | | | Tomorrow's Reality Today..... | |___________________________________________________________________| A somewhat-definitive guide to resources bringing you the future..... updated: October.23.1992 _______________________________________________________________________________ Requests to FutureCulture must be sent to: future-request@nyx.cs.du.edu -- more -- The subject must have one of the following: subscribe realtime -subscribe in realtime (reflector) format subscribe digest -subscribe in daily-digest (1 msg / day format) subscribe faq -subscribe to faq only (1 msg every few months) unsubscribe realtime unsubscribe digest unsubscribe faq send info -receive info on the FutureCulture mailing list send faq -this file (list subscribers automatically receive a copy) FutureCulture list maintainer and keeper of this FAQ hawkeye (andy) ahawks@nyx.cs.du.edu _______________________________________________________________________________ While no article that attempts to document an entire emerging subculture can be complete, I will do my best to give you enough complete and accurate information to get you on your way to the future. -- more -- This article will focus mainly on cyberpunk culture, rave culture, industrial, post po-mo, virtual reality, drugs, computer underground, etc. Basically, the elements that make up the developing techno-underground, the new edge, the technoculture. Included in this article will be: suggested readings -- books, magazines, zines, requisite authors, etc., BBSes devoted to relevant topics, corporations and merchandise geared toward the techno-aware, Internet e-mail addresses for relevant figure-heads in this area, suggested music and movies/videos, FTP sites, etc. I will do my best to update this article every so often, as the techno-underground is not stagnant and is always shifting and changing and moving forward. If you have any complaints/comments/suggestions/errors or just wanna send someone mail, write to me on the Internet - ahawks@nyx.cs.du.edu. I also welcome addition requests and such - feel free to say "hey man, add blah-blah to the list!" -----all the information contained in this article is for information purposes only - I am not responsible for anything but me and all that - I disclaim everything I possibly can and all that other stuff -- more -- -----many thanks go out to The Butler for his article "An Introduction to the Computer Underground", which was an invaluable resource and model! ______________________________________________________________________________ If you find this file useful and think it is a worthwhile endeavor, please send a couple dollars to: Andy Hawks 4290 South Mobile Circle Apt. D Aurora, CO 80013 USA The money is used to help finance the research that goes into this file - i.e.: sending away for zines, information from companies, etc. Research, I've found at my own expense, can be very costly and time-consuming, and it will be almost impossible for me to continue this venture without outside support. ______________________________________________________________________________ We are the music makers. And we are the dreamers of the dreams. :::::Wille Wonka and the Chocolate Factory Time just ain't doing what it used to do. -- more -- ::::::Bernard Sumner w/ 808 State Reality is for people who can't handle drugs. ::::::the masses The cyberpunks did not originate their vision, but picked up bits and pieces of what was actually coming true, and fed it back to the readers who were already living in Gibson's Sprawl, whether they knew it or not. ::::::Steve Brown Information wants to be free. Believe it, pal. ::::::Bruce Sterling If only you could see what I've seen through your eyes ::::::Blade Runner They made LSD illegal - I wonder what they'll do with this. ::::::Jerry Garcia on Virtual Reality We've discovered Cyberotica!!!!! ::::::The Shaman at a Rave with RU Sirius -- more -- The techno-underground is a direct descendant of the hippy revolution. ::::::Select Magazine (April .92) Cyberpunks use all available data input to think for themselves. ::::::Timothy Leary "Thus the most repressed sector of society acquires a paradoxical power through the myth of its occult and knowledge." [Hakim Bey]. Gibson & Burroughs & Lewis Shriner & Norman Spinrad & Bruce Sterling created the perfect term -- CYBERPUNK! "The odd occult shadow still haunts" the civilized, industrial culture. Here is the marvelous paradox of VR/Cyberpunk: Big high-tech firms fighting the myth of "electronic LSD." Jaron Lanier as wizard with dreadlocks! Eric Gullichsen - student of Crowley! Mondo 2000! Gibson and his data rustlers! ::::::Timothy Leary ______________________________________________________________________________ | | | Contents: | |______________| -- more -- ::::: * Part 1 intro quotes contents cultural literacy magazines (hardcopy) electronic zines and digests electronic-essays ::::: * Part 2 usenet newsgroups e-mail addresses internet bbses and services ftp sites bbses books videos music drugs -- more -- companies/merchandise closing ______________________________________________________________________________ | | | Cultural Literacy | |______________________| Agrippa: A Book of the Dead - A collaboration between author [William Gibson], publisher Kevin Begos Jr, and artist Dennis Ashbaugh. This art-work contains engravings by Ashbaugh which appear or disappear in light and an on-disk semi-autobiographical poem by [William Gibson] which is unreadable after having been read once. Agrippa is notable because in many respects it blurs the lines about what art is, and adds fuel to the fire on issues of property rights and intellectual property. BBSes - electronic Bulletin Board Systems. Begun in the late 70's, a form of [virtual community] existing in [cyberspace] where participants (usually using aliases) may send and receive public and private messages to each other on any topic imaginable, transfer software (copyrighted and/or public -- more -- domain), play on-line games, etc. There is the "over-ground" BBS world where aliases are less common and illegal activities are avoided in discussion, and the [{computer} underground] where illegal activities and discussions are very common, members use aliases, and illegal information and/or software is exchanged. Boxing - A variety of electronic devices used to aid in [phreaking]. The original was the blue box, used from the mid 60's to the mid 80's, which allowed long distance phone calls to be made for free. A variety of other similar instruments accomplishing different tasks have been developed, some purely comical, some quite practical. CC fraud - Credit Card or Calling Card fraud. common in the [computer underground] community. Chaos Theory - science revolving around simplistic equations involving a large number of variables. Gave rise to [fractals], a form of [cyberdelic] art. For further info on the subject, James Gleick's "Chaos: Making a New Science" is suggested. -- more -- Computer Underground - "A group organized in secrecy, hidden behind aliases, to promote the free exchange of information regarding anything and everything including, but not limited to: computers, telephones, radios, chemicals, and ideas." (thanx to The Butler for this definition) The mainstay of communication for the computer underground is [cyberspace], more specifically [BBSes]. The computer underground is comprised of [hackers], [phreakers], [piraters], anarchists, and other [cyberpunks]. CP - see [cyberpunk]. Cryonics - The fringe science of freezing a person's head or whole body after death, in the hopes that in the future they may be revived and brought back to life. Cyber- - A prefix taken from [cybernetics] generally used in popular culture to mean anything that is technologically oriented. Cyberdeck - Term originated by [William Gibson] to refer to a computer used by [deck cowboys] that can connect to the -- more -- [matrix]. Cyberdelic - "Cyber-art". Examples include [fractals], computer-generated pictures and/or music, [virtual worlds], etc. Cybernetics - The study of communication systems in living organisms and machines, the mathematical analysis of the flow of information. Cyberpunk - Begun as a literary movement in the 80's, an off-shoot of normal science fiction. Unique in that it generally occurs in the present or not so distant future, the characters are often considered "punks" and technology, (the cyber aspect), is prominent. "Neuromancer" by [William Gibson], published in 1984, is considered by most to be the "bible" of cyberpunk. Another prominent author is [Bruce Sterling], editor of another worthy cyberpunk collection, "Mirrorshades". Other examples of cyberpunk include Max Headroom (tv show) and Blade Runner (movie). Cyberpunk is special in that it has evolved from a purely literary movement to a realistic subculture. Many "techno-punks" -- more -- (ie: [hackers]) are considered cyberpunks. Other contributing factors to the cyberpunk subculture include: virtual reality, hallucinogenic and [nootropic] drugs, and industrial and punk music. For an in-depth, detailed look at cyberpunk fiction and cyberpunk culture, "Storming the Reality Studio", ed. by Larry McCaffery is suggested. Cyberspace - "The electronic frontier." A completely virtual environment: the sum total of all [BBSes], computer networks, and other [virtual communities]. Unique in that it is constantly being changed, exists only virtually, can be practically infinite in "size", communication occurs instantaneously world-wide - physical location is completely irrelevant most of the time. Deck Cowboys - Futuristic version of a computer [hacker] or a modern-day [cyberpunk]. Electronic Frontier Foundation - (EFF). Organization founded by Mitch Kapor (of Lotus fame) and John Perry Barlow (writer and Grateful Dead songwriter) to establish laws for [cyberspace] -- more -- and apply the constitution to [virtual communities]. Fractals - Images created using [chaos theory]. A mish-mash of colors presented in a pattern that repeats itself many times over. A popular type of fractal image is one created using the "Mandlebrot set". Fractals are considered [cyberdelic] art. Gibson, William - Considered by most to be the "father" of [cyberpunk], along with [Bruce Sterling]. His works include the infamous "Neuromancer", "Count Zero", "Mona Lisa Overdrive" (these 3 works are known as the [sprawl] series), "The Difference Engine" with which he was co-author with [Bruce Sterling], and "Burning Chrome" a collection of short stories. Hist latest work is a poem in "[Agrippa: A Book of the Dead]". Gibson says he will no longer be writing the "classic" [cyberpunk] novels he is famous for. Hacker - 60's (1st) generation (orig. MIT): one who tinkers with software, electronics, computer hardware, etc. 80's (2nd) [WarGames] generation: one who enters computer systems without permission with either malicious or non-malicious -- more -- intent, to gain, alter, or destroy information (labelled as [crackers] by the 60's generation). 90's (3rd) generation: often called [cyberpunks], mostly non-malicious [crackers] interested in information for the sake of information, and not hacking for the sake of the hack - sometimes calling themselves "information liberators", they have re-adopted more of the original hacker ethic of the 60's which states mainly "all information should be free", "access to computers should be unlimited and total" and "promote decentralization". This new, 3rd generation is commonly associated with the computer underground, despite its mostly non-malicious intent. Industrial - A subculture revolving around industrial music, a collection of mostly electronically created sounds and samples that results in a fierce explosion of sound labelled by many as "the new punk". This subculture is generally anti-political, anti-aesthetic in nature. Internet - A large and very popular world-wide computer network begun by the Defense Department in the 60's that connects educational institutions, corporations, organizations, and -- more -- Current Directory: [Archives/Cyberpunk/FutureCulture] [Archives]: View: FC-faq.p2 _____________________________________________________________________________ ::: * Begin FutureCulture FAQ Part 2 (of 2) c o n t i n u a t i o n o f p a r t 1 ______________________________________________________________________________ ______________________________________________________________________________ | | | Usenet Newsgroups: | |______________________| (list of newsgroups one might find interesting...These change often, especially the 'alt' groups, so please check the newsgroups file on your site for more info) alt.artcom Artistic Community, arts & communication. alt.bbs.ads Ads for various computer BBS's. alt.bbs.internet BBS systems accessible via the Internet. alt.comp.acad-freedom.news Academic freedom issues related to computers. alt.comp.acad-freedom.talk Academic freedom issues related to computers. alt.consciousness All aspects of consciousness -- more -- alt.cyberpunk High-tech low-life. alt.cyberpunk.chatsubo Literary virtual reality in a cyberpunk hangout. alt.cyberpunk.movement Cybernizing the Universe. alt.cyberpunk.tech Cyberspace and Cyberpunk technology. alt.cyberspace and how it should work. alt.dcom.telecom Discussion of telecommunications technology. alt.drugs Recreational pharmaceuticals and related flames. alt.drugs.usenet Many things are addictive besides pills. alt.fractals Fractals in math, graphics, and art. alt.gothic The gothic movement: things mournful and dark. alt.hackers Descriptions of projects currently under development. alt.hackers.malicios Bad hackers. alt.individualism Individualist discussions alt.industrial The Industrial Computing Society. alt.internet.access.wanted People looking for internet access alt.internet.services Internet services alt.manga Discussion of non-Western comics. alt.paranormal Phenomena which are not scientifically explicable. alt.postmodern Postmodernism, semiotics, deconstruction, and the like. alt.privacy Privacy issues in cyberspace. alt.psychoactives Better living through chemistry. alt.radio.pirate Discussions surrounding pirate radio -- more -- alt.rave Rave culture alt.rock-n-roll Counterpart to alt.sex and alt.drugs. alt.security Security issues on computer systems. alt.sex Postings of a prurient nature. alt.skate-board Discussion of all apsects of skate-boarding. alt.skinheads The skinhead culture/anti-culture. alt.slack Posting relating to the Church of the Subgenius. alt.society.ati The Activist Times Digest. (Moderated) alt.society.cu-digest Postings about the Computer Underground. (Moderated) alt.sport.lasertag Indoor splatball with infrared lasers. alt.thrash Thrashlife. bionet.neuroscience Research issues in the neurosciences bit.listserv.emusic-l Electronic Music Discussion List. bit.listserv.ethics-l Discussion of Ethics in Computing. bit.listserv.4ad-l The 4AD recording label. bit.listserv.fnord-l New Ways of Thinking List. bit.listserv.frac-l FRACTAL Discussion List. bit.listserv.valert-l Virus Alert - Urgent Virus Warnings. bit.listserv.virus-l Computer viruses. bit.listserv.xtropy-l Extropians comp.ai Artificial intelligence discussions. comp.ai.neural-nets All aspects of neural networks. -- more -- comp.ai.philosophy Philosophical aspects of Artificial Intelligence. comp.ai.vision Artificial Intelligence Vision Research. (Moderated) comp.bbs.misc BBS Discussion comp.bbs.internet Internet BBSes comp.dcom.telecom Telecommunications digest. (Moderated) comp.graphics Computer graphics, art, animation, image processing. comp.graphics.research Highly technical computer graphics discussion. comp.graphics.visualization Info on scientific visualization. comp.music Applications of computers in music research. comp.org.acm Topics about the Association for Computing Machinery. comp.org.eff.news News from the Electronic Frontiers Foundation. comp.org.eff.talk Discussion of EFF goals, strategies, etc. comp.org.fidonet FidoNews digest, official news of FidoNet Assoc. comp.research.japan The nature of research in Japan. (Moderated) comp.risks Risks to the public from computers & users. (Moderated) comp.robotics All aspects of robots and their applications. comp.security.announce Announcements from CERT. (Moderated) comp.simulation Simulation methods, problems, uses. (Moderated) comp.society The impact of technology on society. (Moderated) comp.society.development Computer technology in developing countries. comp.society.folklore Computer folklore & culture, past & present. comp.society.futures Events in technology affecting future computing. -- more -- misc.activism.progressive Information for Progressive activists. misc.int-property Discussion of intellectual property rights. misc.legal.computing Discussing the legal climate of the computing world. news.announce.important General announcements of interest to all. (Moderated) news.future The future technology of network news systems. pubnet.nixpub The "nixpub" list of public access UNIXes. pubnet.sources Software of interest to BBS users and sysops. pubnet.sysops Discussions between sysops of BBS systems. pubnet.talk Miscellaneous BBS talk. rec.arts.animation Discussion of various kinds of animation. rec.arts.anime Japanese animation fen discussion. rec.arts.comics Comic books and strips, graphic novels, sequential art. rec.arts.sf-lovers Science fiction lovers' newsgroup. rec.arts.sf-reviews of science fiction/fantasy/horror works. rec.arts.sf.announce Major announcements of the SF world. (Moderated) rec.arts.sf.fandom Discussions of SF fan activities. rec.arts.sf.marketplace Personal for-sale notices of SF materials. rec.arts.sf.misc Science fiction lovers' newsgroup. rec.arts.sf.movies Discussing SF motion pictures. rec.arts.sf.reviews Critiques of science fiction stories. (Moderated) rec.arts.sf.science Real and speculative aspects of SF science. rec.arts.sf.tv Discussing general television SF. -- more -- rec.arts.sf.written Discussion of written science fiction and fantasy. rec.ham-radio Amateur Radio practices, contests, events, rules, etc. rec.music.gdead A group for (Grateful) Dead-heads. rec.music.industrial Discussion of all industrial-related music styles. rec.music.makers For performers and their discussions. rec.music.newage "New Age" music discussions. rec.music.synth Synthesizers and computer music. rec.music.video Discussion of music videos and music video software. rec.radio.amateur.misc Amateur radio practices, contests, events, rules, etc. rec.radio.noncomm Topics relating to noncommercial radio. rec.radio.shortwave Shortwave radio enthusiasts. rec.video Video and video components. rec.video.releases Pre-recorded video releases on laser-disc and videotape sci.bio.technology Any topic relating to biotechnology. sci.cryonics People who freeze themselves after death sci.crypt Different methods of data en/decryption. sci.lang.japan The Japanese language, both spoken and written. sci.logic Logic -- math, philosophy & computational aspects. sci.military Discussion about science & the military. (Moderated) sci.nanotech Self-reproducing molecular-scale machines. (Moderated) sci.philosophy.meta Discussions within the scope of "Meta-Philosophy." sci.philosophy.tech Technical philosophy: math, science, logic, etc. -- more -- sci.physics.fusion Info on fusion, esp. "cold" fusion. sci.psychology Topics related to psychology. sci.skeptic Skeptics discussing pseudo-science. sci.space Space, space programs, space related research, etc. sci.space.shuttle The space shuttle and the STS program. sci.virtual-worlds Modelling the universe. Virtual Reality. (Moderated) soc.culture.japan Everything Japanese, except the Japanese language. soc.culture.usa The culture of the United States of America. soc.human-nets Computer aided communications digest. (Moderated) talk.bizarre The unusual, bizarre, curious, and often stupid. talk.philosophy.misc Philosophical musings on all topics. talk.politics.drugs The politics of drug issues. talk.politics.space Non-technical issues affecting space exploration. ______________________________________________________________________________ | | | E-Mail Addresses: | |____________________| (please use care and consideration when mailing to these people - do not send private mail if it is not important.) [Note: If you are looking for a person who is not on the list but should be, I suggest you use the 'whois' or 'netwhois' command, or finger @ a particular -- more -- site if you know the site the person on.] [2 other obvious places to check are the WELL and MindVox, where a lot of the cyber-crowd hangs out] Aristotle uk05744@ukpr.uky.edu John Perry Barlow barlow@well.sf.ca.us Cyndre the Grey root@ashpool.sccsi.com Dorothy Denning denning@cs.georgetown.edu Peter J Denning pjd@cs.gwu.edu Desert Fox root@fennec.sccsi.com Dispater dispater@stormking.com The EFF eff@eff.org Mark Frauenfelder mark@well.sf.ca.us Freaker's Bureau Int'l au530@cleveland.freenet.edu Gatsby gatsby@ryptyde.tcs.com Mike Godwin mnemonic@eff.org Emmanuel Goldstein emmanuel@well.sf.ca.us Ground Zero gzero@tronsbox.xei.com Hactic ropg@ooc.uva.nl Hawkeye (put this art. together)ahawks@nyx.cs.du.edu Intertek (Steve Steinberg) steve@cs.ucsb.edu Judge Dredd elisem@nuchat.sccsi.com -- more -- Mitch Kapor mkapor@eff.org Knight Lightning (Craig Neidorf)knight@well.sf.ca.us Lord Digital digital@phantom.com Lord Macduff macduff@nuchat.sccsi.com Lord Nose lordnose@well.sf.ca.us Tom Maddox tmaddox@netcom.com Mentor (Loyd Blankenship) cs.utexas.edu!dogface!fnordbox!loydb Mondo 2000 mondo2k@well.sf.ca.us mondo2k@mindvox.phantom.com Gordon Meyer 72307.1502@compuserve.com Marvin Minsky minsky@media.mit.edu Peter G Neumann neumann@csl.sri.com Ono-Sendai osendai@well.sf.ca.us Donn B. Parker dparker@sri.com Pengo (Hans Heubner) hans@trabant.artcom.de Genesis P-Orridge gensis@well.sf.ca.us John S Quarterman jsq@tic.com Eric S. Raymond eric@snark.thyrsus.com Len Rose len@netsys.netsys.com RU Sirius rusirius@well.sf.ca.us Eugene Spafford spaf@cs.perdue.edu Richard Stallman rms@athena.mit.edu -- more -- Bruce Sterling bruces@well.sf.ca.us St. Jude stjude@well.sf.ca.us Cliff Stoll stoll@earthquake.berkeley.edu Michael Synergy synergy@metaphor.com Jim Thomas tk0jut1@niu.bitnet Ken Thompson ken@research.att.com Tuc tuc@stormking.com 2600 2600@well.sf.ca.us Vernor Vinge vinge@SDSU.EDU _____________________________________________________________________________ | | | Internet BBSes | |__________________| (telnetable sites of interest, taken from: "Zamfield`s Wonderfully Incomplete, Complete Internet BBS List" [Zamfield@Dune.EE.MsState.Edu]) [Yanked without permission- hope no one minds...The full file is available at many FTP sites and is regularly updated on alt.bbs.internet or alt.internet.services] Cleveland Free-Net 129.22.8.75 (cwns16.ins.cwru.edu) CWRUBBS -- more -- -- 129.22.8.76 (cwns9.ins.cwru.edu) -- 129.22.8.82 (cwns10.ins.cwru.edu) -- freenet-in-a.cwru.edu -- freenet-in-b-cwru.edu -- freenet-in-c-cwru.edu -- Usenet, Internet, MUD, USA Today ON-Line. Local -- mail, and Interest Groups. Mars Hotel jupiter.ee.msstate.edu MindVox phantom.com -- call for sub rates Netcom netcom.netcom.com guest + at passwd -- 192.100.81.100 -- voice # 408-554-UNIX -- Full Unix service. Money for access. Nyx BBS isis.cs.du.edu new -- 130.253.192.9 SpaceLink BBS spacelink.msfc.nasa.gov -- more -- -- 128.158.13.250 The WELL well.sf.ca.us -- 192.132.30.2 -- call for sub rates The World world.std.com new -- 192.74.137.5 -- sign-up, dial 617-739-WRLD, type new. basic -- rates are $2/hr 24 hrs/day and $5 monthly fee. -- 20/20 plan, $20 for 20 hrs, including monthly -- fee. Also available from Compuserve Packet -- Network. $5.60 surcharge is added to monthly -- bill. Further info at staff@world.std.com :::::SERVICES Archie quiche.cs.mcgill.ca archie -- 132.206.2.3 -- archie-client sites. -- archie.sura.net -- archie.mcgill.ca -- more -- -- archie.funet.fi -- archie.au -- archie.doc.ic.ac.uk -- cs.huji.ac.il -- Archie is the easiest, fastest, and most convenient -- way to find files available via anonymous FTP. DDN Network Information Center -- nic.ddn.mil -- 192.112.36.5 FTP Mail write mail to ftpmail@decwrl.dec.com -- reply -- connect [HOST [USER [PASS]]] -- chdir PLACE -- compress -- compact -- uuencode -- btoa -- ls (or dir) PLACE -- get FILE -- quit -- more -- -- >>> examples: -- -> connect to gatekeeper.dec.com and get the -- README.ftp file: -- connect -- get README.ftp -- quit -- -> connect to gatekeeper.dec.com and get the -- gnuemacs sources: -- connect -- binary -- chdir /pub/GNU -- get emacs-18.57.tar.Z -- quit -- -> connect to uunet.uu.net as anonymous and get a -- root directory list: -- connect uunet.uu.net -- dir -- quit GeoServer Martini.eecs.umich.edu 3000 -- 141.212.100.9 3000 -- more -- IRC Client bradenville.andrew.cmu.edu -- 128.2.54.2 National Ham Radio Call-Sign Callbook -- 128.205.32.4 2000 -- marvin.cs.Buffalo.Edu 2000 Network Information Service (Univ. of California at Berkeley) -- mailhost.berkeley.edu 117 -- 128.32.136.9, 117 -- 128.32.136.12, 117 -- 128.32.206.9 117 -- 128.32.206.12 117 OCEANIC 128.175.24.1 OCEANIC -- delocn.udel.edu UM-Weather Service madlab.sprl.umich.edu 3000 -- 141.212.196.79 3000 Vatech Central Branching Exchange -- 128.173.16.6 -- more -- -- vtcbx.cc.vt.edu -- to get to the Dream World BBS, type -- C 26964, and hit enter a couple o times. WAIS server hub.nnsc.nsf.net wais -- 192.31.103.7 -- quake.think.com -- 192.31.181.1 -- nnsc.nsf.net -- 129.89.1.178 -- info at think.com < -- Wide Area Information Service. Gives access to online -- documents. More info can be obtained from think.com -- via anonymous ftp. ______________________________________________________________________________ | | | BBSes: | |__________| (most of these BBSes cater to the underground crowd. If that is not your forte then please look elsewhere. Even the most "overground" BBSes listed -- more -- here [WELL, MindVox, etc.] are sympathetic at least a little bit to the underground.) 071.477.8183 Monochrome (UK) 359.2.20.4198 Virus eXchange BBS (Bulgaria) 201.451.3063 Wrong Number 201.759.8450 Tronsbox (public access unix) 203.485.0088 Rune Stone 203.567.8903 Restaurant at the End of the Universe 203.628.9660 Dark Shadows 203.661.1279 The Grid (public access unix) 206.454.0075 Manta lair 209.526.3194 Tequila Willie's Great Subterranean Carnival 212.988.5030 MindVox (unix) 214.324.3501 KeelyNet 214.522.5321 Dead Zone 215.449.1902 Time Enough for Love (hippie oriented) 215.654.9184 The Cellar (public access unix) 301.384.2482 The Empire 303.438.1481 The Kracker Box 303.871.4824 Nyx (public access unix) 312.283.0559 ChiNet (public access unix) -- more -- 312.528.5020 Ripco 401.847.2603 Underground Computing Federation 408.241.9760 Netcom (public access unix) 408.245.7726 darkside.com (public access unix) 408.725.0561 Portal (public access unix) 408.867.7400 Spies in the Wire (unix) 414.363.4282 Lightning Systems 414.789.4210 Exec-PC 415.332.6106 The Well (public access unix) 415.472.5527 The Cyberden (public access unix - limited) 502.499.8933 Blitzkrieg (NUP) 503.635.2615 Awakening Technology 508.281.3961 Generic Access BBS 512.447.4449 The Illuminati BBS (Steve Jackson Games) 512.469.0447 The CyberSpace Institute 517.337.7319 Pure Nihilism 602.861.3167 Frayed Ends 602.894.1757 Unphamiliar Territory (NUP) 603.465.2793 SkyNet 617.475.6187 Convent 617.861.8976 The Works 618.549.4955 Free Speech -- more -- 703.820.0574 Pentavia 708.672.5426 World Trade Center 713.242.6853 Face-2-Face 713.337.1452 Dickinson Nightlight 713.522.0709 Lucid Dreams 713.668.7176 NuChat (public access unix) 717.361.0947 Digital Warfare (NUP) 718.358.9209 Switchboard 718.428.6776 Milliways 806.794.4362 Demon Roach Underground 815.895.5573 Sycamore Elite 914.761.6877 Uncensored 916.481.2306 Phun Line (NUP) 916.673.8412 Greenpeace's Inverted Granola Bar ______________________________________________________________________________ | | | Books: | |__________| ??? American Flagg - comic Cyberpunk - comic Dirty Pair - comic -- more -- Judge Dredd - comic PIHKAL: A Chemical Love Story Anonymous - Go Ask Alice. Diary of 15 year-old girl in the drug world. - Computers: Crimes, Clues, and Controls. Hacking. Acker, Kathy - Blood and Guts in High School (fiction). - Don Quixote, which was a dream (fiction). - Empire of the Senseless (fiction). - Great Expectations (fiction) Adams, Douglas - The Meaning of Liff (fiction). - The Hitchhiker's Guide to the Galaxy (fiction). - The Restaurant at the End of the Universe (fiction). - Life, the Universe, and Everything (fiction). - So Long, and Thanks For All the Fish (fiction). Aldiss, Brian Wilson - Barefoot in the Head: A European Fantasia (fiction). - Enemies of the System (fiction) Algren, Nelson - Man with the Golden Arm (fiction). -- more -- Army, U.S. - Computer-Related Crime Ashby, W. Ross - An Introduction to Cybernetics Austakalnis, Steve & David Blatner - Silicon Mirage. Vr. Bachman, Richard - The Running Man (fiction) Ballard, J. G. - The Atrocity Exhibition (Re/Search publication) - Crash (fiction). - Concrete Island - High rise Barlow, John Perry - Everything We Know is Wrong (forthcoming). Barnes, Steven - Gorgon Child (fiction) - Streetlethal (fiction) Baudrillard, Jean - The Anti-Aesthetic: Essays on Postmodern Culture (ed.). - Body Invaders: Panic Sex in America (ed.). Bear, Greg - Blood Music (fiction) -- more -- - Eon (fiction) - Eternity (fiction; sequel to Eon) - Beyond Heaven's River (fiction) - Forge of God (fiction) - Great Sky River (fiction) - Psychlone (fiction) - Strength of Stones (fiction) - The Wind Froma Burning Woman (fiction) Beck, Jerome, & Rosenbaum, Marsha - Pursuit of Ecstacy: The MDMA Experience. Bell, Madison Smartt - The Washington Square Ensemble - Waiting for the End of the World Belsito, Peter - HardCore California - Notes from the Pop Underground Benedikt, Michael - Cyberspace: First Steps. Benford, Gregory - Against Infinity Bernal, J. D. - The World, the Flesh, and the Devil -- more -- Bester, Alfred - Computer Connection (fiction) - Golem 100 (fiction) - The Demolished Man (fiction) - The Stars My Destination (fiction) Betanacourt, G. - Johnny Zed (fiction) Bethke, Bruce - Cyberpunk (fiction) - Elimination Round (fiction) Bey, Hakim - T.A.Z. Blankenship, Loyd (Steve Jackson Games) - GURPS Cyberpunk. RPG, guide to CP. Bloombecker, Buck - Spectacular Computer Crimes. Hackers and RISKS and stuff. Bova, Ben - Exiled from Earth (fiction) Bradbury, Ray - Fahrenheit 451 (fiction) Brecher, Edward M. (Consumer's Union) - Guide to Licit and Illicit Drugs. -- more -- Brin, David -Earth (fiction) Brunner, John - The Shockwave Rider (fiction) - Stand on Zanzibar (fiction) - The Jagged Orbit (fiction) - The Sheep Look Up (fiction) - The Stone that Never Came Down (fiction) Budrys, Algis - Michaelmas (fiction) Burgess, Anthony - A Clockwork Orange (fiction). - The End of the World News: An Entertainment. (fiction). Burroughs, William S. - Interzone (fiction) - Naked Lunch (fiction) - Nova Express (fiction) - The Soft Machine (fiction) - Ticket That Exploded (fiction) - The Wild Boys: A Book of the Dead (fiction) - The Third Mind (fiction) - The Yage Letters -- more -- Butler, Jack - Nightshade (fiction) Cadigan, Pat - MindPlayers (fiction) - Indigo (fiction) - Patterns (fiction) Card, Orson Scott - Ender's Game (fiction) Carlisle, Anne - Liquid Sky (fiction) Chambers, Iain - Popular Culture: The Metropolitan Experience (fiction) Cornwall, Hugo - Datatheft. Hacking. - Hacker's Handbook III. Hacking. Cross, Ronald Anthony - Prisoners of Paradise (fiction) Crowley, Aleister - Diary of a Drug Fiend - Magick Without Tears Davis, Douglas - Art and the Future -- more -- Dean, Ward - Smart Drugs & Nutrients. Nootropics, smart drugs. Delany, Samuel - Dahlgren (fiction). - Babel 17 (fiction) - Nova (fiction) DeLillo, Don - White Noise. (fiction) Denning, Peter J. (ed. ACM) - Computers Under Attack. Viruses, Worms, Hackers Denton, Bradley - Wrack'n'Roll (fiction) Dick, Philip K. - Do Androids Dream of Electric Sheep (Blade Runner)(fiction) - Flow My Tears the Policeman Said (fiction) - Vulcan's Hammer (fiction) - Ubik (fiction) - A Scanner Darkley (fiction) Dickson, Gordon - The R-Master (fiction) Dobbs, Bob - Book of the SubGenius -- more -- Dozois, Gardner - Slow Dancing Through Time (fiction) Drexler, Eric - Engines of Creation. Nanotechnology. Eco, Umberto - Foucault's Pendulum (historical fiction) Effinger, George Alec - A Fire in the Sun (fiction). - When Gravity Fails (fiction). - The Exile Kiss (fiction) Eisner, Bruce - Ecstacy: The MDMA Story. Farren, Mick - The Long Orbit (fiction) Faust, Clifford - The Company Man (fiction) - A Death of Honor (fiction) Fjermedal, Grant - The Tomorrow Makers (fiction) Ford, John - Web of Angels (fiction). -- more -- Forester, Tom - Computer Ethics. Hacking, viruses, etc. Foster, Alan Dean - Cyber Way (fiction) Friedman, David - The Machinery of Freedmon. Anarchy. Furst, ??? - Hallucinogens and Culture Gerrold, David - When Harlie Was One Gibson, William - Burning Chrome (fiction) - Count Zero (fiction) - The Difference Engine (with Bruce Sterling)(fiction) - Mona Lisa Overdrive (fiction) - Neuromancer (fiction) - Virtual Light (forthcoming) Gleick, James - Chaos: The Making of a New Science Grof, Stanislov - The Human Encounter with Death. Death, Psychology, LSD. - Realms of the Human Unconscious. LSD, Subconscious. -- more -- Hafner, Katie with John Markoff - Cyberpunk: Outlaws and Hackers...Frontier Hamit, Francis & Wes Thomas - Virtual Reality: Adventures in Cyberspace Harrison, Harry - Make Room! Make Room! (fiction) Harry, ??? - Computer Underground Hattori, Katura - What's Virtual Reality? Hawke, Simon - Psychodrome (fiction) Heinlein, Robert - The Moon is a Harsh Mistress (fiction) - Notebooks of Lazarus Long (fiction) - Stranger in a Strange Land (fiction) - Time Enough for Love (fiction) Helsel, Sandra & Judith Roth - Virtual Reality: Practice, Theory, and Promise Herer, Jack - Hemp & Marijuana Conspiracy: The Emperor Wears No Clothes Hoffman, Abbie - Steal This Book -- more -- - Steal This Urine Test: Fighting Drug Hysteria - Soon To Be a Major Motion Picture - Best of Abbie Hoffman Hofmann, Albert - Insight/Outlook - LSD: My Problem Child Hofstadter, Douglas R. - The Mind's I: Reflections on Self & Soul. Hooper, Judith - Would the Buddha Wear A Walkman? Catalogue of consciousness. Hoy, ??? - Loompanics Greatest Hits Hutchison, Michael - Mega-brain. Consciousness, Brain growth, stimulation. Huxley, Aldous - Brave New World (fiction) - Brave New World Revisited (fiction) - The Doors of Perception. Mescaline encounters. - Ends and Means. Nature of ideals and realization. - Heaven and Hell - Island (fiction) - Moksha. Hallucinogens, religious experiences, visions -- more -- - Perennial Philosophy. Philosophy and religion. Huyssen, Andreas - After the Great Divide: Modernism, Mass Culture, Postmodern Jester, K. W. - Death Arms (fiction) - Dr. Adder (fiction) - Farewell Horizontal (fiction) - Infernal Devices (fiction) - The Glass hammer (fiction) Kadrey, Richard - Metrophage (fiction) Kerouac, Jack - On the Road. Kesey, Ken - Demon Box (fiction) - Further Inquiry. Tales of the Merry Pranksters. - One Flew Over the Cuckoo's Nest (fiction) - Sometimes a Great Notion. Autobiography. Key, William Bryan - Subliminal Seduction - Media Sexploitation - The Clam-Plate Orgy -- more -- Kowalski, Roy - The Science of Virtual Reality and Virtual Environments. Kroker, Arthur, and David Cook - The Postmodern Scene Krueger, Myron W. - Artificial Reality - Artificial Reality II Kunetka, James - nature's End (fiction) Landreth, Bill - Out of the Inner Circle. Hacking. Leary, Timothy - Changing My Mind, Among Others - Flashbacks - Info Psychology - Neuropolitiques - Politics of Ecstacy - Psychedelic Experience LeGuin, Ursula - Always Coming Home (fiction) Lee, Marvin - Acid Dreams: CIA, LSD, and the Sixties -- more -- Lem, Stanislaw - Memoirs Found in a Bathtub (fiction) - Solaris - The Futuroligcal Congress - The Cyberiad - One Human Minute - Fiasco - A Perfect Vacuum - Imaginary Magnitude Levy, Steven - Hackers. Origins of hackers. Lewit, S. N. - Cyberstealth (fiction) - Dancing Vac (fiction) Leyner, Mark - My Cousin, My Gastroenterologist (fiction) - American Made (fiction) - I Was an Infinitely Hot and Dense Dot (fiction) Lilly, John - Center of the Cyclone: An Autobiography of Inner Space - The Deep Self - Programming and Meta-programming the Human Biocomputer -- more -- Ludlow, ??? - Hasheesh eater: The Life of Pythagorean. published in 157! Lyotard, Jean-Francois - The Postmodern Condition: A Report on Knowledge Lyttle, ??? - Psychedelic Monographs and Essays Volumes #1-5 Maddox, Tom - Halo (fiction) Malacalypse the Younger - The Principia Discordia. Church of the Subgenius. Marcus, Greil - Lipstick Traces: A Secret History of the 20th Century McAfee, John - Computer Viruses, Worms....And Other Threats to your System McAffrey, Larry - Storming the Reality Studio. Cyberpunk, postmodern fiction. McDonald, Ian - Out on Blue Six (fiction) McHale, Brian - Postmodern Fiction McKenna, Dennis - The Invisible Landscape -- more -- McKenna, Terence - The Archaic Revival - Food of the Gods - True Hallucinations McLellan, H. - Virtual Reality: A Selected Bibliography. Milan, Victor - The Cybernetic Samurai (fiction) - The Cybernetic Shogun (fiction) Minsky, Marvin - Society of Mind Misha - Red Spider, White Web (fiction) Moorcock, Michael - The Cornelious chronicles (fiction) Moravec, Hans - Mind Children Orwell, George - 1984 (fiction) Otomo, Katsuhiro - Akira -- more -- Palmer, Thomas - Dream Science (fiction) Parker, Don - Fighting Computer Crime Parsegian, V. Lawrence - This Cybernetic World. Cybernetics. Parfrey, Adam - Apocalypse Culture. Pomo/industrialism. Pelton, Ross - Mind Food & Smart Pills. Neuropharmacology. Penley, Constance & Andrew Ross (eds.) - Technoculture Perry, Paul - On the Bus. Story of Ken Kesey and Merry Pranksters and stuff. - Haight-Ashbury: A History Pirsig, Robert - Zen and the Art of Motorcycle Maintenance Platt, Charles - The Silicon Man. Pohl, Frederick - Beyond the Blue Event Horizon (fiction) - Gateway (fiction) - Heechee Rendezvous (fiction) -- more -- - Man Plus (fiction) - The Annals of the Heechee (fiction) Porush, David - The Soft Machine: Cybernetic Fiction Potter, Beverly - Way of the Ronin. Career, vocation changes. Powell, William - The Anarchists Cookbook. Drug abuse, explosives, firearms. Pynchon, Thomas - Crying of Lot 49 - Gravity's Rainbow - V - Vineland Quarterman, John S. - The Matrix. Computer Networks. Rand, Ayn - For the New Intellectual. Philosophy. Ratsch, ??? - Gateway to Inner Space Re/Search - Industrial Culture Handbook. Industrial musicians profiles. - Modern Primitives -- more -- - PRANKS! - Angry Women Rheingold, Howard - Virtual Reality. Cybernetics, virtual reality, simulation. Rucker, Rudy - Software (fiction) - Wetware (fiction) - The Secret of Life (fiction) - masters of Space and Time (fiction) - Spacetime Donuts (fiction) - The 5th Franz Kafka (fiction) - White Light (fiction) Ryan, Thomas - The Adolescence of PI (fiction) Schultes, Richard Evans - Plants of the Gods: Originis of Hallucinogens Shelley, Mary - Frankenstein (fiction) Sherman, Barry - Glimpses of Heaven, Visions of Hell. VR. Shiner, Lewis - Frontera (fiction) -- more -- - Deserted Cities of the Heart (fiction) - Slam (fiction) Shirley, John - Eclipse (fiction) - Eclipse Corona (fiction) - Eclipse Penumbra (fiction) - Total Eclipse (fiction) - City Come A'Walkin' (fiction) - Heatseeker (fiction) - Transmaniacon (fiction) Sieber, Ulrich - International Handbook on Computer Crime Sirius, R.U. & Rudy Rucker (eds) - A User's Guide to the New Edge Spinrad, Norman - Agent of Chaos (fiction) - Little Heroes (fiction) - Other Americas (fiction) - Streetman (fiction) Stafford, Peter - Psychedelics Encyclopedia -- more -- Stang, Ivan - High Weirdness By Mail. Fringes of culture sources. - Three-Fisted Tales of Bob. Subgenius. Starks, ??? - Cocaine Fiends and Reefer Madness. Drugs on film. Stelarc - Obsolete Body Suspensions Stephenson, Neal - Snow Crash (fiction). Sterling, Bruce - Artificial Kid (fiction) - Crystal Express (fiction) - Difference Engine (with William Gibson) - Involution Ocean (fiction) - Islands in the Net (fiction) - Mirrorshades: A Cyberpunk Anthology (editor) - Schizmatrix (fiction) - The Hacker Crackdow - Globalhead (fiction) Stevens, Jay - Storming Heaven: LSD & the American Dream Stoll, Clifford - The Cuckoo's Egg. Hacking. -- more -- Sturgeon, Theodore - More Than Human (fiction) Swanwick, Michael - Vacuum Flowers (fiction) - In the Drift (fiction) - Stations of the Tide (fiction) Swezey, ??? - AMOK Dispatch Toffler, Alvin - Future Shock. Social Change. - The Third Wave. Social Change. Turkle, Sherry - The Second Self: Computers & the Human Spirit Varley, John - The Ophiuchi Hotline (fiction) - Millenium (fiction) Vinge, Vernor - Marooned Across Real-time (fiction) - True Names and Other Dangers (fiction) - Threats and Other Promises (fiction) - The Peace War (fiction) -- more -- Vollman, William - You Bright and Risen Angels (fiction) Wade, ??? - Anarchist's Guide to the BBS Weil, Andrew - Marriage of Sun & Moon: Quest for Unity in Consciousness - Natural Mind: Investigation of Drugs and Higher Consciousness Whole Earth Catalog - Essential Whole Earth Catalog. - The Fringes of Reason. Occultism. - Signal, Communications for the Information Age. - Software Catalog. - Whole Earth Access Mail Order Catalog. Wiener, Norbert - Cybernetics: Control and Communication in Animal and Machine - The Human Use of Human Beings Williams, Walter Jon - Angel Station (fiction) - Facets (fiction) - Hardwired (fiction) - Solips System (fiction) - Voice of the Whirlwind (fiction) -- more -- Wilson, Robert Anton - Cosmic Trigger - Cosmic Trigger 2 - Historical Illuminatus Chronicles The Earth Will Shake Nature's God The Widow's Son - Illuminati Papers - The Illuminatus! Trilogy - Ishtar Rising - Masks of the Illuminati - New Inquisition - Prometheus Rising - Quantum Psychology - Right Where You are Sitting Now - Schrodinger's Cat Trilogy - Sex & Drugs, A Journey Beyond Limits Windling, Terri (editor) - Borderlands (fiction) - Bordertown (fiction) Wolfe, Tom - Electrik Kool-Aid Acid Test. Kesey & Pranksters & Haight-Ashbury. -- more -- Womack, Jack - Ambient (fiction). Terraplane (fiction). Heathern (fiction). Zahn, Timothy - Cobra (fiction) - Cobra Bargain (fiction) - Cobra Strike (fiction) ______________________________________________________________________________ | | | Videos: | |__________| (this is meant to be a broad base of futuristic or trippy movies, and, as in the music category, everyone has their own personal tastes and opinions, and this list would vary from person to person) The Abyss (sci-fi) Aeon Flux (anime) Akira (anime) Alien[s, s^3] (sci-fi) Arise: The Subgenius video -- more -- Altered States (drama/sci-fi) Blade Runner & Director's Cut (science fiction) Bliss (drama) Brainstorm (sci-fi) Brazil (science fiction/fantasy) A Clockwork Orange (science fiction) Computers, Freedom, and Privacy Videos Cyberia on U-Network (music, animation) Cyberpunk (Intercon productions) (documentary) Cyberpunk (animated) Cyberspace, Power and Culture (documentary) Dreamscape (sci-fi/fantasy) Drugstore Cowboy (drama) Dune (science fiction) Hardware (science fiction) Hip Tech and High Lit (?) Jacob's Ladder (drama) Koyaanisqatsi (documentary) The Lawnmower Man (science fiction/fantasy) Liquid Sky (drama/sci-fi) Max Headroom (science fiction) Metropolis (science fiction/pomo) -- more -- eMpTV's Buzz (documentary/soundbytes) eMpTV's Buzz Cut (music) eMpTV's Liquid Television (anime/animated) Naked Lunch (drama) The 90's (Television station/show - documentary) Powaqatsi (documentary) anything by Psychic TV (Genesis P-Orridge) (music) anything by Re/Search (SRI, Modern Prim, etc.) Rocky Horror Picture Show (musical/science-fiction/fantasy) Sid & Nancy (drama/musical) Slacker (docudrama) Sneakers (drama) Star Wars, etc. (sci-fi) 2001 A Space Odyssey (science fiction) 2600's Hacking Video (featured on 'Now It can Be Told')(documentary) Terminal Man (sci-fi) THX 1138 (science fiction) Total Recall (science fiction) The Trip (drama) Tron (science fiction/fantasy) The Wall (musical/docudrama) Videodrome (sci-fi/horror) -- more -- Video Toaster Demo Tape (computer graphics) Virtual Reality 1991 (documentary) Wax or the discovery of television among the bees (email Artist #1 - artist1@rdrc.rpi.edu for info.) Wax Trax Promotional Sampler Video (music) War Games (drama) Woodstock (documentary) ______________________________________________________________________________ | | | Music: | |_________| (music is music and you like what you like, but here is a list of trippy or futuristic oriented groups.....Undoubtedly you will argue with my categorizations and selections, but each person has their own tastes and preferences and opinions, so please don't make a big deal out of it... Obviously this list is by no means definitive - that truly would be impossible, but it should be enough to get you started in the right directions....) Classic/Classic-Progressive/Progressive/etc. -------------------------------------------- Allan Parsons Project -- more -- The Black Crowes David Bowie Can Clash The Doors Electric Light Orchestra Emerson, Lake, & Palmer Grateful Dead Jimi Hendrix King Crimson Led Zeppelin Marillion Gary Numan Phish Pink Floyd Police Primus Queensryche Ramones Red Hot Chilli Peppers Rush Smashing Pumpkins -- more -- Patti Smith Talking Heads Thin White Rope The Velvet Underground Violent Femmes Tom Waits War Ween Neil Young (the unrelease cp/computer-experiment thing he did awhile back) Yes Frank Zappa DJ's/Mixers/etc. ---------------- The Beatmasters Joey Beltram Frankie Bones Jim Cauty (KLF) DNA Terry Farley Frankie Knuckles -- more -- Graham Massey (808 State) Mayday Dave Morales Tommy Musto Paul Oakenfold Steve Osborne Dr. Alex Paterson (the Orb) Renegade Soundwave Evil Ed Richards Mark Ryder Thrash (the Orb) Andrew Weatherall Industrial/etc. --------------- Bigod 20 Braindead Sound Machine Cabaret Voltaire Chris & Cosey ClockDVA Consolidated -- more -- Cop Shoot Cop Cyberactif Einsturzende Neubauten Extreme Noise Terror Foetus Front 242 Frontline Assembly Edward Ka-spel KMFDM Legendary Pink Dots LFO MC 900 Ft. Jesus Meat Beat Manifesto Ministry Moev My Life with the Thrill Kill Cult Nine Inch Nails Negativland Nitzer Ebb 1000 Homo DJ's Pigface Psychic TV -- more -- Renegade Soundwave Rise Robot Rise Skinny Puppy Test Dept. Throbbing Gristle Wolfgang Press Manchester/Madchester/Overground Dance/Shoegazer/etc. ----------------------------------------------------- Art of Noise Beloved Blur Breeders Carter: The Unstoppable Sex Machine Chapterhouse Charlatans Curve Depeche Mode Happy Mondays Information Society Inspiral Carpets -- more -- James Lush Moose My Bloody Valentine Ned's Atomic Dustbin Primal Scream Ride Slowdive Soup Dragons Stone Roses Swervedriver Wedding Present New Age/Experimental/Experimental Jazz/etc. ------------------------------------------- Laurie Anderson Cocteau Twins Dead Can Dance Brian Eno Michael Hedges Kitaro -- more -- Tangerine Dream Gary Thomas Vangelis Punk/Thrash/Hardcore/Grindcore/Harder stuff/etc. ------------------------------------------------ Agent Orange Agnostic Front Bad Brains Beat Happening Black Flag Dead Kennedys Dinosaur, Jr. Fear Firehose Fugazi Godflesh Gwar Hanoi Rocks Head Candy Helmet -- more -- Husker Du L7 Melvins Napalm Death Paleface Pavement Public Image Limited Residents Rollins Band Sex Pistols Social Distortion Sonic Youth Think Tree Voivod Rap/Hip-Hop/etc. ---------------- De La Soul Disposable Heroes of HipHoprisy PM Dawn Public Enemy -- more -- A Tribe Called Quest Urban Dance Squad Reggae/Ska/Dancehall/Jamaican/etc. ---------------------------------- Aswad Bob Marley Ziggy Marley Jacob Miller Peter Tosh Yellowman Techno/Rave/Club/Underground Dance/House/Amibent House/etc. ----------------------------------------------------------- [Note: for the sake of space, techno compilation albums have been removed. However, you should know that many such cds exist, and are a good place to start in techno music] Altern8 Aphex Twin -- more -- Baby Ford Bass-o-Matic Blue Pearl Candy Flip Gary Clail / On U-Sound System Dee-Lite 808 State Enigma Eon Fini Tribe Fortran 5 Fuse Future Sound of London Boy George (Jesus Loves You / Martyr Mantras) The Grid A Guy Called Gerald Hypnotone KLF Kraftwerk LFO Lords of Acid Moby -- more -- Mr. Fingers Nexus 21 New Order N-Joi Orb William Orbit Orbital Quadrophonia S-Express Shamen Space St. Etienne Sun Electric System 7 T99 Voodoo Child World of Twist ______________________________________________________________________________ | | | Drugs: | |___________| -- more -- (*NOTE* - This is provided for informational purposes only. I do not necessarily condone the use of these drugs. I sincerely suggest you do a lot more thurough research if you plan to use any of the substances listed below. Much of the information was obtained through the FAQs from alt.drugs - Please check out the alt.drugs archives on ftp sites, where available - 2 ftp sites containging more thurough and accurate drug information are listed in the FTP section of this article) [MAO Inhibitors - When using an MAO Inhibiting drug, don't ingest anything that contains potentially dangerous amines - could produce awful, deadly side-effects. MAO Inhibitors: sedatives, tranquilizers, antihistamines, narcotics, alcohol, amphetamines, mescaline, asarone, nutmeg, macromerine, ephedrine, dill/parsley/wild fennel oil, cocoa, coffee (caffeine-high substances, aged cheese, and tyrosine-containing foods] Nootropics/"Smart Drugs" ------------------------ Centrophenoxine (Lucidril) -anti-aging effects -intelligence booster Choline -- more -- -aids in production of acetylcholine DHEA -anti-aging -appetite suppressant -protects neurons from senility degenerative conditions DMAE -assists in some aspects of memory -increases acetylcholine levels Gingko -blood vessel dilators Hydergine (Ergoloid Mesylates) -increases blood supply, oxygen to brain -reduces tired, dizziness -normalizes systolic pressure -increases intelligence -improves mental function -enhances brain metabolism L-phenylalanine -antidepressant -stimulate's the release of your body's appetite-suppressants -improves memory and mental alertness -may increase sexual interest -- more -- -do not use with MAO inhibitors -amino acid Phenytoin (Dilantin) Piracetam (Nootropyl) -cognitive enhancer -memory improver Propranolol Hydrochloride (Inderal) Sulbutiamine (Arcalion) -improves long-term memory -facilitates wakefulness -speeds reaction time -decreases anxiety Vasopressin (Diapid - Nasal Spray) -helps learn new memories (??) -improves attention, concentration, recall -helps clear your mind when under the influence of other substances Marijuana & alcohol inhibit the release of vasopressin Cocaine, LSD, Amphetamines deplete vasopressin (if you use illegal 'non-smart' drugs, you might want some of this) Vincamine (Oxicebral) -aids in alertness -- more -- -increases activity Vinpocetine (Cavinton) -memory enhancer Xanthinol Nicotinate Psychedelics/Hallucinogens/Empathenogens/Etc. --------------------------------------------- Hawaiian Baby Woodrose Seeds -usage: 4-6 seeds from a seed pod -eat on empty stomach after removing coating -nausea likely -similar to LSD with less visual effects, 6-8 hrs. LSD -lysergic acid diethylamide-25, acid, cid, sid, lucy in the sky, sugarcubes, blotter, tabs, microdots, windowpaine, etc. etc. -causes hallucinations, altering/distortion of vision, auditory, time, enhancement of sensations, motor difficulties, loss of concentration or consistent thought, pupil dilation (or opposite) -not physically addictive, can be psychologically, though -trip usually averages around 8-12 hours -post-usage effects may include insomnia, jitters, temporary/permanent psychosis, flashbacks, permanent trails, nausea -- more -- -usage: taken orally or licked, usually on blotter paper, sugarcubes, jello, dropper, also eyeballs -strychnine rumors/myths persist -dosage is usually unknown -150-200 mics usually induces heavy trip -those with heart/physical problems, low tolerance should avoid -set (your idea of what the drug will do / mood) and setting (where you are and who you're with) have a _lot_ to do with the outcome of what LSD does. First time trippers should trip only with people they trust that have tripped before, and in a place where unexpected "bad" things will not happen (police come in, parents, etc). Tim Leary has lots of info on what could be done. Reading his books can only help. Marijuana -cannabis, pot, weed, mj, mary jane, etc. etc. -consumption: joints, bongs, pipes, hash brownies, tea, etc. -produces some distortions, feeling of happiness -when stoned, your eyelids become heavy -we don't really need much more info, do we? Morning Glory Seeds (Ipomoea) -arborescens, carnea, costata, leptophylia, meulleri, murucoides, purpurea, violacea -usage: 5-10 grams -- more -- -consumption: orally, grind/soak/strain & drink, sprout by soaking -most are chemically treated - can induce nausea, vomiting, diarrhea -effects: trip-like but less hallucinogenic than lsd, 6 hours, less intense MDMA -ecstacy, X, E, XTC -empathenogen -like a combo of LSD and Speed (the 'MA' is methamphetamine, mind you) -effects similar to LSD, little or no visual hallucinations auditory/visual/time perception altered, sensations increased, extreme emotional awareness, trips average around 6 hours -XTC many times cause the user to "love" everything. Beware of taking X with people you know little about. (You may end up giving your car keys to your worst enemy). Any touch to your skin (in a sexual sense) feels like heaven, even though sex may be impossible. -usage: pills, caplets, in water -street stuff may contain many different varieties of different substances -much debate over toxicity and neuro-toxicity -set and setting are extremely important, as with LSD -long-term use can result in liver damage Mushrooms (Psilocype) -- more -- -Baeocystis (potent), caerulipes (blue foot), coprophila (dung-loving) cubensis (common large), cyanescens (bluing), pelliculosa (conifer) semilanceata (liberty cap), stunzii (stunz's blue legs), amanita muscaria (fly agaric), conocybe smithii (bog conocybe), gymopilus spectabilis (big laughing gym) -never ingest unless positively identified by a mycologist to be non-poisonous -effective dose of dried mushrooms: 1 gram (one or two whole shrooms) -best taken on an empty stomach -consumption: orally, smoked, tea (water + dried fragments) -effects: trip lasting 6 hours or so, more visual & less auditory than LSD, alters sound-perception though not as radically as LSD -physical effects: liquid breathing, headache -effects occur quicker, generally, than with LSD Nutmeg -usage: 5-20 grams of freshly ground -effects: heavy buzz, promotes lethargy, sleep, nausea, dry mouth, pupil dilation Yohimbe bark -usage: 6-10 teaspoons of shaved bark boiled in water & drank can also be smoked -effects: aphrodisiac (supposedly), perception changes (mild) -- more -- lasts 2-4 hours, insomnia, nausea possible -rumored to cause longer-term erections in men. cool. ______________________________________________________________________________ | | | Merchandise/Companies: | |__________________________| Abbie Yo-Yo Inc. PO Box 15 Worcester, MA 01613 -things related to Abbie Hoffman Albert Hofmann Foundation 8683 West Pico Blvd. Mailbox #107 Los Angeles, CA 90035 310.281.8110 (voice mail) -"an international library for the scientific study of psychedelic substances and human consciousness" Ameba 1732 Haight St. San Francisco, CA 94117 -- more -- 800.292.6322 -Rave clothes and stuff Amok PO Box 861867 Terminal Annex Los Angeles, CA 90086-1867 -hard to find/underground books catalog is a whopping $9 (400 pages) Autodesk, Inc. 2320 Marinship Way Sausalito, CA 94965 -makers of Chaos software. $59.95 Autonomedia 55 Sotuh 11th Street NY, NY 11211 -edge/post-modern publishing company Kevin Begos, Jr. Apartment #4d 1411 York Ave -- more -- New York, NY 10021 212.650.9324 -Agrippa: A Book of the Dead -$450 - $7,500 Berkeley Designs 2615 Shasta Rd Berkeley, CA 94708 510.549.0129 -sells t-shirts with fractal and cyberpunk designs (90's tie-dye's) send a SASE Books by Phone Box 522 Berkeley, CA 94701 800.858.2665 (orders) 510.548.2124 (info) -large library of hard-to-find books related to CP, drugs, etc. nice resource, but you pay a lot for it :-) Church Of SubGenius PO Box 140306 -- more -- Dallas, TX 75214 The Computer Lab Rt 4 Box 54C Louisa, VA 23093 800.562.1638 -the well-known 5.5meg HyperCard stack Beyond CyberPunk, $29.95 Consumertronics 2011 Crescent Dr. PO Drawer 537 Alamogordo, NM 88310 505.434.0234 500.434.0234 (fax - orders only) -hacking/phreaking manuals Cyberpunk Books Prince St. Station PO Box 96 NY, NY 10012 -write for a list -- more -- The Electronic Frontier Foundation, Inc. 155 2nd St. Cambridge, MA 02141 617.864.1550 (voice) 617.864.0886 (fax) eff@eff.org -group protecting your rights on-line Further Connections Waves Forest PO Box 768 Monterey, CA 93940 -fringe science InHome Health Services Box 3112 CH-2800 Delemont Switzerland -nootropics Interlab BCM Box 5890 -- more -- London WC1N 3XX England -nootropics Timothy Leary Box 69886 LA, CA 90069 Loompanics, Ltd. PO Box 1197 Port Townsend, WA 98368 -carries a large collection of underground/hard-to-find books and stuff -send for a catalog Lord Nose! PO Box 170473M San Francisco, CA 94117 -Xochi Speaks poster & Guide to Psychedelics available for $25 Mark Ziesing Books PO Box 76 Shingleton, CA 96088 -- more -- 800.869.0348 916.474.1580 -mail-order cp/sf book service -send $1 for a catalog -recommended by top cp authors/luminaries Media Magic PO Box 507 Nicasio, CA 94946 415.662.2426 -books, videos, merchandise related to vr, cyberspace Nettwerk Records Attn: Mail Order 1755 Robson St. Box 330 Vancouver, British Columbia V6G3B7 -record company NewTek, Inc. 215 SE 8th St. -- more -- Topeka, KS 66603 800.843.8934 -makers of the Video Toaster -send 'em $4.95 for a demo tape of what the Video Toaster does Nutrient Cafe Wholesale PO Box 170156 San Francisco, CA 94117-0156 - high tech nutrient mixtures ...of the jungle PO Box 1801 Sebastopol, CA 95473 -legal highs and such Ono-Sendai Corporation 332 3rd Avenue, San Francisco, CA 94118-2403 415.387-OSVR. osendai@well.sf.ca.us -information on _affordably_ VR systems. -the people advertising in Mondo 2K, pg 7 (issue #7) -- more -- Paladin Press PO Box 1307 Boulder, CO 80306 -obscure books Re/Search Publications 70 Romolo Street #B San Francisco, CA 94133 -underground/fringe subject matter magazine publications -sex, cyberpunk, industrial and alternative lifestyles Spectrum Dynamics 2016 Main St. Ste #1207 Houston, TX 77002-8843 -vr merchandise/products -20pg catalog is $15 SST Records PO Box 1 Lawndale, CA 90260 -send for catalog -- more -- STZ Corporation PO Box 22 Monmouth, Gwent NP5 3XU United Kingdom -rave t-shirts and clothing Sub Pop Mail Order 1932 1st Avenue #1103 Seattle, WA 98101 -send for catalog Sudona, Desktop Computing for Women's Health 2118 Guadalupe, Suite 195 Austin TX 78705 1 800 488 6335 donna@well.sf.ca.us -Menstat(tm)2.0...First desktop software to track and estimate menstrual cycles.. TOPYUS (Psychic TV) PO Box 18223 -- more -- Denver, CO 80218 -Genesis P-Orridge's Psychic TV -send a SASE for info on Psychic TV, catalogs, albums, t-shirts, videos, books, etc. VPL Research, Inc. 950 Tower Lane Foster City, CA 94404 -Jaron Lanier's famous virtual reality firm Wax Trax Records 1659 North Damen Avenue Chicago, Illinois 60647 312.252.1000 312.252.1007 (fax) -send SASE for catalog Zentech Box 138 Morgan Bay Rd. Surry, ME 04684 -cyberpunk, virtual reality merchandise -- more -- _____________________________________________________________________________ | | | see ya! | |___________| Welp, that looks like it for now. Have fun! Many thanks go out to the masses who have added their suggestions, too numerous to mention. But an extra-special thanks to Bruce Sterling and Steve Brown of SF Eye for being *extremely* helpful with suggestions, comments, and info! Many thanks go out to Strider (Steve White) for editing this file, as well as Anne Balsamo for providing a very useful, wonderful bibliography. Final Hellos to: the nameless masses. (yes, you!). And all those living on the edge of the future, and to all those working to protect cyberspace from the fascism that now threatens it. And everyone else. :-) Again, if you have any questions/comments/concerns/criticisms/corrections or any additional info, please contact me at ahawks@nyx.cs.du.edu. _______________________________________________________________________________ -- more -- -- ahawks@nyx.cs.du.edu FutureCulture E-List: [future-request@nyx.cs.du.edu] andy (hawkeye) new edge, technoculture, cyberpunk, virtual reality, raves, etc. Home of the famous :) FutureCulture FAQ! Current Directory: [Archives/Cyberpunk/FutureCulture] [Archives]: Current Directory: [Archives/Cyberpunk/FutureCulture] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberpunk] [Archives]: Directory: * FAQS < DIR > 8-Jan-93 FutureCulture < DIR > 8-Jan-93 Journals < DIR > 10-Jan-93 Misc < DIR > 16-Mar-93 Current Directory: [Archives/Cyberpunk] [Archives]: Change Directory: Misc Current Directory: [Archives/Cyberpunk/Misc] [Archives]: Directory: * Crossbows.to.Cryptro 28648 18-Nov-92 Cyberterm.doc 31566 19-Nov-92 David.Moran.News 15112 18-Nov-92 EFFector3.06 25146 18-Nov-92 HWbEmail.v11 37759 18-Nov-92 Maddox.txt 12571 18-Nov-92 Mindvox.Overture 66115 18-Nov-92 OnoSendai 2757 18-Nov-92 PCVR 1577 18-Nov-92 SRL 5862 18-Nov-92 Startrek.vr 7591 18-Nov-92 Stelarc.cyberhuman 7318 18-Nov-92 Sterling.txt 19292 18-Nov-92 VR.ftpsites 1314 18-Nov-92 WAX 8196 18-Nov-92 hrgiger.bibliography 10428 18-Nov-92 technomads 3059 18-Nov-92 Current Directory: [Archives/Cyberpunk/Misc] [Archives]: View: Cyberterm.doc Following is the document I promised a while back on the system I am developing. I have received many requests for this data so here it is (a little incomplete or it never would have been posted). I'm emailing copies to those who requested it and will be in touch with programmers who said they were interested (see later). --------------------------------------------------------------------------- OSC Open System Cyberterm THIS DOCUMENT This document is an overview of ideas and concepts that have evolved over the last year or so. It is not meant to comprehensive, exhaustive, complete or fixed. Any items mentioned herein are open for discussion and modification through arbitration (ie if you've got a good idea, tell me and we'll use it!). Criticism is most wellcome as this has chiefly been only a two person project with various input from 1/2 dozen others. Arguments and pointers from others would be gratefully received. The first part of this document discusses some broad ideas and then -- more -- gives a brief description of the terms used. Following this is a 1/2 technical discussion on a walk though of some aspects of the system. After that a more detailed examination is made of the various terms described briefly earlier and finally a look at other, less related topics is covered in cursory fashion. After all that a brief description of the software as it stands is given, along with projected milestones and pleas for technical/programming assistance. This document mentions many ideas and concepts that stem from the use and implementation of the underlying protocols. This paper discusses broad uses of the protocols and the resulting system rather than focusing on the protocol itself. The reason for this is two-fold: 1) The protocol by itself would seem pretty meaningless without describing how it works and how its resulting use affects the dynamics of a system, and 2) The protocol isn't firmly set. As the system is developed, more holes are found and things change. There are 1 dozen or so basic messages and a dozen or so rules that are followed, but these are in flux. -- more -- It is hoped that this paper will give readers some familiarity with the type of system that is beeing aimed for. A later paper, covering the nitty gritty may be produced, but the detailed explanations may be left to the source code itself when it is released. Having read this discussion first, users and programmers will be in a better position to criticise and aid in the systems development (by discussion and programming support). Note: Where possible I have put terms in capitals which refer to concepts/objects whichare peculiar to this system. This is to try to differentiate items when using English to describe some ideas etc, to make things a bit clearer. SYSTEM OVERVIEW The need for a low cost, low bandwidth cyberterminal (CYBERTERM) has arisen due to the increasing need to communicate over existing data channels with existing hardware. The system is aimed for widespread use -- more -- over a number of platforms and data connections. Initial release is planned for late '92 in a shareware format with full source code for all available systems. INTERFACE The interface is simply using the screen with the keyboard and mouse to provide a window view into a cyberspace area. As source code will become available. The addition of Power Glove, HMD and other devices will be encouraged but not initally supported and will not be required. The nature of the system will be such that if you have a PC XT with hercules graphics then you can display only wire frame at 1 frame per second (or whatever the software can manage). If you have an Indigo or similar then you are lucky enough to be able to display 30 frames a second, solid or rendered. The idea is that all the different systems will be able to be functionally connected together in a meaningful manner. If you have a full body suit, lucky you and you get better integration into the cyberspace etc etc -- more -- etc. What this all means is that the code has a central communications core that is common to all modules on all systems. The interface business is merely a variable front end. All systems will use the same messages etc to communicate, but the low end users' systems will not request the extra data and will not be capable of producing some messages. (eg if you don't have a mouse then movenment is via keyboard. If you have a Data Glove then movement can be via gestures). INITIAL SYSTEM The system will initially be designed around a PC, with Amiga and X11 (on a Sun IPC) mods being made as we go, but with no special provisos for these machines at this point. Software is currently being written and a beta version will be available in a few months (now is May '92). Release will be via request to selected users for immediate feedback, followed by general shareware release. -- more -- SYSTEM ARCHITECHETURE The whole nature of the cyberspace is controlled by the messages that are sent, which abstractly define the rules for objects, clients etc within the cyberspace. To more clearly describe the nature of these rules and messages, a number of terms have been borrowed and coined to describe new/borrowed concepts. Once these terms are defined, then it becomes much clearer as to how the whole thing fits together and the interaction of objects and the nature of this interaction will become evident as you understand the rules and contraints which define the behaviour of the cyberspace. DEFINITIONS These definitions are brief and are given to allow a fuller understanding of the descriptions to follow. A more detailed discussion of these terms will follow later. CLIENT -- more -- A CLIENT is the term to describe a person (USER) who is connected to a system. The CLIENT may be automated (an AGENT). SERVER A SERVER is the central message handling facility which handles the data flow between CLIENTS. (A bit like a BBS) LOCAL SERVER (LS) A LOCAL SERVER is a SERVER that resides on the same machine as the CLIENT. REMOTE SERVER (RS) A REMOTE SERVER is not at the same physical machine as the CLIENT in question. CYBERTERM (CT) This is the term to define the CLIENT and the LOCAL SERVER together which a USER -- more -- interfaces to. This all resides on his local machine. SECTOR A SECTOR is a region of CYBERSPACE which is controlled by a single SERVER. SECTOR CONTROLLER (SC) This is another term for the SERVER, but which covers the CLIENT that is local to that SERVER (akin to a News conference moderator or a BBS sysop). PERMASPACE (PS) PERMASPACE is an area of the SECTOR which has been allocated to a specific purpose. The data defining this region resides in the SC which controls the SECTOR. PRIVATE PERMASPACE (PPS) PERMASPACE can belong to a single CLIENT (or else it belongs to the SC). If a -- more -- USER acquires a region of a SECTOR for their own use, that region is called PRIVATE PERMASPACE and is controlled by the owner CLIENT's LOCAL SECTOR CONTROLLER (ie the SERVER which resides on their own machine). LINE A LINE is the connection from the SERVERs to the CLIENTS, LINEs can be virtual or real. AGENTS AGENTS are macros that use the messages and protocols of the system to perform tasks as the USER himself would. There are 3 types of AGENTS defined so far. PRIVATE AGENTS, SC AGENTS and INDEPENDENT AGENTS. ASPECT ASPECT is the description of an OBJECT and covers visual and audio definitions in an extensible hierarchy of increasing complexity. All objects have default ASPECTs. CYBERSPACE CONFERENCING (CBC) -- more -- This is the initial "let's get together and have a chat" aim of the system and is useful when people ask "So what are you working on?". You say, "I'm working on a Cyberspace Conferencing system", or something like that. GUEST A GUEST is a CLIENT who is remote to your location who is connected to your LOCAL SERVER. BBS A bulletin board system, which when in "chat" or "conference" mode is a good analogy for what this system will build upon (ie a graphical version of a BBS CB channel.) OBJECTS OBJECTs are any things which exist within a SECTOR and and listed in a SERVER database. This includes CLIENTS, AGENTS, PERMASPACE etc. -- more -- ID ID applies to AGENTS, CLIENTS and SERVERS. It is a unique 4 byte number where the top 4 bits define what type of object the ID belongs to. FAR - 1,000 units NEAR - 100 units CLOSE - 10 units VERY_CLOSE - 1 unit (ie 26 adjacent units) A DEMONSTRATION RUN THROUGH Perhaps the best way to show how the various features of the system interact is to give a description of a typical session. This description will not be exhaustive and will give some technical details of the message passing that will take place during such a session. A complete description of all the features will not be given here as that would take too long and this is only meant to be an overview. However, what I hope is to be able to give some insight into what the working system will be like. -- more -- So here we go. (by the way this description is of a screen and keyboard system, but as stated above, you can use whatever hardware/imagination you have available) First off when you start up the CYBERTERM you have a blank screen with maybe a few control buttons around the edges. The first step is to log into the LOCAL SERVER. Now this is a SECTOR CONTROLLER that resides on the same machine and in the first incarnation of the software is all in the same executable. This connection is done by hitting the 'connect' key (or mouse button etc). This will send a REQUEST_TO_ENTER message to your LOCAL SERVER, but first the interface will require that you enter some parameters. These are: 1) your proposed entry point into the LOCAL SECTOR, and 2) the proposed viewing direction. -- more -- In a more advanced system these parameters will probably be pre-set in an option menu so you don't have to enter these details each time, but that's the way it is now (Note: There are quite a few places where things can be pre-set like this, as you'll see). Once the CLIENT software has assembled this data it sends the message to the LOCAL SERVER prepended by your ID, a unique identifying code (4 bytes) that defines you as a human CLIENT as well as giving you a unique handle for reference purposes. An additional parameter, velocity, is set to zero and is the final part of the message. The connection between the CLIENT and the LOCAL SERVER is a buffer that emulates a LINE. A daemon type function transfers the message across to the SERVER's input (and visa versa). The reason this is done is so that the software for a REMOTE SERVER and the LOCAL SERVER will be the same, except that the daemon will be different (ie transfering data to and from a modem, serial line, socket, -- more -- or whatever). So as far as the SERVER is concerned it is running autonimously from the CLIENT and the human interface handling software. The SERVER checks its internal database of objects to see if you are allowed to enter at the specified point (more on that in a moment) then sends a MOVE_TO message back to the CLIENT. This includes the CLIENT's ID to make sure the right person gets the message (not necessary obviously as you're the only one logged into your machine), a location tuple, a direction tuple and a velocity tuple (which is zero in this case). Now it looks like we're already sending redundant information, but these are generic commands that can apply to many situations. You CLIENT software now gets this MOVE_TO message and can throw up an image on the screen which shows what the SECTOR looks like from this point. What's there to display? Well by default the 'floor' of the sctor is blue and can be displayed as a grid. The range of co-ords is 2**16 (32768) only positive, as a 32 bit fixed decimal number. This effectively gives a cube 32768 units on a side. That seems small but think of each unit as one metre. This means the SECTOR is about 32kms cubed, with increments down to 1/30 mm. I really think this will cator -- more -- for system (and user) requirements for a long time to come. There is room for much more detail than this actually (2**32 time more) as is shown later under PRIVATE PERMASPACE. Okay, so we see a blue grid below us. Our CLIENT software is keeping track of our velocity and co-ords at the last vector change (ie time stamped) in its internal object database (this is separate from the SERVER's object database). So a simple look at the time and a scan of the database will give the current location of all objects and the screen can be updated accordingly. If your machine is slow this screen update is slow etc. Now that you're logged into the LOCAL SERVER things get a bit more interesting. To make things a bit clearer I'll skip over the details a bit here and get to a remote connection. Suffice to say that the objects contained in the LOCAL SERVER all belong to your PRIVATE PERMASPACE. There may be objects here, for instance that represent your hard disk and so you may have a graphical operating system where you can move files, launch applications etc. You can construct objects and store them for later use. Certain areas may be defined as dorrways to the control of real-world apparatus by telepresence etc. So -- more -- you now have your own SECTOR, a whole world really, in which to create and move. Now all this on your own machine is nice but dull. The next step is to send a TRANSFER_SECTOR command. This will move you to another SECTOR. This will obviously be a REMOTE SECTOR. It's up to you to specify a legal SECTOR you wish to transfer to and it's up to your LOCAL SECTOR CONTROLLER to know how to connect to the SECTOR. Asumming all this has been set up your LOCAL SC (for modem) dials up the remote SC and identifies itself as an SC that has a CLIENT that wants to enter. This is sent as a REQUEST_TO_ENTER command (as before). Your CLIENT software knows that to issue a TRANSFER_SECTOR message you must enter a location and view direction so it prompts you for them (or gets it from pre-set options as before). The local SC passes the info on to the remote SC. If the request message is okay, a MOVE_TO command is sent from the remote SC to the local SC which now knows that any data coming in from the CLIENT (on LINE x) is transfered straight to the remote SC (on LINE y) and visa versa. Now that your CLIENT software has a new location and viewdirection it adjusts it's internal object database and updates the screen accordingly (the blue grid). -- more -- When you entered the SECTOR the SC sent a message of its own to all other users who are within NEAR (100 units) of where you entered. These messages say what your ID is, your vector and location (this is actually a PERSONAL_ASPECT_DATA message which has ID, vector and location in the front of the message but without the ASPECT data as the SC doesn't have this yet). These other users may have their systems set up to ignore these (unexpected) messages, but if they process them then you, the new user, will appear on their screens in the appropriate place and will be placed in their individual object databases. They may also have a database of 'know ASPECTS' and can check to see if they already know what you look like and so can display you in your full glory straight away. Alternatively they may have their system set up to automatically request your APSECT if it is unknown and to display it then. Anyway, you've just entered this REMOTE SECTOR. Now you can send a message (or a more sophisticated system would be pre-set) to ask the REMOTE SC what the brief details are of all users within NEAR of your location (that is, to send you PERSONAL_ASPECT_DATA messages with ID, vector and direction). This data is added into your -- more -- CLIENT's object database (with a time stamp) and the objects appear on your screen with the default ASPECT. You can request the details of other users over different distances first off if you like. Once you know the ID of other users you can REQUEST_ASPECT_DATA of a specific ID, to whatever level of detail of ASPECT the REMOTE SC has in it's database. So on your screen these other users appear as arrows (their default ASPECT) or their real shape. When you move (that is, change your velocity or direction) your CLIENT automatically sends a message (MOVE_TO) to the SERVER. If this is okay by the SERVER then it sends a MOVE_TO message to you telling you where to move to (the reason for this is made clear later) and then the SERVER distributes the message to all NEAR CLIENTS. In this way, as you watch your screen with these objects moving around in straight lines until they change vec/vel when you get a message from the REMOTE SC telling you their new velocity/direction. If you turn around your system sends a MOVE_TO message that is distributed and others see your shape turn around etc. It is important to note that there is no collision control and it is quite possible for you to move straight through someone else. (Note: The only possible exception to this is stopping over a PERMASPACE -- more -- unit you do not own (see later) or the possiblity that two CLIENTS cannot be at the same point at the same time. There is no logical reason why this could not be so, it's just that it doesn't see right to me. Being instantaneaously at the sam epoint is okay, (ie moving through each other), but being stationary at the same point? Comments please.) An optional message that you can send to the SC is CHANGE_UPDATE_RATE which tells the SC how often to send you location, vel and vec updates of all CLIENTS within a given distance of yourself. Normally you would have to request this information specifically and the position of users you see on the screen may be false (for example a user may drift out of the NEAR distance from you but your object database is still tracking them saying they are moving at such and such a vector and speed when actually they may have changed direction etc. So with a CHANGE_UPDATE_RATE message you can request to be updated on the stats of users who are NEAR or FAR or whatever say every 10 seconds. Of course if they move when they are within NEAR of you then you will be automatically updated anyway). So now you can sit and watch these shapes going by. Other commands within a SECTOR are SEND_MAIL, JUMP_TO, REQUEST_SECTOR_TRANSFER etc. -- more -- Similarly to requesting the ASPECT of users in the area, you can request the ASPECT of PERMASPACE in the area. PERMASPACE is permanaent regions that default to blue. These will usually consist of PRIVATE PERMASPACE but some regions may be owned by the SC such as public database access areas and public bulletin boards (more on these later). Just like CLIENTS, PERMASPACE has a default ASPECT that is a blue cube that occupies the unit cube that is the centre of its local co-ordinate space. Requests for higher level ASPECTS may reveal these cubes to be buildings, flashing lights or data structures etc. A PRIVATE PERMASPACE ASPECT may reveal that it belongs to a friend of yours. (It may his name on top or maybe you recognise his style of castle!) You can move through PERMASPACE but you CANNOT stop (ie have 0 velocity) when in a unit cube of PERMASPACE which does not belong to you. -- more -- So you stop one unit away (VERYCLOSE) and send a REQUET_TO_ENTER_PRIVATE_PERMASPACE. This is interpreted by the SC as a TRANSFER_SECTOR message, to the LOCAL SERVER of the user who owns that PP. If the request is okayed by the owner then you are sent a MOVE_TO message that moves you to the coords of the PP. Now you have transfered to a new SECTOR and are controlled by the owner's private SC on his machine. The remote SC you were controlled by now routes all your data straight to the LINE that that new SC is on. (in a similar way to how your LOCAL SC is re-routing all your data straight through to the modem). Once again your screen is blank and you can request to see what's around you. This person may have his SECTOR set up to look like a lounge room or as rolling hills. All messages from users who you could see before (ie those outside that unit cube of PP that you're in) are filtered out to reduce bandwidth required (you may, for instance want to keep mail coming through. If you have a powerful system you may still get all 'outside' messages but make the walls of the living room appear transparent like smoked glass etc). Now that you are in his SECTOR you must abide by his rules. If you send -- more -- a MOVE_TO message that will make you collide with object in his PP (eg a chair or wall) then his sector can return okay for that request, but when it calculates that you've hit a wall, it can send an addittional MOVE_TO message that sets your velocity to zero. In this way you must follow the rules he has set up in his PP. Obviously if he proves to be obnoxious you can send a EXIT_SECTOR message that the main REMOTE SC intercepts and so moves you back out into public cyberspace, garuanteed. Other users can enter the PP of your frined at the same time so you can have a 'private conference with only those present'. At that time his LOCAL SC daemon has set up secondary virtual LINES to allow the messages from several remote CLIENTS to come down the one modem connection. As each message is preceeded by the message senders ID, it's a fairly simply task fo rthe daemon to put the incoming messages into the appropriate virtual LINE buffers so the SC thinks there are lots of people/modems connected up. Of course, the main remote SC may also provide private conference rooms where similar duscussion can take place. This PP may alternatively be the front end to access a commercial -- more -- database, a game service, a ticket sales office etc. So you want to establish your own PP within the public SECTOR? You send a REQUEST_TO_AQUIRE_PRIVATE_PERMASPACE message that is sent via the SC to anyone who is CLOSE to you (within 10 units). If less than 50% of those nearby say 'no' to the SC then you aquire 1 unit of PP and this is registered in the SC's object database. You can optionally send PERMASPACE_DATA messages to the SC that define the ASPECT of your PP to whatever level of detail you desire so others can see your new aquisition. Clearly, you can aquire several PP units next to each other and build up a composite structure that is more impressive. This aquisition is monitored by the SC and there may be limits defined. Some reqions of PP that belong to commercial users may be large (eg a database service for stock information may have a large area of PP that (when you request to see higher level aspects) may be large building surrounded by wide grass areas with fountains and gardens). Maybe there would be large areas within the owned PP that has no higher ASPECT so that in a crowded area of many PPs the structure will stand out as it has all this 'open' space around it. -- more -- You can send mail to a friend by several methods. The most straight forward would be to use the SEND_MAIL message where you specify the recipients ID and then the message (no set format, just specify the length in 4 bytes). The mail will be sent straight to his LINE. If he is currently transfered to another SECTOR, the mail is sent on to the next SECTOR to which he travelled (he may have moved on from there too). He may have his CLIENT software set up so mail appears as a flashing icon on the screen or as a full letter box outside the little cottage that is his PP. Mail can also be send to a location and the SC will try to inform the owner, if the mail is not received, a MAIL_FAILED message is returned. Text mail may be appended to a PP ASPECT temporarily. In this way if no-one is 'home' (maybe not logged in or in another SECTOR) then you can send the mail to the PP location and when he person returns he will see an added object on his normal PP aspect. This object may be a piece of paper with the text message written on it. In a similar way a true bulletin board could be set up, where people could leave messages for others to read. -- more -- So you can conference with otheres, send mail, access commercial services etc. The commercial services may first connect to the system using their original 2D flat screen interface, so when you enter their PP you just see a single screen. In this way the interface changes would be minimal to start with but they could develop better interfaces to make data access more efficient. A statistics service could have a PP where data was represented as dynamic 3D structures etc. Probably the most useful items within the cybersapce are your AGENTS. These items exist as packets of messages that together form an entity that is a type of object. See the comprehensive definition later on for details. Agents can do whatever you can do, in your place. Some agents are simply objects that you use (for instance a 'design-an-aspect' agent may allow you to draw items in 3D (walls, texture, motion etc) and will then create the ASPECT data for you). It may be an access key tool (eg you might guy a '10 shot' agent from a database service. When you want to access that database you instruct the agent as to what you want. The agent then goes off to the databases PP and gets a high prioirty of service (because you paid for it!) and also knows how the database works and so can access the data faster and then mail the data back to you (or -- more -- maybe return to you itself with its ASPECT changed to show you the data) and after the tenth use it doesn't come back. The last sort of agent is independant. These actually are macro languages that are executed by the SC and may act as guides to newcomers or perform tasks within the sector for you (ie like a servant). They can exist by themselves. You can have an AGENT that 'lives' in you PP and answers requests to enter from other CLIENTS while you are tied up somewhere else. Now this brings on all sorts of possibilities. You could send an AGENT to a conference in your place and it may respond to text as a human would, to gather data for you. For this reason and others, there is one strict rule, and that is that the default ASPECT of agents are a white star made of three perpendicular axes, no matter what. Another example is to have several agents that travel with you in unison and which have ASPECTS that fit into yours to make one larger, more impressive ASPECT. One ASPECT detail that hasn't been mentioned is sound. Obviously a sound interface would be good (so you can talk to people you meet other than just sending mail or typing stuf in during a private conference). Sound -- more -- would be easy enough to implement into the SEND_MAIL message protocol (you get mail from someone who is in such and such a direction therefore the headphones position the sound source accordingly). But I would like to incorporate it into the ASPECT as well so you could hear someone comming, even if you were looking in the wrong direction. (Note: Its clear that this system is open to abuse to rogue CLIENTS that send invalid messages. The buck will have to stop at the SERVER and so this could end up being a pretty awesome beast as far as functionality goes.) DETAILED DESCRIPTIONS NOT COVERED BEFORE (incomplete section) (note: I covered a bit more detail than planned above, hope it suffices for now or I'll never send this thing!) =================================================================== =================================================================== - each CLIENT has an ID derived from their "login" address (eg internet address) and so is unique. Along with ID, each CLIENT has an ASPECT which describes how they appear to other CLIENTS. ASPECT by default is an arrow with a single feather to indicate 3D orientation -- more -- ASPECT has levels, the one just stated is the default level, 0. The next level is "wire frame" representation that consists of a variable length list of points and vectors. They have variable colour and have a DYNAMIC | STATIC parameter, if DYMNAMIC is TRUE then motion paramters follow (undefined yet). The last parameter is EXTENDED. If EXTENDED is TRUE then a further level follows defining solid geometry descriptions, which end with the EXTENDED parameter for future expansion. Things are designed this way so that a simple system (AT with CGA graphics) can select only the minimum display criteria because that's all it can handle. Better machines '486, Silicon Graphics Workstation etc can go for full solid rendering etc. =================================================================== =================================================================== SOFTWARE STATUS The system so far has a CLIENT that connects to the LOCAL SERVER and allows the user to move around within their own SECTOR, requesting information on and displaying PERMASPACE objects that are already in the SERVER's object database. This is all in wire frame (easily upgraded to solids, but it goes too slow on the PC (386SX) for development work). -- more -- This system works on a PC and on a SUN (X11). The graphics library used is VOGLE, but REND386 is being kept in mind for PC stuff. An Amiga version is in the works (mainly just requires the VOGLE driver). (VOGLE is available from most ftp sites I assume, I got it from the Australian ftp mirror site, archie.au:/graphics/graphics/echidna) The code is in ANSI C. This is ideal stuff for C++ but that would limit the platforms we could easily port to (and not enough people are comfortable with it yet). HELP WANTED As you can see, there are many ideas brewing here and so few implemented. I really hope to have something significant done by the beta release date later this year ('92) before tasks and improvements can be farmed out to others. Ideas on modifying the concepts involved would be wonderful, but programmers with time would be even better. Managing remote development seems a difficult task. Breaking this into neat packages isn't really possible at the moment. The only area that could be done (perhaps) is the graphical operating system stuff for your local computer. I hope people will disagree with me and show how this -- more -- can be done as a joint effort. My time for co-ordination of such an effort is woefully limited which is why I have perservered with the programming alone thus far. As I think I mentioned earlier, I want to make this software freely available with limited source distribution until it looks stable. But in the long run, the source should be available for everyone to update and use as they will. My main reasoning for this is to give everyone a chance to have a working interactive system that they can connect up together. So far I have received about 30 requests for information/code. This document will be posted to sci.virtual-worlds and sent to each of the senders. If after reading this you want to help with programming, then let me know. Any and all comments (public and email) would be greatly appreciated. Cheers Michael Snoswell June 1st, 1992 snoswell@sirius.ucs.adelaide.edu.au p.s. okay, so the doco's not complete...(sigh) -- more -- -- Michael Snoswell snoswell@sirius.ucs.adelaide.edu.au Vision Systems Limited 08 343 0462 South Australia "Profound quote" Current Directory: [Archives/Cyberpunk/Misc] [Archives]: Current Directory: [Archives/Cyberpunk/Misc] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberpunk] [Archives]: Find: Current Directory: [Archives/Cyberpunk] [Archives]: Directory: * FAQS < DIR > 8-Jan-93 FutureCulture < DIR > 8-Jan-93 Journals < DIR > 10-Jan-93 Misc < DIR > 16-Mar-93 Current Directory: [Archives/Cyberpunk] [Archives]: Change Directory: FAQS Current Directory: [Archives/Cyberpunk/FAQS] [Archives]: Directory: * CyberpunkFAQ.p1 44101 19-Nov-92 CyberpunkFAQ.p2 33528 18-Nov-92 bladerunner.faq 32119 7-Jan-93 Current Directory: [Archives/Cyberpunk/FAQS] [Archives]: View: CyberpunkFAQ.p1 ----------------------------------------------------------------------------- ___________________ _________________ / ________________/ / ____________ / / / / /___________/ / / / / ______________/ / /______________ / / /_________________/ yber /__/ unk ______________________________________________________________________| || THE UNOFFICIAL FAQ FOR alt.cyberpunk (part 1/2) ||______________________________________________________________________| :::::updated: 14Nov92 Contents:|| a. Introduction/disclaimer/editors notes| b. Abbreviations and TLAs| 1. What is Cyberpunk? (definitions and interpretations from alt.cp)| 2. Cyberpunk melding with other subcultures-- more -- Current Directory: [Archives/Cyberpunk/FAQS] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberpunk] [Archives]: Current Directory: [Archives/Cyberpunk] [Archives]: Returned to previous directory. Current Directory: [Archives] [Archives]: Directory: * Computers < DIR > 28-Apr-93 Software for Download Cyberpunk < DIR > 9-Apr-93 Fiction and Files Cyberspace < DIR > 9-Apr-93 Drugs < DIR > 9-Apr-93 Encryption < DIR > 9-Apr-93 Internet < DIR > 10-Apr-93 Everything about the InterNet MindVox < DIR > 9-Apr-93 Help and Information about MindVox Security < DIR > 9-Apr-93 Computer Security TheArts < DIR > 9-Apr-93 Film, Music, Theatre and Fiction Uploads < DIR > 29-Apr-93 VR < DIR > 9-Apr-93 Virtual Reality and its Impact Virus < DIR > 9-Apr-93 Articles and Papers about Viruses Current Directory: [Archives] [Archives]: Find: phrack No items were found. Current Directory: [Archives] [Archives]: Change Directory: Cyberspace Current Directory: [Archives/Cyberspace] [Archives]: Directory: * CUD < DIR > 24-Oct-92 The Computer Underground Digest EFF < DIR > 18-Sep-92 Electronic Frontier Foundation History < DIR > 17-Jan-93 Journals < DIR > 4-Jan-93 Electronic Texts from the Underground Legal < DIR > 30-May-92 Federal & State Laws, Misc. Net Policies Risks < DIR > 19-Nov-92 The Risks Digest Current Directory: [Archives/Cyberspace] [Archives]: Change Directory: D CUD Current Directory: [Archives/Cyberspace/CUD] [Archives]: Directory: * cud-1.00 55559 17-Mar-92 cud-1.01 34144 17-Mar-92 cud-1.02 22780 17-Mar-92 cud-1.03 31581 17-Mar-92 cud-1.04a 17929 17-Mar-92 cud-1.04b 25047 17-Mar-92 cud-1.04c 20619 17-Mar-92 cud-1.04d 19125 17-Mar-92 cud-1.05 30759 17-Mar-92 cud-1.06 30508 17-Mar-92 cud-1.07 28087 17-Mar-92 cud-1.08 31581 17-Mar-92 cud-1.09 29733 17-Mar-92 cud-1.10 31492 17-Mar-92 cud-1.11 33796 17-Mar-92 cud-1.12 31193 17-Mar-92 cud-1.13 32789 17-Mar-92 cud-1.14 25622 17-Mar-92 cud-1.15 26877 17-Mar-92 cud-1.16 46001 17-Mar-92 cud-1.17 36222 17-Mar-92 cud-1.18 38799 17-Mar-92 -- more -- cud-1.19 29779 17-Mar-92 cud-1.20 25551 17-Mar-92 cud-1.21 35389 17-Mar-92 cud-1.22 46610 17-Mar-92 cud-1.23 42869 17-Mar-92 cud-1.24 35779 17-Mar-92 cud-1.25 28476 17-Mar-92 cud-1.26 37317 17-Mar-92 cud-1.27 34161 17-Mar-92 cud-1.28 38741 17-Mar-92 cud-1.29 38142 17-Mar-92 cud-2.00 40494 17-Mar-92 cud-2.01 39661 17-Mar-92 cud-2.02 45888 17-Mar-92 cud-2.03 44094 17-Mar-92 cud-2.04 36946 17-Mar-92 cud-2.05 36434 17-Mar-92 cud-2.06 35052 17-Mar-92 cud-2.07 47366 17-Mar-92 cud-2.08 39911 17-Mar-92 cud-2.09 45219 17-Mar-92 cud-2.10 42392 17-Mar-92 -- more -- cud-2.11 40568 17-Mar-92 cud-2.12 49674 17-Mar-92 cud-2.13 43395 17-Mar-92 cud-2.14 47688 17-Mar-92 cud-2.15 46380 17-Mar-92 cud-2.16 37282 17-Mar-92 cud-2.17 40282 17-Mar-92 cud-2.18 43936 17-Mar-92 cud-2.19 40944 17-Mar-92 cud-3.00 42110 17-Mar-92 cud-3.01 34470 17-Mar-92 cud-3.02 38643 17-Mar-92 cud-3.03 45676 17-Mar-92 cud-3.04 42192 17-Mar-92 cud-3.05 47198 17-Mar-92 cud-3.06 41313 17-Mar-92 cud-3.07 36692 17-Mar-92 cud-3.08 36359 17-Mar-92 cud-3.09 44154 17-Mar-92 cud-3.10 41679 17-Mar-92 cud-3.11 36289 17-Mar-92 cud-3.12 42947 17-Mar-92 -- more -- cud-3.13 46265 17-Mar-92 cud-3.14 41114 17-Mar-92 cud-3.15 47088 17-Mar-92 cud-3.16 41448 17-Mar-92 cud-3.17 36587 17-Mar-92 cud-3.18 30790 17-Mar-92 cud-3.19 39902 17-Mar-92 cud-3.20 45542 17-Mar-92 cud-3.21 36814 17-Mar-92 cud-3.22 44597 17-Mar-92 cud-3.23 42636 17-Mar-92 cud-3.24 42910 17-Mar-92 cud-3.25 38422 17-Mar-92 cud-3.26 40360 17-Mar-92 cud-3.27 45164 17-Mar-92 cud-3.28 50781 17-Mar-92 cud-3.29 35111 17-Mar-92 cud-3.30 42194 17-Mar-92 cud-3.31 44047 17-Mar-92 cud-3.32 41761 17-Mar-92 cud-3.33 36117 17-Mar-92 cud-3.34 34351 17-Mar-92 -- more -- cud-3.35 41588 17-Mar-92 cud-3.36 21390 17-Mar-92 cud-3.37 33813 17-Mar-92 cud-3.38 39246 17-Mar-92 cud-3.39 29727 17-Mar-92 cud-3.40 37228 17-Mar-92 cud-3.41 36774 17-Mar-92 cud-3.42 40027 17-Mar-92 cud-3.43 39065 17-Mar-92 cud-3.44 29162 17-Mar-92 cud-4.01 26884 18-Mar-92 cud-4.02 38226 18-Mar-92 cud-4.03 21689 18-Mar-92 cud-4.04 43607 18-Mar-92 cud-4.05 29312 18-Mar-92 cud-4.06 48420 18-Mar-92 cud-4.07 46010 18-Mar-92 cud-4.08 51282 18-Mar-92 cud-4.09 42494 18-Mar-92 cud-4.10 42013 15-Jun-92 cud-4.11 40568 15-Jun-92 cud-4.12 32518 15-Jun-92 -- more -- cud-4.13 39124 15-Jun-92 cud-4.14 40960 15-Jun-92 cud-4.15 41998 15-Jun-92 cud-4.16 44342 15-Jun-92 cud-4.17 36376 15-Jun-92 cud-4.18 46542 15-Jun-92 cud-4.19 36288 15-Jun-92 cud-4.20 38308 15-Jun-92 cud-4.21 37105 15-Jun-92 cud-4.22 48823 15-Jun-92 cud-4.23 51813 15-Jun-92 cud-4.24 43451 15-Jun-92 cud-4.25 42549 15-Jun-92 cud-4.26 48949 15-Jun-92 cud-4.27 36098 18-Sep-92 cud-4.28 47542 18-Sep-92 cud-4.29 43677 18-Sep-92 cud-4.30 39209 18-Sep-92 cud-4.31 53197 18-Sep-92 cud-4.32 37278 18-Sep-92 cud-4.33 42231 18-Sep-92 cud-4.34 40581 18-Sep-92 -- more -- cud-4.35 39503 18-Sep-92 cud-4.36 39932 18-Sep-92 cud-4.37 44273 18-Sep-92 cud-4.38 40686 18-Sep-92 cud-4.39 42564 18-Sep-92 cud-4.40 35543 18-Sep-92 cud-4.41 37156 18-Sep-92 vol1_index 16964 18-Mar-92 vol2_index 8897 18-Mar-92 vol3_index 20352 24-Oct-92 Current Directory: [Archives/Cyberspace/CUD] [Archives]: Change Directory: Current Directory: [Archives/Cyberspace/CUD] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace] [Archives]: Change Directory: ? File not found. Current Directory: [Archives/Cyberspace] [Archives]: Directory: * CUD < DIR > 24-Oct-92 The Computer Underground Digest EFF < DIR > 18-Sep-92 Electronic Frontier Foundation History < DIR > 17-Jan-93 Journals < DIR > 4-Jan-93 Electronic Texts from the Underground Legal < DIR > 30-May-92 Federal & State Laws, Misc. Net Policies Risks < DIR > 19-Nov-92 The Risks Digest Current Directory: [Archives/Cyberspace] [Archives]: Change Directory: History Current Directory: [Archives/Cyberspace/History] [Archives]: Directory: * Anarchy < DIR > 16-Mar-93 Apple-Cat < DIR > 3-Jan-93 BBS < DIR > 3-Jan-93 BOP < DIR > 4-Jan-93 Buffers < DIR > 3-Jan-93 Busts < DIR > 3-Jan-93 File-Index < DIR > 3-Jan-93 Hacking < DIR > 3-Jan-93 Humor < DIR > 3-Jan-93 Phreaking < DIR > 4-Jan-93 Piracy < DIR > 3-Jan-93 Press < DIR > 3-Jan-93 Current Directory: [Archives/Cyberspace/History] [Archives]: Change Directory: BBS Current Directory: [Archives/Cyberspace/History/BBS] [Archives]: Directory: * Articles < DIR > 3-Jan-93 Lists < DIR > 3-Jan-93 Systems < DIR > 3-Jan-93 Current Directory: [Archives/Cyberspace/History/BBS] [Archives]: Change Directory: Articles Current Directory: [Archives/Cyberspace/History/BBS/Articles] [Archives]: Directory: * bbs-golden-days 7533 22-Jul-92 Current Directory: [Archives/Cyberspace/History/BBS/Articles] [Archives]: View: bbs-golden-days What ever happened to real bulletin-board systems? First off, I'd like to make it perfectly clear that I cannot be objective in these notes. These are observations, but they are from 1) a Sysop 2) a user of 8BBS, the greatest BBS ever evolved 3) a boy ... who's become a boyish programmer 4) an old timer....1977 was when I first started using BBS systems. 5) the author of a BBS system If you're expecting objectivity, then don't bother reading on. I have a rather unique perspective on the entire BBS scene. I've been around since close to the beginning, and I'm wondering what has happened. Have BBS's gone the way of CB? Is the entire system in a slump? Is there anything wrong at all? I'm going to try to present these questions and show how things have changed...for the better, and for the worst. HISTORY: -- more -- A long time ago, in a city far-far away, two men had an insight. Ward Christensen and Randy Suess wanted a way to leave notes and messages to their programmer/engineer friends. Back then, modems were used by field-engineers and some high-level executives to talk to their companies computers. A 300 baud modem was extremely fast, as most people were using 110 baud TeleTypes. Ward and Randy devloped the concept of the BBS. They called it CBBS, for "Computer Bulletin Board System." CBBS was the first of its kind. It was an enormous program written in 8080 assmebly language. By our standards today, it was kludgy and bug-ridden, but back then it was heavenly. Users could enter messages and read messages... that was about it. CBBS was a wonderful concept, but it was localized to the Chicago area. Ward and Randy were the only ones who were running the program. Then Bill Blue came along and wrote ABBS, which was designed to "emulate" the CBBS system. I feel it was ABBS, rather than CBBS which made the real breakthrough. While ABBS was much less powerful, and more difficult to use, it could be run on a "universal" machine: --The Apple ][-- Anyone with an Apple ][ and a D.C. Hayes MM][ modem could run ABBS. This program could be installed in a matter of minutes, and anyone could have their own bulletin board system. Soon after the release of ABBS, several other BBS -- more -- programs (for various computers) soon followed. ABBS was the king for many years, just because there were more ABBS systems than any other BBS program available. It is this time that I would like to refer to as the "Golden age of the BBS." It wasn't as golden as you might think. Most Sysops would come home every evening from work to find that their BBS had crashed because of yet another bug. Even back then, user's logged in under false names and left obscene messages. The one point that made that age golden was the users. Without users, a BBS is just a program. With users, it gains a personality, and if I may be metaphysical, a soul. The users MAKE the BBS. A Sysop may have the greatest BBS program in the world, but without active users, he just has a computer wasting line-current. LIFE IN THE "GOLDEN AGE" A user would think nothing of spending his Saturday helping "The Sysop" find an intermittant bug in the BBS program. A user would not only answer his or HER mail, but also butt into other -- more -- people's conversations and throw in his/her two cents worth. A user would suggest improvements to make the system easier to use. A Sysop would care for his BBS like a baby. He'd spend 2 hours each night writing messages and playing with modifications to the program. A Sysop would NOT restrict conversation to one particular topic...such as CP/M software. A Sysop would tolerate kids who were just learning how to use modems. He'd even give them a hand getting things working. A Sysop would [on his own preference] dilligently weed out obscene or "pseudo-illegal" messages, -- or -- promote them as he saw fit. Users would start clubs, such as the well known "Gabber Gang" and later the infamous "Phone Phriekers" who figured so prominently into BBS history. The government didn't try to restrict BBS users. It was just "us" against tyranny (at that time "Ma Bell"). Although most users did not approve of "Phone Phreaking", everyone talked about it, and was interested in it for -- more -- curiosity sake if nothing else. [Hard to believe, but true.] Uploading and downloading of programs did not exist. BBS's were few and far between. When I wrote the OxGate, the two closest other CP/M based machines were Kelly Smith in Simi Valley (375 miles away), and "Jim C" in Larkspur (100 miles away). People tended to congregate on the local system. WHAT HAS KILLED BBS SYSTEMS: 1) Program uploading and downloading. People just get their programs and leave. 2) The technical clique's retaliation against "gabbers" who just used the systems for personal communication. 3) Too many BBS systems in one area. BBS's are still alive and healthy in low-density areas. 4) The loss of "anonimity" among BBS users. The BBS used to be the place to escape. Where no one had to be "themselves." Users such as "James Bond" and -- more -- "Captain Scarlet" were given free reign to vent their fantasies. Today, most systems do not allow false names so they can keep track of users. 5) The anti-hacker movement. More and more people today think the word "hacker" means "phone phriek/computer crasher." All it ever meant was "great programmer." You would feel proud if someone labeled you a "hacker." 6) The press' ignorance of the BBS community. By trying to make a scandal out of all of it, they ruined a great form of communication. In particular, the magazine "InfoWorld" has done more harm to the BBS community than other press organization. While they actively TRIED to HELP the community, they have caused more harm in their mis-reporting of info. 7) Sysop's ignorance. Quite frankly, the average quality of "Sysop" has dropped. Sysop's are (on the whole) less active and less responsive than 5 years ago. More and more of them are technically incompetent, they couldn't fix a bug if it bit them in the nose. All of these problems are inter-related. We can't solve any of them until all of them are solved. From my descriptions it should be obvious that the "golden age" certainly wasn't all gold. People like "James Bond" and "Sam Daniels" had to be stopped, but the pendulum has swung too far to the opposite -- more -- side. These observations are very general. I've noticed this swing, and it has taken place on 95% of all of the system's I've called across America. It's sad that these problems have stabbed us in the back, but it's not too late to try and bring about a change. I don't have the answers, but maybe these observations will prompt thought into this death of a virtual "art form" of communication. There is one possible solution to this problem... the acceptance of children again. For too long we've been kicking off kids (both phyiscal and "kids at heart"). They've been disruptive, and caused fights galore. Many have even tried to crash the systems they used. "If there's any hope, it lies with the proles." -- George Orwell, _1984_ Perhaps the thing to do is call a few local Commodore and Apple boards and let the users know that they're just as welcome on your super-fancy 100mb 2400 baud RCP/M system as any of your so- called "serious users" . . . "serious users" who can't even bring themselves to answer their own mail. Saddening. (> -- more -- Current Directory: [Archives/Cyberspace/History/BBS/Articles] [Archives]: Directory: * bbs-golden-days 7533 22-Jul-92 Current Directory: [Archives/Cyberspace/History/BBS/Articles] [Archives]: ===== TurboTerm v2.5 : Log : Friday 04/30/1993 @ 00:13:23 ===== Directory: *ir   8BBS < DIR > 3-Jan-93 8BBS AT < DIR > 3-Jan-93 Adventurers Tavern COPS < DIR > 3-Jan-93 COPS LOD < DIR > 3-Jan-93 Legion of Doom (LOD/H System) MOM < DIR > 3-Jan-93 Modem Over Manhattan MSP < DIR > 3-Jan-93 Metal Shoppe Private OSUNY < DIR > 3-Jan-93 Ohio Scientific Users of NY PC < DIR > 3-Jan-93 Pirate's Chest PH < DIR > 3-Jan-93 Pirate's Harbor Pirate-80 < DIR > 3-Jan-93 Pirate-80 PloverNet < DIR > 3-Jan-93 PloverNet (516) SF1 < DIR > 3-Jan-93 Sherwood Forest (Original/Magnetic Surfer) SF2 < DIR > 3-Jan-93 Sherwood Forest ][ (Creative Cracker) SF3 < DIR > 3-Jan-93 Sherwood Forest ]I[ (High Technology) Safehouse < DIR > 3-Jan-93 The Safehouse (612) Securityland < DIR > 3-Jan-93 Securityland Shadowland < DIR > 3-Jan-93 Shadowland (303) SpecELITE < DIR > 3-Jan-93 The Spectrum Elite WOPR < DIR > 3-Jan-93 WOPR (617) Current Directory: [Archives/Cyberspace/History/BBS/Systems] [Archives]: Change Directory: LOD Current Directory: [Archives/Cyberspace/History/BBS/Systems/LOD] [Archives]: Directory: * No files found. Current Directory: [Archives/Cyberspace/History/BBS/Systems/LOD] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/History/BBS/Systems] [Archives]: Change Directory: WOPR Current Directory: [Archives/Cyberspace/History/BBS/Systems/WOPR] [Archives]: Directory: * No files found. Current Directory: [Archives/Cyberspace/History/BBS/Systems/WOPR] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/History/BBS/Systems] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/History/BBS] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/History] [Archives]: Directory: * Anarchy < DIR > 16-Mar-93 Apple-Cat < DIR > 3-Jan-93 BBS < DIR > 3-Jan-93 BOP < DIR > 4-Jan-93 Buffers < DIR > 3-Jan-93 Busts < DIR > 3-Jan-93 File-Index < DIR > 3-Jan-93 Hacking < DIR > 3-Jan-93 Humor < DIR > 3-Jan-93 Phreaking < DIR > 4-Jan-93 Piracy < DIR > 3-Jan-93 Press < DIR > 3-Jan-93 Current Directory: [Archives/Cyberspace/History] [Archives]: Change Directory: Hacking Current Directory: [Archives/Cyberspace/History/Hacking] [Archives]: Directory: * CEO < DIR > 3-Jan-93 TKOS < DIR > 3-Jan-93 TRW < DIR > 3-Jan-93 Trashing < DIR > 3-Jan-93 Unix < DIR > 9-Feb-93 Current Directory: [Archives/Cyberspace/History/Hacking] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/History] [Archives]: Directory: * Anarchy < DIR > 16-Mar-93 Apple-Cat < DIR > 3-Jan-93 BBS < DIR > 3-Jan-93 BOP < DIR > 4-Jan-93 Buffers < DIR > 3-Jan-93 Busts < DIR > 3-Jan-93 File-Index < DIR > 3-Jan-93 Hacking < DIR > 3-Jan-93 Humor < DIR > 3-Jan-93 Phreaking < DIR > 4-Jan-93 Piracy < DIR > 3-Jan-93 Press < DIR > 3-Jan-93 Current Directory: [Archives/Cyberspace/History] [Archives]: Change Directory: Phreaking Current Directory: [Archives/Cyberspace/History/Phreaking] [Archives]: Directory: * BIOC < DIR > 3-Jan-93 Blue-Boxing < DIR > 3-Jan-93 Conferences < DIR > 3-Jan-93 Misc-Boxes < DIR > 3-Jan-93 Numbers < DIR > 3-Jan-93 Telco-History < DIR > 3-Jan-93 Current Directory: [Archives/Cyberspace/History/Phreaking] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/History] [Archives]: Directory: * Anarchy < DIR > 16-Mar-93 Apple-Cat < DIR > 3-Jan-93 BBS < DIR > 3-Jan-93 BOP < DIR > 4-Jan-93 Buffers < DIR > 3-Jan-93 Busts < DIR > 3-Jan-93 File-Index < DIR > 3-Jan-93 Hacking < DIR > 3-Jan-93 Humor < DIR > 3-Jan-93 Phreaking < DIR > 4-Jan-93 Piracy < DIR > 3-Jan-93 Press < DIR > 3-Jan-93 Current Directory: [Archives/Cyberspace/History] [Archives]: Change Directory: Piracy Current Directory: [Archives/Cyberspace/History/Piracy] [Archives]: Directory: * Black-Bag < DIR > 3-Jan-93 Cracking < DIR > 3-Jan-93 Crashing < DIR > 3-Jan-93 KKK < DIR > 3-Jan-93 SpecElite < DIR > 3-Jan-93 Wars < DIR > 3-Jan-93 Current Directory: [Archives/Cyberspace/History/Piracy] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/History] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace] [Archives]: Directory: * CUD < DIR > 24-Oct-92 The Computer Underground Digest EFF < DIR > 18-Sep-92 Electronic Frontier Foundation History < DIR > 17-Jan-93 Journals < DIR > 4-Jan-93 Electronic Texts from the Underground Legal < DIR > 30-May-92 Federal & State Laws, Misc. Net Policies Risks < DIR > 19-Nov-92 The Risks Digest Current Directory: [Archives/Cyberspace] [Archives]: Change Directory: Journals Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- TAP < DIR > 30-May-92 Worldview < DIR > 26-Oct-92 cDc < DIR > 8-Jan-93 Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: ANe No such directory. You must match upper and lowercase in directory names exactly as they appear! Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: ANE Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Directory: * ane-1 22545 17-Mar-92 ane-2 4577 17-Mar-92 ane-3 5766 17-Mar-92 ane-4 5276 17-Mar-92 ane-5 6850 17-Mar-92 ane-6 10070 17-Mar-92 ane-7 201033 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]:  MindVox [ARCHIVES] Library -=/[ File Location Services ]/=- -=/[ File Transfer Options ]/=- [C]hange - Move to a new Directory [A]rc - View Contents of an .arc [D]ir - View CURRENT Directory .zip, .lzh, or .tar File [F]ind - Locate Files by Title [P]rotocol - Set Transfer Protocol [N]ew - Listing of NEW Files [R]eceive - Upload File(s) **TO US** [T]op - Switch to Top Directory [S]end - Send File from US to YOU [.] - Move Back ONE Directory [W]rite - Write Text to a File [H]elp - Get Help! / [Q]uit - Exit [V]iew - View an ASCII File Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Send: ane-? (7 files) -- 2001 blocks, 251k, with Z protocol rz **B00000000000000 Šecho "sz: Can't open any requested files"kìÖc*C/©úEecho "sz: Can't open any requested files"kìÖc sz 3.11 02-26-91 finished. < UNSUCCESSFUL TRANSFER > Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Send: ane-1 177 blocks, 23k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Send: ane-2 36 blocks, 5k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Send: ane-3 46 blocks, 6k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Send: ane-4 42 blocks, 6k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Send: ane-5 54 blocks, 7k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Send: ane-6 79 blocks, 10k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Send: ane-7 1571 blocks, 197k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ANE] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: ATI Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Directory: * ati.01 7880 16-Mar-92 ati.02 10599 16-Mar-92 ati.03 10816 16-Mar-92 ati.04 14885 16-Mar-92 ati.05 13424 16-Mar-92 ati.06 8906 16-Mar-92 ati.07 13350 16-Mar-92 ati.08 14836 16-Mar-92 ati.10 41444 16-Mar-92 ati.11 7535 16-Mar-92 ati.12 11793 16-Mar-92 ati.13 14412 16-Mar-92 ati.14 11099 16-Mar-92 ati.15 22155 16-Mar-92 ati.16 6300 16-Mar-92 ati.17 11122 16-Mar-92 ati.18 11087 16-Mar-92 ati.19 11056 16-Mar-92 ati.20 11286 16-Mar-92 ati.21 4499 16-Mar-92 ati.22 10358 16-Mar-92 ati.23 9249 16-Mar-92 -- more -- ati.24 10111 16-Mar-92 ati.25 10916 16-Mar-92 ati.26 2301 16-Mar-92 ati.27 10528 16-Mar-92 ati.28 5010 16-Mar-92 ati.29 9962 16-Mar-92 ati.30 11308 16-Mar-92 ati.31 12330 16-Mar-92 ati.32 23557 16-Mar-92 ati.33 17770 16-Mar-92 ati.34 20003 16-Mar-92 ati.35 25734 16-Mar-92 ati.36 30017 16-Mar-92 ati.37 22539 16-Mar-92 ati.38 22697 16-Mar-92 ati.39 18693 16-Mar-92 ati.40 14377 16-Mar-92 ati.41 25641 16-Mar-92 ati.42 10069 16-Mar-92 ati.43 20538 16-Mar-92 ati.44 20906 16-Mar-92 ati.45 21987 16-Mar-92 -- more -- ati.46 7724 16-Mar-92 ati.47 24880 16-Mar-92 ati.48 15280 16-Mar-92 ati.49 20301 16-Mar-92 ati.50 21261 16-Mar-92 ati.51 18439 16-Mar-92 ati.52 19605 16-Mar-92 ati.53 30332 16-Mar-92 ati.54 12718 16-Mar-92 ati.55 11976 16-Mar-92 ati.56 30339 16-Mar-92 ati.57 30421 16-Mar-92 ati.58 25400 29-Dec-92 ati.59 16384 29-Dec-92 Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.* (58 files) -- 7267 blocks, 909k, with Z protocol rz **B00000000000000 Šecho "sz: Can't open any requested files"kìÖc*C/¼â hecho "sz: Can't open any requested files"kìÖc sz 3.11 02-26-91 finished. < UNSUCCESSFUL TRANSFER > Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.1 ati.2 ati.3 Illegal character in filename. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]:  MindVox [ARCHIVES] Library -=/[ File Location Services ]/=- -=/[ File Transfer Options ]/=- [C]hange - Move to a new Directory [A]rc - View Contents of an .arc [D]ir - View CURRENT Directory .zip, .lzh, or .tar File [F]ind - Locate Files by Title [P]rotocol - Set Transfer Protocol [N]ew - Listing of NEW Files [R]eceive - Upload File(s) **TO US** [T]op - Switch to Top Directory [S]end - Send File from US to YOU [.] - Move Back ONE Directory [W]rite - Write Text to a File [H]elp - Get Help! / [Q]uit - Exit [V]iew - View an ASCII File Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]:  MindVox [HELP: ARCHIVES] Reference [File Location Commands] C)hange - Move to a new directory. This command is used to go down the file system tree. Your current directory is always displayed right above the Archives prompt. You may view the file listing in the current directory with the D)ir command. D)ir - View the listing of files in the current directory. Among the information displayed is the file name, file size in bytes, date of upload, and a single line text description of the file. F)ind - Locate a file by title. If you quickly want to locate a file anywhere in the Archives section, and you know part of the file name, this command is very useful in quickly locating the file. M)aster - Move to the top of the directory tree. This is an easy way for you to return to the root directory, as opposed to using -- more -- the .) command multiple times. .) - Move back to previous directory. This performs the exact opposite function of the C)hange command. [File Transfer Commands] A)rc - View the contents of an .arc, .lzh, or .zip file. This command will display a list of files and their attributes that are located within an archive file. If you download an archived file, be sure that you have the correct program to extract the files contained therein. Use ARC for .arc files, LHARC for .lzh files, and PKZIP for .zip files. P)rotocol - Set Transfer Protocol. Mindvox currently supports the Xmodem, Ymodem and Zmodem protocols. R)eceive - Upload a file to Mindvox. Be sure you are using the same protocol on Mindvox and in your terminal software, and your settings are 8N1. -- more -- S)end - Download a file from Mindvox. The above rule also applies. V)iew - View a text file. This allows you to download or simply view a text file without the use of a protocol. You can view files online, as well as buffer and save them with your terminal software. W)rite - Write text to a file. This allows you to upload a text file without the use of a protocol. This command can also be used for creating small text files (ie: readme.txt) on the system. [Other Commands] H)elp - Displays the online help screen. Q)uit - Leave the Archives section and return to the main menu.  MindVox [HELP] Section ___________________________________________________________ | | | Help - General Information on System Commands | |___________________________________________________________| | | | Archives - Detailed Information on Using the Archives | | Chat - Explanation of the Chat System Commands | | Forums - Complete Instructions for the Vox Forums | | FTP - How to Use Internet File Transfer Protocol | | Gateways - How to Send Mail to Various Networks | | Home - Setting up Plan, Login, and other Features | | IRC - Crash course on using Internet Relay Chat | | Jove - Documentation on Using the Jove Editor | | Mail - Using the MindVox mail system Capabilities | |___________________________________________________________| | | | QUIT - Exit Help and Return to Previous Menu | |___________________________________________________________| -- more -- [Topic]: Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.1 File not found, ati.1 Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.01 62 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati0 .02 83 blocks, 11k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.03,ati.04 (2 files) -- 201 blocks, 26k, with Z protocol rz **B00000000000000 Šecho "sz: Can't open any requested files"kìÖc*C/ëuiçecho "sz: Can't open any requested files"kìÖc sz 3.11 02-26-91 finished. < UNSUCCESSFUL TRANSFER > Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Protocol: ? MindVox [FILE-TRANSFER PROTOCOL] Selection [K]...Kermit / [X]...Xmodem / [Y]...Ymodem / [Z]...Zmodem [Z] is Selected Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.03 85 blocks, 11k, with Z protocol rz **B00000000000000 Š11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.04 117 blocks, 15k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.05 105 blocks, 14k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.06 70 blocks, 9k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.07 105 blocks, 14k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.08 116 blocks, 15k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.09 File not found, ati.09 Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.10 324 blocks, 41k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati1 / .11 59 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.12 93 blocks, 12k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.13 113 blocks, 15k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.14 87 blocks, 11k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.15 174 blocks, 22k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.16 50 blocks, 7k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.17 87 blocks, 11k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.18 87 blocks, 11k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.19 87 blocks, 11k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.20 89 blocks, 12k, with Z protocol rz **B00000000000000 Š000000022d ŠOO sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.21 36 blocks, 5k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.22 81 blocks, 11k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.23 73 blocks, 10k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.24 79 blocks, 10k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.25 86 blocks, 11k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.26 18 blocks, 3k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.27 83 blocks, 11k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.28 40 blocks, 5k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.29 78 blocks, 10k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.30 89 blocks, 12k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.31 97 blocks, 13k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.32 185 blocks, 24k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.33 139 blocks, 18k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.34 157 blocks, 20k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.35 202 blocks, 26k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.36 235 blocks, 30k, with Z protocol rz **B00000000000000 Š11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.37 177 blocks, 23k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.38 178 blocks, 23k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.39 147 blocks, 19k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.40 113 blocks, 15k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.41 201 blocks, 26k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.42 79 blocks, 10k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.43 161 blocks, 21k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.44 164 blocks, 21k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.45 172 blocks, 22k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.46 61 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.47 195 blocks, 25k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.48 120 blocks, 15k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.49 159 blocks, 20k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.50 167 blocks, 21k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.51 145 blocks, 19k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.52 154 blocks, 20k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.53 237 blocks, 30k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.54 100 blocks, 13k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.55 94 blocks, 12k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.56 238 blocks, 30k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.57 238 blocks, 30k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.58 199 blocks, 25k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.59 128 blocks, 16k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Send: ati.60 File not found, ati.60 Current Directory: [Archives/Cyberspace/Journals/ATI] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: DFP Current Directory: [Archives/Cyberspace/Journals/DFP] [Archives]: Directory: * dfp-1.1 22914 18-Mar-92 dfp-1.2 51910 18-Mar-92 Current Directory: [Archives/Cyberspace/Journals/DFP] [Archives]: Send: dfp-1.1 180 blocks, 23k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/DFP] [Archives]: Send: dfp-2 1.2 406 blocks, 51k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/DFP] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: FBI Current Directory: [Archives/Cyberspace/Journals/FBI] [Archives]: Directory: * fbi-1.1 54422 17-Mar-92 fbi-1.2 111127 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/FBI] [Archives]: View: fbi-1.1 / / --- / | ///////////// ////////// //////////////// / | | | /// /// // // / |-| __ /// /// // // / | | | /////////// /// // // / |- /// ////////// // / |__ /// /// // // / /// /// // // / /// // ////////// // //////////////// // / Volume:001 / Issue:001 /--- \===================================/ Number of /-- reakers \ Founding Members / / Articles:011 / (ph) _ \------------------/ / Size of / \ \ GaRbLeD uSeR / Issue:0055k /--/ureau \ Halifax / /__/ \ The Undead Warrior / ---- \ Eights / / ncorporated. \ Kato / __/_ \ The Sentinel / ==================================\-----------------/ -- more -- Current Directory: [Archives/Cyberspace/Journals/FBI] [Archives]: Send: fbi-1.1 426 blocks, 54k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/FBI] [Archives]: Send: fbi-2.  1.2 869 blocks, 109k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/FBI] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Hack Current Directory: [Archives/Cyberspace/Journals/Hack] [Archives]: Directory: * hack.01 4467 3-Jan-93 hack.02 6584 3-Jan-93 hack.03 5100 3-Jan-93 Current Directory: [Archives/Cyberspace/Journals/Hack] [Archives]: View: hack.01 HACK VOL I ---- --- - CREATED BY GREY WOLF -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- AT&T ---- PHONE: 402-345-6510 (NEBRASKA) LOGCODE: RRC PSWD: FLOPPYS THE LOGCODE & P/W MUST BE TYPED IN LOWER-CASE. -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- -- more -- SPRINT CODES ------ ----- MAIN ACCESS: 617-482-3362 SOME CODES TO TRY: 18151939, 51408733 -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- BOX COLORS --- ------ WHITE BOX --------- 800 EXTENDER (800 # PAYS) -- more -- BLACK BOX --------- INCOMING CALLS -> CALLER PAYS RED BOX ------- NICKEL DIME QUARTER DIRECTORY ASSISTANCE INTERCEPT SILVER BOX ---------- ALL TOUCH TONE SIGNALS MUTE REDIAL 2 UNKNOWN FEATURES GOLD BOX -------- TRACES CALLS TELL IF BEING TRACED -- more -- CHANGE A TRACE BLUE BOX -------- FREE CALLS TO ANYWHERE UNLIMITED CONFERENCE CALLS DISCONNECT PHONE LINE(S) TAP A PHONE LINE DETECT TRACE FAKE DIAL TONE SIGNALS MAKES YOU AN OPERATOR PURPLE BOX ---------- FREE CALLS TO ANYWHERE FAKE SIGNALS BECOME AN OPERATOR CONFERENCE CALLS DISCONNECT PHONE LINE(S) TAP PHONE DETECT TRACE QUARTER -- more -- Current Directory: [Archives/Cyberspace/Journals/Hack] [Archives]: Send: hack.01 35 blocks, 5k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Hack] [Archives]: Send: hack.02 52 blocks, 7k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Hack] [Archives]: Send: hack.03 40 blocks, 5k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Hack] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Informatik Current Directory: [Archives/Cyberspace/Journals/Informatik] [Archives]: Directory: * inform-1.1 186117 17-Mar-92 inform-1.2 176859 17-Mar-92 inform-1.3 129862 24-Apr-92 Current Directory: [Archives/Cyberspace/Journals/Informatik] [Archives]: View: inform-.1.   1.1 +=============================================================================+ | ## ## ## ###### ###### ###### ### ### ###### ###### ## ## ## | | ## ### ## ## ## ## ## ## ## ## ## ## ## ## ## ## ## | | ## ## ### ##### ## ## ###### ## ## ###### ## ## #### | | ## ## ## ## ###### ## ## ## ## ## ## ## ## ## ## | +=============================================##==============================+ | | | [ The Journal of Priveleged Information ] | | | +-----------------------------------------------------------------------------+ | Volume I, Issue 001 By: 'Above the Law' | +-----------------------------------------------------------------------------+ | | |Informatik--Bringing you all the information you should know... | | and a lot you shouldn't... | | | +=============================================================================+ /* Introduction */ By the Informatik staff -- more -- Welcome to the inaugural issue of Informatik, an electronic periodical devoted to the distribution of information not readily available to the public, with a particular emphasis on technology and the computing world. First and foremost, this publication is dedicated to the freedom of information. This journal is made possible by The First Amendment of the U.S. Constitution which states: Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; OR ABRIDGING THE FREEDOM OF SPEECH OR OF THE PRESS; or the right of the people peaceably to assemble, and to petition the Government for redress of grievances. In this and coming issues, we plan to exercise our First Amendment rights to the best of our ability. We will print feature articles on hacking, phreaking, and various other illicit activities. We also plan on bringing you recent news and gossip from the underground, anything news of interest to hackers, phreakers, grifters, cyber-punks, and the like. Informatik will also provide a plethora of information on the inner workings of corporate America and the U.S. Government. DO distribute this freely! Remember this is not illegal, this is information. -- more -- Current Directory: [Archives/Cyberspace/Journals/Informatik] [Archives]: Send: inform-1.1 1455 blocks, 182k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Informatik] [Archives]: Directory: * inform-1.1 186117 17-Mar-92 inform-1.2 176859 17-Mar-92 inform-1.3 129862 24-Apr-92 Current Directory: [Archives/Cyberspace/Journals/Informatik] [Archives]: Send: inform-1.2 1382 blocks, 173k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Informatik] [Archives]: Send: inform-1.3 1015 blocks, 127k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Informatik] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Kcah Current Directory: [Archives/Cyberspace/Journals/Kcah] [Archives]: Directory: * kcah.1 32102 17-Mar-92 kcah.2 17440 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Kcah] [Archives]: View: kcah.1 ____ º º ÚÄ____ÍÍ ÍÍÛÛÛÛÍÍ Û Û º ³º ³ Û Û º º Û Û³ Û Û Û º º ³³³ º ºÛÛÍÍÛÛº ÃÄÍÍÄ´ ³³³ º º º ³ ³ Û Û³ Û Û Û º º º ³º ³ ____ º º º º º º ÀÄ____ÍÍ º º Û Û (tm) _ _ _ _ .. | | | | | | | | | | |_ | \/ |_| |_ |_| | | |_ _|_ 01-20-90 -- more -- ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ[ PREFACE ]ÄÄÄÄ[ by The Rebel ]ÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Welcome to TTL's Quad-Annual Magazine ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ[ Table of Contents ]ÄÄÄÄÄ[ by KCAH Staff ]ÄÄÄÄÄÄ # LINES NAME DATE AUTHOR Ä ÄÄÄÄÄ ÄÄÄÄ ÄÄÄÄ ÄÄÄÄÄÄ I 1-23 oPeNiNg ScReEn 1/09/90 The Rebel II 24-27 PrEfAcE 1/09/90 The Rebel III 28-55 tAbLe Of CoNtEnTs 1/17/90 KCAH Staff IV 56-67 MeMbErS 1/20/90 The Rebel V 68-101 uNiX cOmMaNd SuMmArY 1/09/90 The Rebel VI 102-176 CoMmOn UnIx PaSsWoRdS 1/20/90 The Rebel VII 177-208 MCI mAiL rAtEs & InFo 1/19/90 The Rebel VIII 209-217 SpRiNt EmPlOyEe NeWsLiNe 1/16/90 The Rebel IX 218-225 nEw -:TTL:- eAsT cOaSt Co-HoMe 1/15/90 The Rebel X 226-350 AnArChIsT's AbOdE 1/20/90 The Rebel XI 351-369 VoIcE mEsSaGe SyStEmS 1/12/90 The Rebel XII 270-378 pHrY cOdE pRo 3.01 1/11/90 The Rebel -- more -- XIII 379-429 PhRy CoDe PrO 3.01 hIsToRy 7/04/89 The Exciter XIV 430-441 TTL mEmBeRsHiP dOoRs OpEn 1/16/90 The Rebel XV 442-447 614 Ac C/nA 1/12/90 The Rebel XVI 448-470 SeCrEt SeRvIcE sCaNnEr FrEq.'S 1/10/90 Thanx-Blaster XVII 471-483 pHrEaK tOoLs PhIlE ReViEw 1/09/90 The Rebel XVIII 484-490 TeRmInAl.TxT - a -:TTL:- tXt FiLe 1/14/90 The Rebel XIX 491-508 aUtOmAtEd OpErAtOr SeRvIcE 1/16/90 The Rebel XX 509-603 AcRoNyMs 1/19/90 The Rebel XXI 604-628 bRiEf NoTeS 1/20/90 The Rebel XXII 629-657 HaPpY hAcKiNg! 1/20/90 -:TTL:- ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ[ Members as of 01-20-90 ]ÄÄÄÄ[ by The Rebel ]ÄÄÄÄÄÄ The Rebel - Founder / President / Security Director / Editor of KCAH / IC Mr. Rat - Co-Founder / Vice-President / Consul / Electronics Specialist / IC The Juicer - UnderBoss / Operations Officer / Sierra Contact / Scan-Man / IC Mad Phone Man/Blaster/Marc Blitz - East Coast Minister of Propaganda / SysOp Jack Flash/The Archer - Sgt. of Arms / Weapons Specialist / Operations Officer The Captain <716> - Programming Specialist / SysOp Papo Sanchezz - Puerto Rico Operations Officer IC = Inner Circle -- more -- ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ[ Summary of Unix Commands ]ÄÄÄÄ[ by The Rebel ]ÄÄÄÄÄ ÚÄÄÄÄÄÄÄ¿ ÚÄÄÄÄÄÄÄÄÄÄÄ¿ ³Command³ ³Description³ ÀÄÄÄÄÄÄÄÙ ÀÄÄÄÄÄÄÄÄÄÄÄÙ write ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Used to send a message to another user. uucp ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Unix-Unix execute. spell ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Spellcheck a file. rmdir ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Deletes 1+ directories. help ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ duh! vi ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Full screen editor. f77 ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Fortran Compiler ed ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Text editor. ex ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Another text editor. ln ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Used to link files. du ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Reports on file system usage. kill ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Ends a process. mail ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Get/Send email. date ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Gives date & time cp ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Copies a file. -- more -- find ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Locates files w/ specified variables. awk ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Search for a pattern w/in a file. cal ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Displays a calendar. cc ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ "C" Compiler. cd ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Change Directory chgrp ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Change file's group ownership. du ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Reports on file system usage. mv ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Move/Rename files. pwd ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Displays name of working directory. who ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ Who else is online? Not,by far,all of them... But a few.... - TR ÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄÄ[ Common Unix Passwords ]ÄÄÄÄ[ by The Rebel ]ÄÄÄÄÄÄ aaa daniel jester rascal academia danny johnny really ada dave joseph rebecca adrian deb joshua remote aerobics debbie judith rick airplane deborah juggle reagan albany december julia robot -- more -- albatross desperate kathleen robotics albert develop kermit rolex alex diet kernel ronald alexander digital knight rosebud algebra discovery lambda rosemary alias disney larry roses alpha dog lazarus ruben alphabet drought lee rules ama duncan leroy ruth amy easy lewis sal analog eatme light saxon anchor edges lisa scheme andy erenity angerine scott arrow elizabeth maggot sex arthur ellen magic shark asshole emerald malcolm sharon athena engine mark shit atmosphere engineer markus shiva bacchus enterprise marty shuttle badass enzyme marvin simon bailey euclid master simple banana evelyn maurice singer -- more -- bandit extension merlin single banks fairway mets smile bass felicia michael smiles batman fender michelle smooch beauty fermat mike smother beaver finite minimum snatch beethoven flower minsky snoopy beloved foolproof mogul soap benz football moose socrates beowulf format mozart spit berkeley forsythe nancy spring berlin fourier napoleon subway beta fred network success beverly fuck newton summer bumbling george osiris tape cardinal gertrude outlaw target carmen gibson oxford taylor carolina ginger pacific telephone caroline gnu painless temptation castle golf pam tiger cat golfer paper toggle celtics gorgeous password tomato -- more -- change graham pat toyota charles gryphon patricia trivial charming guest penguin unhappy charon guitar pete unicorn chester hacker peter unknown cigar harmony philip urchin classic harold phoenix utility coffee harvey pierre vicky coke heinlein pizza virginia collins hello plover warren comrade help polynomial water computer herbert praise weenie condo honey prelude whatnot condom horse prince whitney cookie imperial protect will cooper include pumpkin william create ingres puppet willie creation innocuous rabbit winston 666 6969 100 zzz There ya go.... A list of common unix passwords... Have phun -TR -- more -- Current Directory: [Archives/Cyberspace/Journals/Kcah] [Archives]: Directory: * kcah.1 32102 17-Mar-92 kcah.2 17440 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Kcah] [Archives]: Send: kcah.1 251 blocks, 32k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Kcah] [Archives]: Send: kcah.2 137 blocks, 18k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Kcah] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: LODLOD No such directory. You must match upper and lowercase in directory names exactly as they appear! Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: LOD Current Directory: [Archives/Cyberspace/Journals/LOD] [Archives]: Directory: * lod-1 213571 16-Mar-92 lod-2 148592 16-Mar-92 lod-3 167909 16-Mar-92 lod-4 256202 16-Mar-92 Current Directory: [Archives/Cyberspace/Journals/LOD] [Archives]: View: lod-1 The LOD/H Technical Journal: File #1 of 12 Volume 1, Issue 1 Released: Jan. 1, 1987 THE LOD/H TECHNICAL JOURNAL ----------------------- INTRODUCTION: Welcome to the premiere issue of the LOD/H TJ! The LOD/H TJ is a soft-copy free newsletter whose primary purpose is to further the knowledge of those who are interested in topics such as: Telecommunications, Datacommunications, Computer & Physical Security/Insecurity and the various technical aspects of the phone system. The articles contained herein, are totally original unless otherwise -- more -- stated. All sources of information for a specific article is listed in the introduction or conclusion of the atricle. We will not accept any articles that are unoriginal, plagiarized, or contain invalid or false information. Articles will be accepted from anyone who meets those criteria. We are not dependant upon readers for articles, since members of LOD/H and a select group of others will be the primary contributers, but anyone can submit articles. Readers are encouraged to download all files for each issue, not just the ones they are interested in. The reason for this is twofold: The newsletter was designed to be a group effort, and the files herein were not intended for individual distribution, and secondly, keeping the issue intact allows you to distribute it to other BBS's and phriends who are interested in it. There is no set date for releasing issues, as we have no monetary or legal obligation to the readers, but we predict subsequent issues will be released between 2 and 3 months from the previous one. Thus, expect 4 to 6 issues a year assuming we continue to produce them, which we intend to do. Newsletter sponsors are boards which will get the newsletter directly from the staff as soon as it is released, and has added our 'staff account' to the userlist in order for the readers to respond directly to us about the content of the newsletter. If your board would like to become a sponsor, leave us mail -- more -- on any of the following sponsors boards: Atlantis Metal Shop Private or B-type Manhole cover lifter), although an ordinary 3/4 - 1 inch crow- Digital Logic Hell Phrozen Over An LOD/H TJ staff account is on all our sponsor BBS's. This allows readers to get in contact with us for the following reasons: * If you have questions about any article, or question the validity of the material, you are welcome to contact us through the staff account and leave a way for the author to contact you. This insures a better understanding from the readers of the topic and also, insures the integrity of the author as far as knowledge and originality of the topic is concerned. * You may leave questions for the staff which will be answered in our 'Ask the Staff' section of the newsletter. The questions selected will be of general interest to others. Any questions not published will try to be answered via E-Mail. We don't know everything, but anything we do know will be shared with those who ask. -- more -- Various features of the newsletter include: Editorials: These will feature short articles on topics which affect the telecom world in general. Network News & Notes: News articles and other things of interest pertaining to the things this newsletter specializes in. Reader Mail: Questions and comments about previous issues from readers who contact us through our staff account on sponsor boards. Special Features: These will pop up from time to time and can be anything which does not fit in the general format of the newsletter. ------------------------------------------------------------------------------- TABLE OF CONTENTS: 01 Introduction to the LOD/H Technical Journal Staff 05 K and Table Of Contents for Volume 1, Issue 1 -- more -- 02 Custom Local Area Signalling Services (CLASS) The Videosmith 17 K 03 Identifying and Defeating Physical Security and Lex Luthor 23 K Intrusion Detection Systems Part I: The Perimeter 04 The Traffic Service Position System (TSPS) The Marauder 23 K 05 Hacking DEC's TOPS-20: Intro Blue Archer 19 K 06 Building your own Blue Box (Includes Schematic) Jester Sluggo 16 K 07 Intelligence and Interrogation Processes Master Of Impact 18 K 08 The Outside Loop Distribution Plant: Part A Phucked Agent 04 25 K 09 The Outside Loop Distribution Plant: Part B Phucked Agent 04 23 K 10 LOH Telenet Directory: Update #4 (1-1-87) Part A LOH 25 K 11 LOH Telenet Directory: Update #4 (1-1-87) Part B LOH 18 K 12 Network News & Notes Staff 10 K -- more -- Total: 12 files 223 K ------------------------------------------------------------------------------- That wraps it up for the introduction, hope you like it and we will look forward to hearing from you. The LOD/H Technical Journal: File #2 of 13 Custom Local Area Signalling Services Written by: The Videosmith Version - 1.1 ----------------------------(c) Copyright 1994--------------------------- This article will explain the newly developed LASS system (AT&T Bell Labs), and how it may affect us in the near future. Note that the service as it -- more -- appears for customers is called "CLASS", the C standing for Custom. I assume this is just for looks. LASS ---- The telephone was destined to become a well used and powerful tool for otherwise tedious tasks. Gas meters and other metered services would be surveyed through the use of automatic data retrieval employing telephone communications. All in all, some have big plans for the uses one could put the telephone system up to, and CLASS is one plan that is going to drop an innovative bombshell on the telecommunicating world. At this moment, a local CCIS network feature is being developed by Bell Laboratories. This feature will change the way people use fones, and will also change the attitude in which they use them. It will give far more control of the telephone to the user than ever before. This feature is called CLASS (Custom Local Area Signalling Services). Everyone will find something useful in this newly developed telephone feature. Pizza parlours will no longer have to worry about fraudulent italian food mongers, and little old ladies won't have to worry about prank calls -- more -- by certain dubious characters. What are all these fantastic features? These features will include call back of the last caller, regardless of whether you have their telephone number or not. Another will be distinct call waiting tones, and preselected call forwarding (only those people whom you wish to speak to will be forwarded). This is a rudimentary list of CLASS features to come. It is a very powerful system, and it all relys on LCCIS (Local Common Channel Interoffice Signalling), an intra-LATA version of the ever-popular CCIS. CCIS Background --------------- CCIS was originally introduced in 1976 as, basically, the signalling system to end all signalling systems. Instead of using the voice grade trunks to carry signalling information on, a data network would be used. This network is comprised of data links from each TO [involved with CCIS] to the appropriate STP (signal transfer point). Signalling information is sent through these links at 4800 bps to the STPs (Note that baud rates may increase due to the economic availability of faster data communications hardware), where stored program control routes the signalling information to the needed -- more -- offices in order to open and complete the call path. SPC checks automatically for on-hook/off-hook status before opening the path, and if the status is off-hook (in this case the customer does not have the call waiting custom calling feature), returns information to the originating CO to apply a busy signal to the customer. This is but one of many features toll CCIS provides the network with. Since this text is not centered on the topic of toll CCIS, technical aspects aren't as important (except for the comparison between the local and toll networks for observational purposes): yet it is important to notice how automated and flexible this type of signalling method is, as well as its speed and efficiency. All the software control involved with local and toll networks is called, fittingly, the "stored program control network." or ISDN (Integrated Services Digital Network). LCCIS will be addressed in a future article. CLASS/LCCIS Features -------------------- LCCIS would look like this: -- more -- /--X CO-2 ESS# /----I-T-G-----1A-----I-T-G----X | X--/ | | | | | LCCIS | | | | | ---------- | /--X--LCCIS--|CCIS/SPC|--LCCIS--/--X CO-1 ---------- CO-3 ESS# ESS# -1A----interoffice trunk group---1A- NPA - Dial 1223 213 NPA (GTE) - Dial 114 SPC = Stored Program Control (Network control and Signal Transfer Point) ITG = Interoffice Trunk Group Using a high-speed data link between local offices creates a much more flexible and more effecient way for intra-LATA central offices to communi- cate. Instead of using per-trunk signalling (using the same trunk used for -- more -- Current Directory: [Archives/Cyberspace/Journals/LOD] [Archives]: Directory: * lod-1 213571 16-Mar-92 lod-2 148592 16-Mar-92 lod-3 167909 16-Mar-92 lod-4 256202 16-Mar-92 Current Directory: [Archives/Cyberspace/Journals/LOD] [Archives]: Send: lod-1 1669 blocks, 209k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/LOD] [Archives]: Send: lod-2 1161 blocks, 146k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/LOD] [Archives]: Send: lod-3 1312 blocks, 164k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/LOD] [Archives]: Send: lodf-4   -4 2002 blocks, 251k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/LOD] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Misc Current Directory: [Archives/Cyberspace/Journals/Misc] [Archives]: Directory: * basic1.net 14534 17-Mar-92 china-2.3 9473 17-Mar-92 cyberspace-1.1 6075 17-Mar-92 elektrix-001 86416 17-Mar-92 hnet.1 69686 17-Mar-92 hu-1.2 79559 17-Mar-92 ppa.2 121252 17-Mar-92 rrg.1 5036 17-Mar-92 tph-1 65643 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Misc] [Archives]: View: rrg.1 [][][][][][][][][][][][][][][][][][][][][][] [] _____ _____ ____ [] [] | _ \ | _ \ / __ \ [] Rebels' Riting Guild [] | |_| | | |_| | | / \_|_ [] ------- ====== >>>>> [] | < | < | | |_ _| [] [] | |\ \ | |\ \ | \__| | [] ############################## [] |__| \__\ o |__| \__\ o \____/ o [] # Newsletter, Vol. 001 # [] [] ############################## [][][][][][][][][][][][][][][][][][][][][][] >>> By: The Crypt Keeper Copyright (c) 1991, The Crypt Keeper/RRG 07/03/91 -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- * ALL* RRG files are for *INFORMATIONAL* purposes ONLY and they are not to be taken lightly. Though we write about these activities, we by NO WAY WHATSOEVER encourage their usage, but they should be for humorous reading and education ONLY. Call the RRG's HQ! -- more -- Current Directory: [Archives/Cyberspace/Journals/Misc] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: NARC Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Directory: * narc.01 5210 17-Mar-92 narc.02 5327 17-Mar-92 narc.03 7871 17-Mar-92 narc.04 7327 17-Mar-92 narc.05 4831 17-Mar-92 narc.06 4406 17-Mar-92 narc.07 8283 17-Mar-92 narc.08 3716 17-Mar-92 narc.09 5555 17-Mar-92 narc.10 3350 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: View: narc.01 ---------------------------------- f N.A.R.C. Newsletter Issue #1 / f Written by: The Oxidizer / f September 12, 1989 / ====================== What is N.A.R.C.? ----------------------------- First of all, it stands for: Nuclear Phreakers/Hackers/Carders N A R C Pretty creative, eh? Well, if you're wondering where the 'Nuclear' came from, that's because the home of N.A.R.C. is located on Nuclear Wasteland. N.A.R.C. is about 2 months old as of today and currently has 6 members in it. It is phreak/hack/card club so we can hack and share our info with the rest of the members without getting our codez abused and getting many codez/cardz daily. On it we also post valuable info on practically every system that is hackable. heh. We also go into detail for each other on what we know best so we can hack/use everything to our full advantage. -- more -- Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.01 41 blocks, 6k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.02 42 blocks, 6k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.03 62 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.04 58 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: .11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.06 35 blocks, 5k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.07 65 blocks, 9k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.08 30 blocks, 4k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.09 44 blocks, 6k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Send: narc.10 27 blocks, 4k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NARC] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: NFX Current Directory: [Archives/Cyberspace/Journals/NFX] [Archives]: Directory: * nfx-1 16024 17-Mar-92 nfx-2 41918 17-Mar-92 nfx-3 26341 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/NFX] [Archives]: View: nfx-`1  1 The newsletter of the Society for the Freedom of Information (SFI) ======================================= T H E N E W F O N E E X P R E S S ======================================= Electronic Edition ------------------------------------------------------------------------------ The publisher, SFI, distribution site(s), and authors contributing to the NFX are protected by the Bill of Rights in the U.S. Constitution, which specifically permits freedom of speech and freedom of the press. We accept article submissions of nearly any sort, about hack/phreak/anarchy/gov't/etc. The printed edition of the newsletter may be available soon. The info will appear here as soon as possible. To be quite honest, the printed version looks a hell of a lot better; but as of now, only the members of SFI receive it. -- more -- Current Directory: [Archives/Cyberspace/Journals/NFX] [Archives]: Directory: * nfx-1 16024 17-Mar-92 nfx-2 41918 17-Mar-92 nfx-3 26341 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/NFX] [Archives]: Send: nfx-1 126 blocks, 16k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NFX] [Archives]: Send: nfx-2 328 blocks, 41k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NFX] [Archives]: Send: nfx-3 206 blocks, 26k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NFX] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: NIA Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Directory: * nia-01 12291 17-Mar-92 nia-02 10357 17-Mar-92 nia-03 11284 17-Mar-92 nia-04 19346 17-Mar-92 nia-05 16751 17-Mar-92 nia-06 18120 17-Mar-92 nia-07 12786 17-Mar-92 nia-08 17492 17-Mar-92 nia-09 8686 17-Mar-92 nia-10 17308 17-Mar-92 nia-11 8003 17-Mar-92 nia-12 62323 17-Mar-92 nia-13 20111 17-Mar-92 nia-14 14038 17-Mar-92 nia-15 5961 17-Mar-92 nia-16 13562 17-Mar-92 nia-17 14131 17-Mar-92 nia-18 14663 17-Mar-92 nia-19 22389 17-Mar-92 nia-20 21223 17-Mar-92 nia-21 6104 17-Mar-92 nia-22 41440 17-Mar-92 -- more -- nia-23 17763 17-Mar-92 nia-24 21238 17-Mar-92 nia-25 25879 17-Mar-92 nia-26 24125 17-Mar-92 nia-27 22932 17-Mar-92 nia-28 24912 17-Mar-92 nia-29 18846 17-Mar-92 nia-30 2858 17-Mar-92 nia-31 2341 17-Mar-92 nia-32 27854 17-Mar-92 nia-33 9602 17-Mar-92 nia-34 13193 17-Mar-92 nia-35 5325 17-Mar-92 nia-36 7805 17-Mar-92 nia-37 102343 17-Mar-92 nia-38 14810 17-Mar-92 nia-39 9608 17-Mar-92 nia-40 7500 17-Mar-92 nia-41 7026 17-Mar-92 nia-42 23976 17-Mar-92 nia-43 13556 17-Mar-92 nia-44 10227 17-Mar-92 -- more -- nia-45 3418 17-Mar-92 nia-46 11098 17-Mar-92 nia-47 15998 17-Mar-92 nia-48 4724 17-Mar-92 nia-49 26138 17-Mar-92 nia-50 20342 17-Mar-92 nia-51 6991 17-Mar-92 nia-52 16660 17-Mar-92 nia-53 107922 17-Mar-92 nia-54 6206 17-Mar-92 nia-55 7949 17-Mar-92 nia-56 7463 17-Mar-92 nia-57 46974 17-Mar-92 nia-58 51760 17-Mar-92 nia-59 8105 17-Mar-92 nia-60 33970 17-Mar-92 nia-61 3749 17-Mar-92 nia-62 13173 17-Mar-92 nia-63 45962 17-Mar-92 nia-64 15127 17-Mar-92 nia-65 7989 17-Mar-92 nia-66 4809 17-Mar-92 -- more -- nia-67 66243 17-Mar-92 nia-68 222960 17-Mar-92 nia-69 344342 17-Mar-92 nia-70 452505 17-Mar-92 nia-71 286247 17-Mar-92 nia-72 320084 17-Mar-92 nia-73 235786 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-01 97 blocks, 13k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-02 81 blocks, 11k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nis a-03 89 blocks, 12k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-04 152 blocks, 19k, with Z protocol .11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-05 131 blocks, 17k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-06 142 blocks, 18k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-07 100 blocks, 13k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-08 137 blocks, 18k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia09 File not found, nia09 Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-09 68 blocks, 9k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: .11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-11 63 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-12 487 blocks, 61k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-13 158 blocks, 20k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-14 110 blocks, 14k, with Z protocol 6-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-15 47 blocks, 6k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-16 106 blocks, 14k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-17 111 blocks, 14k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-18 115 blocks, 15k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-19 175 blocks, 22k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-20 166 blocks, 21k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-21 48 blocks, 6k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-22 324 blocks, 41k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-23 139 blocks, 18k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-24 166 blocks, 21k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-25 203 blocks, 26k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-26 189 blocks, 24k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-27 180 blocks, 23k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: niz-28 File not found, niz-28 Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: rchives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: niz-   ia-28 195 blocks, 25k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-29 148 blocks, 19k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-30 23 blocks, 3k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-31 19 blocks, 3k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: New Files since (default: 29-Apr-93): ia-32      Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-32 218 blocks, 28k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-33 76 blocks, 10k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-34 104 blocks, 13k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-35 42 blocks, 6k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-36 61 blocks, 8k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-37 800 blocks, 100k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-38 116 blocks, 15k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-39 76 blocks, 10k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-40 59 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-41 55 blocks, 7k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-42 188 blocks, 24k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: b nia-43 106 blocks, 14k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-44 80 blocks, 10k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-45 27 blocks, 4k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-46 87 blocks, 11k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-47 125 blocks, 16k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-48 37 blocks, 5k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-49 205 blocks, 26k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-50 159 blocks, 20k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-51 55 blocks, 7k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-52 131 blocks, 17k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-53 844 blocks, 106k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-54 49 blocks, 7k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-55 63 blocks, 8k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nias-56    -56 59 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-57 367 blocks, 46k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-58 405 blocks, 51k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-59 64 blocks, 8k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-60 266 blocks, 34k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: niz a-61 30 blocks, 4k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-62 103 blocks, 13k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-63 360 blocks, 45k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: niz a-64 119 blocks, 15k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-65 63 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-66 38 blocks, 5k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-67 518 blocks, 65k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-68 1742 blocks, 218k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-68 9 2691 blocks, 337k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-70 3536 blocks, 442k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-71 2237 blocks, 280k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-72 2501 blocks, 313k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Send: nia-73 1843 blocks, 231k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NIA] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: NSA Current Directory: [Archives/Cyberspace/Journals/NSA] [Archives]: Directory: * nsa-1.1 35688 16-Mar-92 nsa-1.2 33172 16-Mar-92 nsa-1.3 48676 16-Mar-92 nsa-1.4 82665 16-Mar-92 Current Directory: [Archives/Cyberspace/Journals/NSA] [Archives]: Send: nsa-1.1 279 blocks, 35k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NSA] [Archives]: Send: nsa-1.2 260 blocks, 33k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NSA] [Archives]: Send: nsa-1.3 381 blocks, 48k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NSA] [Archives]: Send: nsa-1.4 646 blocks, 81k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/NSA] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: PHUN Current Directory: [Archives/Cyberspace/Journals/PHUN] [Archives]: Directory: * phun-1 81603 16-Mar-92 phun-2 151367 16-Mar-92 phun-3 241514 16-Mar-92 phun-4 207097 16-Mar-92 phun-5 140588 16-Mar-92 Current Directory: [Archives/Cyberspace/Journals/PHUN] [Archives]: Send: phun-1 638 blocks, 80k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/PHUN] [Archives]: Send: phun-2 1183 blocks, 148k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/PHUN] [Archives]: Send: phun-3 1887 blocks, 236k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/PHUN] [Archives]: Send: phun-4 1618 blocks, 203k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/PHUN] [Archives]: Send: phun-5 1099 blocks, 138k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/PHUN] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- TAP < DIR > 30-May-92 Worldview < DIR > 26-Oct-92 cDc < DIR > 8-Jan-93 Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: PPP Current Directory: [Archives/Cyberspace/Journals/PPP] [Archives]: Directory: * ppp.1 8449 17-Mar-92 ppp.2 21077 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/PPP] [Archives]: View: ppp.1 ------------------------------------------------ P H U C K I N' P H I E L D P H R E A K E R S Newsletter #1 (aka Outdoor Life) ------------------------------------------------ Disclaimer: PPP, Phuckin' Phield Phreakers, take no responsibility of the individual or group actions which may result from exposition to this documented material. PPP and its members do not endorse or encourage (or participate) in any of the illegal or illicit activity herein written in this document. In otherwords, we are not responsible for you, and when it comes to doing what we say, our motto is "Just say no." -- more -- Current Directory: [Archives/Cyberspace/Journals/PPP] [Archives]: Send: ppp1.  .1 67 blocks, 9k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/PPP] [Archives]: Send: ppp.2 165 blocks, 21k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/PPP] [Archives]: Directory: * ppp.1 8449 17-Mar-92 ppp.2 21077 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/PPP] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Phsntasy No such directory. You must match upper and lowercase in directory names exactly as they appear! Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Phantasy Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Directory: * v1n1 24971 17-Mar-92 v1n2 27050 17-Mar-92 v1n3 25251 17-Mar-92 v2n4 37567 17-Mar-92 v2n5 29898 17-Mar-92 v3n6 53818 17-Mar-92 v3n7 55005 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Send: v1n1 196 blocks, 25k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: View: v1n1 -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- = = - WELCOME TO THE PREMIER ISSUE OF - = = - -=>PHANTASY<=- - = = - A MONTHLY PUBLICATIOM AND NEWSLETTER OF - = = - THE - = INTERNATIONAL = - INFORMATION - = RETREIVAL = - GUILD - = = -=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=- Volume Number One, Issue Number One Dated 10/31/90 Table of Discontents: [1] The IIRG meets the FBI (Part 1) -- more -- [2] What is The IIRG and why should I support it? [3] PHANTASY NEWS [4] Listing of PHANTASY Distribution Sites OFFICIAL DISLAIMER... All information in PHANTASY is from USER contributed material The Publishers and Editors of PHANTASY and THE IIRG disclaim any liability from any damages of any type that reader or user of information contained within this newsletter may encounter from the use of said information. PHANTASY is (C) 1990 by The IIRG IIRG and INTERNATIONAL INFORMATION RETREIVAL GUILD is (C) 1982 Editors Note- For Printing PHANTASY uses a 50 line page format by 80 Columns -- more -- Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Directory: * v1n1 24971 17-Mar-92 v1n2 27050 17-Mar-92 v1n3 25251 17-Mar-92 v2n4 37567 17-Mar-92 v2n5 29898 17-Mar-92 v3n6 53818 17-Mar-92 v3n7 55005 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Send: v1n2 212 blocks, 27k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Send: v1n3 198 blocks, 25k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Send: v2n4 294 blocks, 37k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Send: v2n5 234 blocks, 30k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Send: Message from [enzyme] (Enzyme): I seeeee youuuuuuu! w  Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Send: v2n6   3n6 421 blocks, 53k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Send: v3n7 430 blocks, 54k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Phantasy] [Archives]: Quit.. (5:30am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (5:30am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: page enzyme -=/[ Enter your Message [04 Lines Maximum] / Press [Return] TWICE to Send ]/=- > Haha, berry funny ---======={[ Sl PlaT! :) > -=/] Message Sent! (5:30am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: who  MindVox [WHO] Listing ___________ _____________________ ________ ___________________________________ | | | | | | Account | Name | Page | Login Time | |___________|_____________________|________|___________________________________| (7 Accounts Currently Active) universe Universe YES Fri Apr 30 05:19:26 1993 drow Doug Rau NO Fri Apr 30 05:21:12 1993 sulam James Waldrop YES Thu Apr 29 13:41:07 1993 unseen Sara Jane Levinson YES Fri Apr 30 03:08:16 1993 enzyme Enzyme YES Fri Apr 30 05:12:17 1993 phaedra jane weaver NO Fri Apr 30 00:13:22 1993 dack Paul Recon NO Fri Apr 30 00:18:28 1993 (5:31am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: archives  MindVox [ARCHIVES] Library Type "?" to Display the MENU or Select [H]elp for detailed assistance Current Directory: [Archives] [Archives]: Change Directory: Cyberspace Current Directory: [Archives/Cyberspace] [Archives]: Change Directory: Jourb nals Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Phrack Current Directory: [Archives/Cyberspace/Journals/Phrack] [Archives]: Directory: * phrack-01 29195 17-Mar-92 phrack-02 55272 17-Mar-92 phrack-03 58852 17-Mar-92 phrack-04 93420 17-Mar-92 phrack-05 123015 17-Mar-92 phrack-06 274892 17-Mar-92 phrack-07 94983 17-Mar-92 phrack-08 110494 17-Mar-92 phrack-09 93993 17-Mar-92 phrack-10 86448 17-Mar-92 phrack-11 121103 17-Mar-92 phrack-12 113158 17-Mar-92 phrack-13 91400 17-Mar-92 phrack-14 99398 17-Mar-92 phrack-15 68481 17-Mar-92 phrack-16 68112 17-Mar-92 phrack-17 129662 17-Mar-92 phrack-18 146763 17-Mar-92 phrack-19 73530 17-Mar-92 phrack-20 321607 17-Mar-92 phrack-21 237367 17-Mar-92 phrack-22 255579 17-Mar-92 -- more -- phrack-23 173968 17-Mar-92 phrack-24 209817 17-Mar-92 phrack-25 194781 17-Mar-92 phrack-26 218735 17-Mar-92 phrack-27 294816 17-Mar-92 phrack-28 231529 17-Mar-92 phrack-29 235777 17-Mar-92 phrack-30 220015 17-Mar-92 phrack-31 166188 17-Mar-92 phrack-32 336568 17-Mar-92 phrack-33 379811 17-Mar-92 phrack-34 155580 17-Mar-92 phrack-35 393794 17-Mar-92 phrack-36 186602 17-Mar-92 phrack-37 343901 21-Mar-92 phrack-38 364662 18-Aug-92 phrack-39 317929 18-Aug-92 phrack-40 702246 18-Aug-92 phrack-41 356726 8-Jan-93 phrack-42 464181 31-Mar-93 phrack.index 51307 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Phrack] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Pirate Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Directory: * pirate.1 94932 16-Mar-92 pirate.2 205948 16-Mar-92 pirate.3 136370 16-Mar-92 pirate.4 171304 16-Mar-92 pirate.5 115472 16-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: View: pirate.1 ******************************************************* ** _______ ____ ** ** IIIII I IIIII IIIII I I ** ** I II I I II I I I I____ ** ** III I III IIIII I I ** ** I I I I I I I I ** ** I I I I I I I I____ ** **keepin' the dream alive ** ******************************************************* -=> VOLUME 1, ISSUE 1, June, 1989 <=- **** WELCOME **** To the first issue of -=* PIRATE *=-! Special thanks for getting this issue out go to: Jedi Spanky Jim Richards Hatchet Molly Chris Robin -- more -- Maxx Cougar Taran King Knight Lightning Flint The Man Any comments, or if you want to contribute, most of us can be reached at one of the following boards: GREAT ESCAPE (312) 535-2761 >>> PIRATE HOME BOARD SYCAMORE ELITE (815) 895-5733 THE UNDERGROUND (201) 957-1976 PACIFIC ALLIANCE (818) 280-5710 BITNET ADDRESS (Chris Robin): TK0EEE1@NIU.BITNET +++++++++++++++++++++++++++++++++++++++++++++++++++++ Our goal is to share knowledge, gossip, information, and tips for warez hobbyists. TABLE OF CONTENTS *. What's a Pirate? -- more -- *. Pirate Do's and Don'ts *. Pirate tips *. Why Software ownership is bad for society *. Copyright Law *. Computer laws in Wisconsin *. Editorial: Big Brother in the Computer Room? *. Sysop's corner *. What's hot, what's not *. Wants and Needs *. Board Review of the Month: THE GREAT ESCAPE *. A few decent boards ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ * * * * SO YOU WANT TO BE A PIRATE? * * * * ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ What's a pirate? COMPUTER PIRACY is copying and distribution of copyright software (warez). Pirates are hobbyists who enjoy collecting and playing with the latest programs. Most pirates enjoy collecting warez, getting them running, and then generally archive them, or store them away. A PIRATE IS NOT A BOOTLEGGER. Bootleggers are to piracy what a -- more -- Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Directory: * pirate.1 94932 16-Mar-92 pirate.2 205948 16-Mar-92 pirate.3 136370 16-Mar-92 pirate.4 171304 16-Mar-92 pirate.5 115472 16-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Message from [enzyme] (Enzyme): well I thought it wasn't half bad ;) Quit.. (5:32am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: page enzyme -=/[ Enter your Message [04 Lines Maximum] / Press [Return] TWICE to Send ]/=- > Haha ! BTW - you're my first "real                  the first "real person" to speak to me hee :   re :) I'm > rather new > -=/] Message Sent! (5:33am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: archives  MindVox [ARCHIVES] Library Type "?" to Display the MENU or Select [H]elp for detailed assistance Current Directory: [Archives] [Archives]: Change Directory: Cyberspace Current Directory: [Archives/Cyberspace] [Archives]: Change Directory: Journals Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Pirate Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Directory: * pirate.1 94932 16-Mar-92 pirate.2 205948 16-Mar-92 pirate.3 136370 16-Mar-92 pirate.4 171304 16-Mar-92 pirate.5 115472 16-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Send: pirate.1 742 blocks, 93k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Send: pirate.2 1609 blocks, 202k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Send: pirate.3 1066 blocks, 134k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Send: pirate.4 1339 blocks, 168k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Send: pirate.5 903 blocks, 113k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Pirate] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Syndicate Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Directory: * synd-01 6680 16-Mar-92 synd-02 6229 16-Mar-92 synd-03 5458 16-Mar-92 synd-04 8166 16-Mar-92 synd-05 8584 16-Mar-92 synd-06 11428 17-Mar-92 synd-07 9445 17-Mar-92 synd-08 11365 17-Mar-92 synd-09 11970 17-Mar-92 synd-10 11371 17-Mar-92 synd-11 10383 17-Mar-92 synd-12 11274 17-Mar-92 synd-13a 8245 17-Mar-92 synd-13b 14850 17-Mar-92 synd-14 17365 17-Mar-92 synd-15a 15540 17-Mar-92 synd-15b 13036 17-Mar-92 synd-16a 15181 17-Mar-92 synd-17 14446 17-Mar-92 synd-20a 20068 17-Mar-92 synd-20b 18740 17-Mar-92 synd-21 47975 17-Mar-92 -- more -- synd-23 37628 17-Mar-92 synd-25 49182 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: View: synd-01 ===========================@=============================================== NorthWestern Syndicate Presents: THE SYNDICATE REPORT Issue No. 1 Written by The Sensei =========================================================================== Introduction: This file of many to come, will be available to users through-out the datacommunications world. It's purpose is to strictly inform users on current Bell information, and other assorted bits of news which I think will benefit users. NOTE: This is as I said before, strictly Bell information, and without some background could cause a problem to understand completely. =========================================================================== -- more -- PC SYSTEMS/EXCHANGE NAME CHANGE: PC Systems/Exchange has changed to NorthWestern Syndicate. Also, if you have been calling the number above, and keep getting a Bell recording, take it easy. NWS will be up soon enough. I will estimate on the 6th month, of the 1st day. This is just an approximation. And If decide to not set it up, then don't call. I'll simply not use the number anymore in my files. =========================================================================== CCSN CARD HOLDERS: Corporate Communications advises that, for Bell Employees' convenience, starting April 14, they will hear an additional dial tone when using their CCSN Calling Card. Existing instructions indicate that before entering the authorization code they "PAUSE FOR 3 SECONDS...THEN"; effective April 14, that instruction will be "LISTEN FOR DIAL TONE...THEN". Information on CCSN Cards, please get a hold on me. On most popular Ascii Express Lines/Bul.Board Systems. -- more -- Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Directory: * synd-01 6680 16-Mar-92 synd-02 6229 16-Mar-92 synd-03 5458 16-Mar-92 synd-04 8166 16-Mar-92 synd-05 8584 16-Mar-92 synd-06 11428 17-Mar-92 synd-07 9445 17-Mar-92 synd-08 11365 17-Mar-92 synd-09 11970 17-Mar-92 synd-10 11371 17-Mar-92 synd-11 10383 17-Mar-92 synd-12 11274 17-Mar-92 synd-13a 8245 17-Mar-92 synd-13b 14850 17-Mar-92 synd-14 17365 17-Mar-92 synd-15a 15540 17-Mar-92 synd-15b 13036 17-Mar-92 synd-16a 15181 17-Mar-92 synd-17 14446 17-Mar-92 synd-20a 20068 17-Mar-92 synd-20b 18740 17-Mar-92 synd-21 47975 17-Mar-92 -- more -- Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd0 -02 1 53 blocks, 7k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-02 49 blocks, 7k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-03 43 blocks, 6k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-04 64 blocks, 8k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-05 68 blocks, 9k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-06 90 blocks, 12k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd07  -08 7 74 blocks, 10k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-08 89 blocks, 12k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-09 94 blocks, 12k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-10 89 blocks, 12k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-11 82 blocks, 11k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-12 89 blocks, 12k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-13a 65 blocks, 9k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-13b 117 blocks, 15k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-14 136 blocks, 17k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-15a 122 blocks, 16k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-15b 102 blocks, 13k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-16a 119 blocks, 15k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-16b File not found, synd-16b Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-17 113 blocks, 15k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-20a 157 blocks, 20k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-20b 147 blocks, 19k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-21 375 blocks, 47k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-23 294 blocks, 37k, with Z protocol rz **B00000000000000 Š.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Send: synd-25 385 blocks, 49k, with Z protocol rz **B00000000000000 Š sz 3.11 02-26-91 finished. Current Directory: [Archives/Cyberspace/Journals/Syndicate] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- TAP < DIR > 30-May-92 Worldview < DIR > 26-Oct-92 cDc < DIR > 8-Jan-93 Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: TAP Current Directory: [Archives/Cyberspace/Journals/TAP] [Archives]: Directory: * tap.1 239001 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/TAP] [Archives]: View: tap.1 Listing of Contents to TAP Magazine Online #1 Tap 1.01 Intro to Tap Online Tap 1.02 Subscription to Tap Magazine Information Tap 1.03 Department of Defense Network Tap 1.04 TAC Access Control System by Argonaut Tap 1.05 Department of Defense Host Listing Tap 1.06 Letters to Tap Magazine Tap 1.07 Hacking Answering Machines by Predat0r Tap 1.08 NASA Space Shuttle Press Kit Tap 1.09 Ringback in the 502 NPA by Predat0r Tap 1.10 Tymcard Challenge by Techno-Cowboy Tap 1.11 Abbreviation List by Predat0r Tap 1.12 California Bbs Listing Tap 1.13 Nynex by Nightcrawler Tap 1.14 Red Phone Bbs Buffer Tap 1.15 Guide to school lockers by Cablecast Operator & Silver Sphere Tap 1.16 How to contact TAP via the WWIVnet with Wwivnet listing Welcome to the first issue of TAP Magazine Online. Publishing an electronic -- more -- newsletter is somewhat easier then the hardcopy TAP, but i think i can continue to do this with some regularity, while still publishing TAP Magazine. It feels i am jumping on the band wagon since now days it seems everyone is publishing their own newsletter just to be famous or well known. I salute the true pioneers who have stuck it out and to those who have been inspirations to us all. The freedom of information shall never die as long as a few dedicated people continue to fight for our given rights. I have no set format yet, and don't plan on making anything fancy. I have just collected a few text files and thrown them together for those out there to read. If you want to get something included in TAP you can send it to me. If you want to get TAP Online issues first call the following boards. Blitzkrieg 502-499-8933 home to TAP and myself. Amerika's Most Wanted Bbs 502-491-2749 Hall of Injustice 502-241-9304 All these systems have been up for at least six months and are 24 hours. I would like to have other boards in different area codes distribute for me also, so if you want to do this contact me. -- more -- I would now like to greet my fellow friends whom i have met in the computer underground. If i leave anyone out i am sorry. The Last Mafioso & The West Coast Phone Phreaks of Anarchist Express. Where the hell did you all disappear to? Iron Feather Journal, Phantasy, Phrack, Computer Underground Digest, Activist Times Inc and Ground Zero & TCC Crew, Network Information Access, and any other group which sends their files to my bbs regularly. Greets goto Aristotle who helped restart TAP then decided he wanted out. So now what are you going to do write for 2600? I hope not, sellout! and now sit back and enjoy the show..... Predat0r / Editor & Publisher of TAP Magazine. Subscription Information ============ =========== $10.00 for 10 issues USA rate. $15.00 for 10 issues in Canada. -- more -- $20.00 for 10 issues Overseas. TAP Magazine will take CASH, Money Orders, Checks, or Postal Money Orders. Send to the following: TAP Magazine Post Office Box 20264 Louisville, Kentucky 40250-0264 Predat0r / Editor & Publisher of TAP Magazine. Subscription Information ============ =========== $10.00 for 10 issues USA rate. $15.00 for 10 issues in Canada. $20.00 for 10 issues Overseas. -- more -- TAP Magazine will take CASH, Money Orders, Checks, or Postal Money Orders. Send to the following: TAP Magazine Post Office Box 20264 Louisville, Kentucky 40250-0264 Greetings fellow CyberNauts: This gem was downloaded from the DDN on the InterNet. It is a good guide for learning to hack the Net. If you like what you see leave note for Argonaut at Rivendell BBS (816) 563-4845. This is my Home of Port and a small but growing hack/phreak node. The Argonaut =========================================================================== -- more -- FEATURES OF THE TAC ACCESS CONTROL SYSTEM (TACACS) To log in to the network via a MILNET TAC, you MUST have a unique ID and Access Code (TAC Access Card). These cards are issued by the DDN Network Information Center (NIC) only after a user has been authorized by the Host Administrator of the host on which the user has his primary mailbox or account. IF YOU HAVE NOT RECEIVED YOUR TAC ACCESS CARD, AND HAVE A LEGITIMATE REQUIREMENT TO ACCESS THE NETWORK VIA A MILNET TAC, CONTACT YOUR HOST ADMINISTRATOR! (DO NOT CONTACT THE NIC FOR AUTHORIZATION). If you do not know who your Host Administrator is, you may find out by using the "WHOIS" command on the NIC.DDN.MIL host. Instructions on using "WHOIS" are as follows: When you finish reading this message, type "quit" as instructed. After the connection to NIC.DDN.MIL is closed, type "@n" again. You will be told how to find your Host Administrator. When finished, type "logout" at the prompt and you will be returned to the TAC. ---------------------------------------------------------------------- -- more -- Current Directory: [Archives/Cyberspace/Journals/TAP] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- TAP < DIR > 30-May-92 Worldview < DIR > 26-Oct-92 cDc < DIR > 8-Jan-93 Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: Worldview Current Directory: [Archives/Cyberspace/Journals/Worldview] [Archives]: Directory: * worldview-1.1 321909 17-Mar-92 worldview-1.10 32812 17-Mar-92 worldview-1.2 73740 17-Mar-92 worldview-1.3 40127 17-Mar-92 worldview-1.4 47678 17-Mar-92 worldview-1.5 30380 17-Mar-92 worldview-1.6 40310 17-Mar-92 worldview-1.7 26539 17-Mar-92 worldview-1.8 47898 17-Mar-92 worldview-1.9 46112 17-Mar-92 worldview-2.1 48662 17-Mar-92 Current Directory: [Archives/Cyberspace/Journals/Worldview] [Archives]: View: worldview-1.1 Weltanschauung Magazine (The WorldView) %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% % % % Editor: The Desert Fox D E R % % Co-Editor: Rev. Scott Free % % % % W E L T A N S C H A U U N G % % % %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% April 4, 1991 Vol. 1, Issue 1. (*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*)(*) Material Written By Computer And Telecommunications Hobbyists World Wide Promoting the publication of Features, Editorials, and Anything Else.... To submit material, or to subscribe to the magazine in hardcopy, send a SASE to: WorldView 11504 Hughes #124 ø Weltanschauu¤g Distribution Site: Houston, Texas U.S.A. 77089 Rivendell BBS ******************************************* (713)333-XXXX * Please submit articles and comments to: * 3/12/2400 Bps * INTERNET - Fox@nuchat.sccsi.com * (The New BBS will be ******************************************* up May 1, 1991) -- more -- If Possible...Otherwise, Mail Or Call! ****************************************************************** *IN THE NEXT ISSUE *** Unix features, More On Robert Morris, Info* *On The New Rivendell BBS Including The New Phone Number, An * *Editorial By The Reverand Scott Free, Plus Much More... * ****************************************************************** Table Of Contents: I. The Shockwave Rider: A mini-biography on Robert T. Morris, the creator of the Internet Worm. II. Wordless: An editorial by Homer Mandril III. The State Of National Security: An editorial by The Desert Fox and Lord Macduff IV. The complete explination of BEER*NET V. Torts: Some handy information on laws governing the world of -- more -- communications, by James J. Spinelli VI. HR 4070 [The story behind Homer Mandrill's Editorial] VII. Editor's Comments Title: The Shockwave Rider. (background on Robert T. Morris Jr., author of the Internet 'worm') Author: Unknown -- more -- Current Directory: [Archives/Cyberspace/Journals/Worldview] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: CdC No such directory. You must match upper and lowercase in directory names exactly as they appear! Current Directory: [Archives/Cyberspace/Journals] [Archives]: Change Directory: cDc Current Directory: [Archives/Cyberspace/Journals/cDc] [Archives]: Directory: * Missing 24 23-Dec-92 cDc-200 124156 23-Dec-92 cdc-1 3355 23-Dec-92 cdc-10 9173 23-Dec-92 cdc-100 43563 23-Dec-92 cdc-101 8737 23-Dec-92 cdc-102 10557 23-Dec-92 cdc-103 5356 23-Dec-92 cdc-104 4528 23-Dec-92 cdc-105 23922 23-Dec-92 cdc-106 7507 23-Dec-92 cdc-107 7695 23-Dec-92 cdc-108 3777 23-Dec-92 cdc-109 26588 23-Dec-92 cdc-11 15364 23-Dec-92 cdc-110 25662 23-Dec-92 cdc-111 15394 23-Dec-92 cdc-112 12851 23-Dec-92 cdc-114 7556 23-Dec-92 cdc-115 12755 23-Dec-92 cdc-116 6893 23-Dec-92 cdc-117 5133 23-Dec-92 -- more -- cdc-118 4954 23-Dec-92 cdc-119 41721 23-Dec-92 cdc-12 8600 23-Dec-92 cdc-120 7382 23-Dec-92 cdc-121 7183 23-Dec-92 cdc-122 5698 23-Dec-92 cdc-123 19276 23-Dec-92 cdc-124 4761 23-Dec-92 cdc-125 16342 23-Dec-92 cdc-126 7625 23-Dec-92 cdc-127 7172 23-Dec-92 cdc-128 7663 23-Dec-92 cdc-129 9412 23-Dec-92 cdc-13 7009 23-Dec-92 cdc-130 5002 23-Dec-92 cdc-131 5436 23-Dec-92 cdc-132 3988 23-Dec-92 cdc-133 6143 23-Dec-92 cdc-134 7436 23-Dec-92 cdc-135 6095 23-Dec-92 cdc-136 7831 23-Dec-92 cdc-137 7920 23-Dec-92 -- more -- cdc-138 14920 23-Dec-92 cdc-139 6486 23-Dec-92 cdc-14 17971 23-Dec-92 cdc-140 19789 23-Dec-92 cdc-141 13381 23-Dec-92 cdc-142 7150 23-Dec-92 cdc-143 8330 23-Dec-92 cdc-144 7278 23-Dec-92 cdc-145 10851 23-Dec-92 cdc-146 6822 23-Dec-92 cdc-147 4993 23-Dec-92 cdc-148 10117 23-Dec-92 cdc-149 10225 23-Dec-92 cdc-15 19389 23-Dec-92 cdc-150 23017 23-Dec-92 cdc-151 41594 23-Dec-92 cdc-152 11074 23-Dec-92 cdc-153 15638 23-Dec-92 cdc-154 5949 23-Dec-92 cdc-155 31083 23-Dec-92 cdc-156 16693 23-Dec-92 cdc-157 16746 23-Dec-92 -- more -- cdc-158 5003 23-Dec-92 cdc-159 5493 23-Dec-92 cdc-16 4435 23-Dec-92 cdc-160 10186 23-Dec-92 cdc-161 19764 23-Dec-92 cdc-162 8743 23-Dec-92 cdc-163 7389 23-Dec-92 cdc-164 6661 23-Dec-92 cdc-165 23938 23-Dec-92 cdc-166 39143 23-Dec-92 cdc-167 41232 23-Dec-92 cdc-168 6688 23-Dec-92 cdc-169 8702 23-Dec-92 cdc-17 3856 23-Dec-92 cdc-170 9210 23-Dec-92 cdc-171 13474 23-Dec-92 cdc-172 6053 23-Dec-92 cdc-173 3909 23-Dec-92 cdc-174 10822 23-Dec-92 cdc-175 11510 23-Dec-92 cdc-176 9819 23-Dec-92 cdc-177 18108 23-Dec-92 -- more -- cdc-178 5169 23-Dec-92 cdc-179 21657 23-Dec-92 cdc-18 5525 23-Dec-92 cdc-180 10369 23-Dec-92 cdc-181 11449 23-Dec-92 cdc-182 5420 23-Dec-92 cdc-183 9684 23-Dec-92 cdc-184 3813 23-Dec-92 cdc-185 13774 23-Dec-92 cdc-186 37507 23-Dec-92 cdc-187 18375 23-Dec-92 cdc-188 6972 23-Dec-92 cdc-189 3685 23-Dec-92 cdc-19 9176 23-Dec-92 cdc-190 4826 23-Dec-92 cdc-191 13863 23-Dec-92 cdc-192 4468 23-Dec-92 cdc-193 22277 23-Dec-92 cdc-194 17593 23-Dec-92 cdc-195 6858 23-Dec-92 cdc-196 12551 23-Dec-92 cdc-197 8687 23-Dec-92 -- more -- cdc-198 13361 23-Dec-92 cdc-199 28988 23-Dec-92 cdc-2 14946 23-Dec-92 cdc-20 4967 23-Dec-92 cdc-201 11427 8-Jan-93 cdc-202 26362 8-Jan-93 cdc-203 12506 8-Jan-93 cdc-204 12720 8-Jan-93 cdc-205 10321 8-Jan-93 cdc-206 7205 8-Jan-93 cdc-207 6838 8-Jan-93 cdc-208 3712 8-Jan-93 cdc-209 16073 8-Jan-93 cdc-21 3983 23-Dec-92 cdc-210 6669 8-Jan-93 cdc-22 6211 23-Dec-92 cdc-23 9185 23-Dec-92 cdc-24 4891 23-Dec-92 cdc-25 13322 23-Dec-92 cdc-26 6310 23-Dec-92 cdc-27 7724 23-Dec-92 cdc-28 23835 23-Dec-92 -- more -- cdc-29 7347 23-Dec-92 cdc-3 9236 23-Dec-92 cdc-30 2566 23-Dec-92 cdc-31 3752 23-Dec-92 cdc-32 8178 23-Dec-92 cdc-33 3649 23-Dec-92 cdc-34 19295 23-Dec-92 cdc-35 6958 23-Dec-92 cdc-36 18551 23-Dec-92 cdc-37 3540 23-Dec-92 cdc-38 5002 23-Dec-92 cdc-39 3928 23-Dec-92 cdc-4 18689 23-Dec-92 cdc-40 8687 23-Dec-92 cdc-41 18917 23-Dec-92 cdc-42 3650 23-Dec-92 cdc-43 10649 23-Dec-92 cdc-44 4758 23-Dec-92 cdc-45 3664 23-Dec-92 cdc-46 6495 23-Dec-92 cdc-47 11830 23-Dec-92 cdc-48 7674 23-Dec-92 -- more -- cdc-49 3815 23-Dec-92 cdc-5 2460 23-Dec-92 cdc-50 1794 23-Dec-92 cdc-51 8769 23-Dec-92 cdc-52 45404 23-Dec-92 cdc-53 45363 23-Dec-92 cdc-54 46221 23-Dec-92 cdc-55 2006 23-Dec-92 cdc-56 3651 23-Dec-92 cdc-57 7109 23-Dec-92 cdc-58 11407 23-Dec-92 cdc-59 8842 23-Dec-92 cdc-6 4758 23-Dec-92 cdc-60 10910 23-Dec-92 cdc-61 4720 23-Dec-92 cdc-62 4524 23-Dec-92 cdc-63 3981 23-Dec-92 cdc-64 8639 23-Dec-92 cdc-65 7927 23-Dec-92 cdc-66 10779 23-Dec-92 cdc-67 26124 23-Dec-92 cdc-68 20886 23-Dec-92 -- more -- cdc-69 8374 23-Dec-92 cdc-7 2965 23-Dec-92 cdc-71 17667 23-Dec-92 cdc-72 9572 23-Dec-92 cdc-73 3387 23-Dec-92 cdc-74 3091 23-Dec-92 cdc-75 13167 23-Dec-92 cdc-76 12989 23-Dec-92 cdc-77 3732 23-Dec-92 cdc-78 8822 23-Dec-92 cdc-79 4332 23-Dec-92 cdc-8 7209 23-Dec-92 cdc-80 3237 23-Dec-92 cdc-81 8577 23-Dec-92 cdc-82 6635 23-Dec-92 cdc-83 16153 23-Dec-92 cdc-84 12258 23-Dec-92 cdc-85 8242 23-Dec-92 cdc-86 7367 23-Dec-92 cdc-87 6951 23-Dec-92 cdc-88 3493 23-Dec-92 cdc-9 4735 23-Dec-92 -- more -- cdc-90 13105 23-Dec-92 cdc-91 9077 23-Dec-92 cdc-92 5511 23-Dec-92 cdc-93 5813 23-Dec-92 cdc-94 2937 23-Dec-92 cdc-95 12645 23-Dec-92 cdc-96 16945 23-Dec-92 cdc-97 8971 23-Dec-92 cdc-98 7984 23-Dec-92 cdc-99 11590 23-Dec-92 cdc-dist 15060 8-Jan-93 cdc-kc0w 2645 8-Jan-93 cdc-update.10 6773 8-Jan-93 Current Directory: [Archives/Cyberspace/Journals/cDc] [Archives]: View: cdc-98 _______________________________________________________________________________ _ _ _ _ ((___)) ((___)) [ x x ] cDc communications [ x x ] \ / presents... \ / (' ') (' ') (U) (U) On The Porch Swing a screenplay from Forced Exposure 'zine #13 by Suzy Rust >>> A CULT Distribution.....1988 <<< -cDc- CULT OF THE DEAD COW -cDc- _______________________________________________________________________________ A taupe-shingled duplex surrounded by olive trees, grape vines, and other -- more -- fruits of Italian-American truck-farming know-how houses the Boston head- quarters of Baggage Productions, a home movie company where I work as a screen- writer. I arrived there one recent Friday evening to study the reels of Lower East Side Super 8 artists on the VCR with my accomplices. Once Richard Kern had finished ejaculating, I went out to get a pizza. Inside the pizzeria, a dough-thrower in floured clothes made a big fish gesture to his co-worker and raved about marlins in Portuguese. I ordered a large deluxe, extra anchovies. Waiting in a red booth, I gazed at the Holiday Inn parking lot across the street. In its flat stardust, I recalled the works I'd just seen - young sluts, naked but for their wigs, lolling around on crabby mattresses; pretty Nick Zedd, moping on porcelain in his party dress; some dejected girl with a rhinestone through her nose, saying sad and angry things. I thought about how we could emulate the degenerate glamour of those downtown movies. We could put a bunch of people in long leather coats and give them toys to play with: eyeliner, pocket snakes, switchblades, flaking green Coupe de Villes with cat bones hanging from the rear-view mirrors, heroin habbits. We could call it DIRTY NEEDLE SPREE. But why bother, when the thrill of urban blight is already being dealt with so successfully. We should stick to family entertainment, I decided as I carried the pizza up the hill to headquarters. _______________________________________________________________________________ -- more -- Scene 1: ROCK WORSHIP A girl named Matilda and her great aunt Gertrude sit on a porch swing. Gertrude is an old hag with a polio-withered arm who smokes a lot of Kools. The porch where they sit and swing is surrounded by mallow bushes whose wilting puce blooms are the same color and texture as Gertrude's lingerie. Gertrude pops a lemon drop, licks her chin, and begins to talk. "My grandparents came over on a boat from Bohemia. Once here, they set up a dressmaking shop. They did well. But the more money they made, the more they hated each other. "One day my grandfather withdrew all their savings, got drunk, and lost everything at the races. Hungover and broke, he tied a rock to his neck and drowned himself in six inches of pond water. My grandmother brought the rock home from the police station and put it on the mantlepiece in her front parlor, so she could thank it every morning." Cutaway to a single shot of a bustled woman sitting beside a hearth fire. She strokes the rock she holds in her lap, and hums. Scene 2: MOM ENTERS THE NEW AGE -- more -- "Why does your mother spend so much time in the bathroom these days?" Gertrude asks Matilda as they watch the sunset from the porch. "She's trying to rejuvenate herself. The bathroom is her spa." Gertrude lights up a Kool, the sack of flesh on her good arm swaying. "I'd rather play pinochle," she says. "Yeah," says Matilda. Cutaway to several shots of a postmenopausal matron taking enemas by candlelight. She looks into the toilet to catch another glimpse of the past she just expelled - as if the swirl of flushing could foretell the reversal of her future. In the background, surrounded by crystals, a peach-colored cassette deck intones, "You alone have the power to create your own reality." Scene 3: NEXT DOOR WITH THE BRAUERS It has grown late. By yellow porch light, Matilda is reading aloud from INTERVIEW. Gertrude, smoking, looks out into the green dark. "Bill Brauer!" says Matilda, turning a page. "Wow. He used to live next door. I thought he was only good at lawn jobs. But he's a hot new painter." Matilda picks open a bug bite on her shank as she begins to read about Bill. -- more -- Cutaway to years ago, next door. Bill is a wiry fifteen-year-old youth with stringy hair, bagged eyes, and knee-high suede moccasins into which he tucks his jeans. After positioning half of his sister Nancy's thirty plastic horse models in the stud-fuck stance atop the rumps of the other half, Bill opens all of the windows of the second floor sun porch, then sprinkles birdseed on its floors. When a good crop of pigeons has flown in to peck, Bill slides outside and closes the windows with a laundry hook. Then he run upstairs and shoots all the pigeons with a pellet gun. Meanwhile his twelve-year-old sister Nancy, clad in a leopard print bikini, hangs by her knees from a sycamore branch in the back yard and shrieks, "I'm adopted! I'm adopted! I know I'm adopted!" Oblivious, their mother, Cookie, sits at a vanity table in the grey light of her bedroom, slowly smearing on more coral lipstick. Scene 4: LILLY IN THE CITY "I got a postcard from Lilly today," says Matilda, putting down her magazine. "It was a picture of the Manhattan skyline. She wrote, 'I've started wearing white press-on fingernails and big gaudy rings.' I wonder what else she's doing up there. Here she was always on the verge of going to a -- more -- Polynesian restaurant." Gertrude sips her Fresca and says, "She was named after my step-sister Lilly, a gun moll for Jelly Roll Eagan. Cats used to follow that woman everywhere. She died blind at ninety in stiletto heels and falsies, her bathroom wastebasket full of dye gloves. She hardly had any hair left, but what was left was red." Cutaway to a woman out on a fire escape, muttering curses to a sunken moon. Her red hair is a mess. She wears silk charmeuse, and an eyepatch. The camera tracks to the window, then focuses on the room inside, where a man in a muscle shirt erases each eye in every photo of that evening's newspaper. Scene 5: KOOLS Gertrude is snoring, so Matilda reaches over and filches a Kool from her gold lame' cigarette wallet. She snaps the smell of butane shut and draws hard on the butt. Closing her eyes, she remembers her days of smoking menthols. Cutaway to Matilda as an early teen, sauntering up the street to the pinball parlor - her hip hugger bell bottoms swishing the thick dusk, her halter top Egyptian, her belly button on qualudes... the coal of a Kool burnishing her copper eyeshadow. The soundtrack to her saunter is the wail of far off trains. -- more -- Scene 6: THE END Matilda flicks the cigarette in a high arc out to the gutter. Gertrude still snores. Matilda sprays her with OFF and goes inside. _______________________________________________________________________________ Behavior Modification.....806/793-9462 The Dead Zone.............214/522-5321 Demon Roach Underground...806/794-4362 Dragonfire Private........609/424-2606 Question Authority........715/341-6516 Pure Nihilism.............517/337-7319 Tequila Willy's...........209/526-3194 The Metal AE..............201/879-6668 =============================================================================== 1988 cDc communications by Suzy Rust 12/31/88-98 All Rights Worth Shit Current Directory: [Archives/Cyberspace/Journals/cDc] [Archives]: Change Directory: Current Directory: [Archives/Cyberspace/Journals/cDc] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace/Journals] [Archives]: Directory: * ANE < DIR > 26-Oct-92 Anarchy aNd Explosives ATI < DIR > 3-Jan-93 The Activist Times Incorporated Bootlegger < DIR > 3-Jan-93 DFP < DIR > 26-Oct-92 Digital Free Press FBI < DIR > 4-Jan-93 Foreign < DIR > 30-May-92 Foreign Language Newsletters & Texts Globe-Trotter < DIR > 3-Jan-93 Hack < DIR > 3-Jan-93 Informatik < DIR > 3-Jan-93 Kcah < DIR > 3-Jan-93 LOD < DIR > 30-May-92 Legion of Doom Technical Journals Misc < DIR > 4-Jan-93 NARC < DIR > 26-Oct-92 Nuclear Phreakers Hackers Carders NFX < DIR > 26-Oct-92 New Fone eXpress NIA < DIR > 30-May-92 Network Information Access Issues NSA < DIR > 26-Oct-92 National Security Anarchists PHUN < DIR > 26-Oct-92 Phreakers Hackers Underground Network PPP < DIR > 4-Jan-93 Phantasy < DIR > 26-Oct-92 The Phantasy Journal Phrack < DIR > 31-Mar-93 The Collected Issues of Phrack Pirate < DIR > 26-Oct-92 Pirate Magazine Newsletter Syndicate < DIR > 30-May-92 The Syndicate Reports -- more -- TAP < DIR > 30-May-92 Worldview < DIR > 26-Oct-92 cDc < DIR > 8-Jan-93 Current Directory: [Archives/Cyberspace/Journals] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace] [Archives]: Directory: * CUD < DIR > 24-Oct-92 The Computer Underground Digest EFF < DIR > 18-Sep-92 Electronic Frontier Foundation History < DIR > 17-Jan-93 Journals < DIR > 4-Jan-93 Electronic Texts from the Underground Legal < DIR > 30-May-92 Federal & State Laws, Misc. Net Policies Risks < DIR > 19-Nov-92 The Risks Digest Current Directory: [Archives/Cyberspace] [Archives]: Change Directory: le  Legal Current Directory: [Archives/Cyberspace/Legal] [Archives]: Directory: * Cases < DIR > 30-Mar-93 Papers < DIR > 29-Mar-93 School < DIR > 30-May-92 State < DIR > 30-May-92 Current Directory: [Archives/Cyberspace/Legal] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace] [Archives]: Change Directory: Risjs  ks Current Directory: [Archives/Cyberspace/Risks] [Archives]: Directory: * risks-1.00 13351 19-Nov-92 risks-1.01 35446 19-Nov-92 risks-1.02 49123 19-Nov-92 risks-1.03 6520 19-Nov-92 risks-1.04 8858 19-Nov-92 risks-1.05 14301 19-Nov-92 risks-1.06 13082 19-Nov-92 risks-1.07 28667 19-Nov-92 risks-1.08 20318 19-Nov-92 risks-1.09 7456 19-Nov-92 risks-1.10 9695 19-Nov-92 risks-1.11 15362 19-Nov-92 risks-1.12 9825 19-Nov-92 risks-1.13 12378 19-Nov-92 risks-1.14 13358 19-Nov-92 risks-1.15 14252 19-Nov-92 risks-1.16 14479 19-Nov-92 risks-1.17 14594 19-Nov-92 risks-1.18 13956 19-Nov-92 risks-1.19 11666 19-Nov-92 risks-1.20 13659 19-Nov-92 risks-1.21 20908 19-Nov-92 -- more -- risks-1.22 22970 19-Nov-92 risks-1.23 16665 19-Nov-92 risks-1.24 17798 19-Nov-92 risks-1.25 12555 19-Nov-92 risks-1.26 12508 19-Nov-92 risks-1.27 58015 19-Nov-92 risks-1.28 13829 19-Nov-92 risks-1.29 20313 19-Nov-92 risks-1.30 10494 19-Nov-92 risks-1.31 15613 19-Nov-92 risks-1.32 11303 19-Nov-92 risks-1.33 10780 19-Nov-92 risks-1.34 15488 19-Nov-92 risks-1.35 27434 19-Nov-92 risks-1.36 16857 19-Nov-92 risks-1.37 16282 19-Nov-92 risks-1.38 14288 19-Nov-92 risks-1.39 6355 19-Nov-92 risks-1.40 8299 19-Nov-92 risks-1.41 11619 19-Nov-92 risks-1.42 4993 19-Nov-92 risks-1.43 15590 19-Nov-92 -- more -- risks-1.44 5871 19-Nov-92 risks-1.45 8131 19-Nov-92 risks-1.46 13351 19-Nov-92 risks-10.00 40190 19-Nov-92 risks-10.01 22282 19-Nov-92 risks-10.02 33865 19-Nov-92 risks-10.03 29424 19-Nov-92 risks-10.04 19333 19-Nov-92 risks-10.05 23760 19-Nov-92 risks-10.06 27774 19-Nov-92 risks-10.07 23080 19-Nov-92 risks-10.08 18583 19-Nov-92 risks-10.09 14226 19-Nov-92 risks-10.10 22882 19-Nov-92 risks-10.11 13821 19-Nov-92 risks-10.12 28522 19-Nov-92 risks-10.13 28545 19-Nov-92 risks-10.14 10132 19-Nov-92 risks-10.15 32791 19-Nov-92 risks-10.16 22252 19-Nov-92 risks-10.17 23185 19-Nov-92 risks-10.18 13785 19-Nov-92 -- more -- risks-10.19 15451 19-Nov-92 risks-10.20 17547 19-Nov-92 risks-10.21 21493 19-Nov-92 risks-10.21a 6235 19-Nov-92 risks-10.22 23925 19-Nov-92 risks-10.23 18408 19-Nov-92 risks-10.24 17710 19-Nov-92 risks-10.25 30051 19-Nov-92 risks-10.26 11498 19-Nov-92 risks-10.27 19234 19-Nov-92 risks-10.28 26536 19-Nov-92 risks-10.29 14684 19-Nov-92 risks-10.30 21683 19-Nov-92 risks-10.31 27128 19-Nov-92 risks-10.32 20374 19-Nov-92 risks-10.33 14335 19-Nov-92 risks-10.34 21448 19-Nov-92 risks-10.35 25957 19-Nov-92 risks-10.36 19468 19-Nov-92 risks-10.37 19885 19-Nov-92 risks-10.38 25576 19-Nov-92 risks-10.39 21903 19-Nov-92 -- more -- risks-10.40 25717 19-Nov-92 risks-10.41 18872 19-Nov-92 risks-10.42 28868 19-Nov-92 risks-10.43 28116 19-Nov-92 risks-10.44 22834 19-Nov-92 risks-10.45 18214 19-Nov-92 risks-10.46 23843 19-Nov-92 risks-10.47 28931 19-Nov-92 risks-10.48 22004 19-Nov-92 risks-10.49 20221 19-Nov-92 risks-10.50 21027 19-Nov-92 risks-10.51 16523 19-Nov-92 risks-10.52 10028 19-Nov-92 risks-10.53 17958 19-Nov-92 risks-10.54 19236 19-Nov-92 risks-10.55 22629 19-Nov-92 risks-10.56 28587 19-Nov-92 risks-10.57 17993 19-Nov-92 risks-10.58 24409 19-Nov-92 risks-10.59 26350 19-Nov-92 risks-10.60 21491 19-Nov-92 risks-10.61 27020 19-Nov-92 -- more -- risks-10.62 26723 19-Nov-92 risks-10.63 13000 19-Nov-92 risks-10.64 22184 19-Nov-92 risks-10.65 20526 19-Nov-92 risks-10.66 22300 19-Nov-92 risks-10.67 20096 19-Nov-92 risks-10.68 20574 19-Nov-92 risks-10.69 18928 19-Nov-92 risks-10.70 19064 19-Nov-92 risks-10.71 16697 19-Nov-92 risks-10.72 21447 19-Nov-92 risks-10.73 18124 19-Nov-92 risks-10.74 30762 19-Nov-92 risks-10.75 15986 19-Nov-92 risks-10.76 21290 19-Nov-92 risks-10.77 36039 19-Nov-92 risks-10.78 17100 19-Nov-92 risks-10.79 29486 19-Nov-92 risks-10.80 18534 19-Nov-92 risks-10.81 18499 19-Nov-92 risks-10.82 29235 19-Nov-92 risks-10.83 25744 19-Nov-92 -- more -- risks-10.84 24926 19-Nov-92 risks-10.85 23434 19-Nov-92 risks-10.86 40190 19-Nov-92 risks-10.ncs90 28901 19-Nov-92 risks-11.00 45500 19-Nov-92 risks-11.01 27451 19-Nov-92 risks-11.02 13864 19-Nov-92 risks-11.03 29503 19-Nov-92 risks-11.04 29753 19-Nov-92 risks-11.05 23149 19-Nov-92 risks-11.06 27202 19-Nov-92 risks-11.07 21391 19-Nov-92 risks-11.08 22005 19-Nov-92 risks-11.09 22849 19-Nov-92 risks-11.10 26849 19-Nov-92 risks-11.11 27604 19-Nov-92 risks-11.12 29006 19-Nov-92 risks-11.13 22301 19-Nov-92 risks-11.14 18628 19-Nov-92 risks-11.15 29480 19-Nov-92 risks-11.16 18030 19-Nov-92 risks-11.17 19489 19-Nov-92 -- more -- risks-11.18 17320 19-Nov-92 risks-11.19 26424 19-Nov-92 risks-11.20 26946 19-Nov-92 risks-11.21 31675 19-Nov-92 risks-11.22 21058 19-Nov-92 risks-11.23 18475 19-Nov-92 risks-11.24 30953 19-Nov-92 risks-11.25 10905 19-Nov-92 risks-11.26 28130 19-Nov-92 risks-11.27 24805 19-Nov-92 risks-11.28 12026 19-Nov-92 risks-11.29 29663 19-Nov-92 risks-11.30 28600 19-Nov-92 risks-11.31 18485 19-Nov-92 risks-11.32 24050 19-Nov-92 risks-11.33 19584 19-Nov-92 risks-11.34 28920 19-Nov-92 risks-11.35 28673 19-Nov-92 risks-11.36 14612 19-Nov-92 risks-11.37 14224 19-Nov-92 risks-11.38 15125 19-Nov-92 risks-11.39 42903 19-Nov-92 -- more -- risks-11.40 17048 19-Nov-92 risks-11.41 21166 19-Nov-92 risks-11.42 22859 19-Nov-92 risks-11.43 16592 19-Nov-92 risks-11.44 13779 19-Nov-92 risks-11.45 16378 19-Nov-92 risks-11.46 33250 19-Nov-92 risks-11.47 18174 19-Nov-92 risks-11.48 29949 19-Nov-92 risks-11.49 21817 19-Nov-92 risks-11.50 19595 19-Nov-92 risks-11.51 19228 19-Nov-92 risks-11.52 26937 19-Nov-92 risks-11.53 20151 19-Nov-92 risks-11.54 15440 19-Nov-92 risks-11.55 15658 19-Nov-92 risks-11.56 17218 19-Nov-92 risks-11.57 19660 19-Nov-92 risks-11.58 27155 19-Nov-92 risks-11.59 22327 19-Nov-92 risks-11.60 32642 19-Nov-92 risks-11.61 28252 19-Nov-92 -- more -- risks-11.62 30344 19-Nov-92 risks-11.63 25225 19-Nov-92 risks-11.64 22066 19-Nov-92 risks-11.65 22739 19-Nov-92 risks-11.66 24607 19-Nov-92 risks-11.67 23892 19-Nov-92 risks-11.68 23042 19-Nov-92 risks-11.69 25935 19-Nov-92 risks-11.70 24348 19-Nov-92 risks-11.71 23129 19-Nov-92 risks-11.72 20069 19-Nov-92 risks-11.73 19577 19-Nov-92 risks-11.74 28248 19-Nov-92 risks-11.75 17797 19-Nov-92 risks-11.76 29185 19-Nov-92 risks-11.77 20802 19-Nov-92 risks-11.78 28762 19-Nov-92 risks-11.79 22912 19-Nov-92 risks-11.80 29194 19-Nov-92 risks-11.81 2551 19-Nov-92 risks-11.82 24741 19-Nov-92 risks-11.83 23102 19-Nov-92 -- more -- risks-11.84 27839 19-Nov-92 risks-11.85 28083 19-Nov-92 risks-11.86 19325 19-Nov-92 risks-11.87 22058 19-Nov-92 risks-11.88 27550 19-Nov-92 risks-11.89 26242 19-Nov-92 risks-11.90 28727 19-Nov-92 risks-11.91 26655 19-Nov-92 risks-11.92 22127 19-Nov-92 risks-11.93 26779 19-Nov-92 risks-11.94 23880 19-Nov-92 risks-11.95 20917 19-Nov-92 risks-11.96 45500 19-Nov-92 risks-12.00 43947 19-Nov-92 risks-12.01 31175 19-Nov-92 risks-12.02 25036 19-Nov-92 risks-12.03 29293 19-Nov-92 risks-12.04 21338 19-Nov-92 risks-12.05 24991 19-Nov-92 risks-12.06 27073 19-Nov-92 risks-12.07 25294 19-Nov-92 risks-12.08 21633 19-Nov-92 -- more -- risks-12.09 31238 19-Nov-92 risks-12.10 24496 19-Nov-92 risks-12.11 29806 19-Nov-92 risks-12.12 15978 19-Nov-92 risks-12.13 31612 19-Nov-92 risks-12.13law 26154 19-Nov-92 risks-12.14 31203 19-Nov-92 risks-12.15 27407 19-Nov-92 risks-12.16 29701 19-Nov-92 risks-12.17 30044 19-Nov-92 risks-12.18 29261 19-Nov-92 risks-12.19 23905 19-Nov-92 risks-12.20 30590 19-Nov-92 risks-12.21 29018 19-Nov-92 risks-12.22 30354 19-Nov-92 risks-12.23 28673 19-Nov-92 risks-12.24 30751 19-Nov-92 risks-12.25 25154 19-Nov-92 risks-12.26 23688 19-Nov-92 risks-12.27 30792 19-Nov-92 risks-12.28 31768 19-Nov-92 risks-12.29 26353 19-Nov-92 -- more -- risks-12.30 21834 19-Nov-92 risks-12.31 30866 19-Nov-92 risks-12.32 31671 19-Nov-92 risks-12.33 31863 19-Nov-92 risks-12.34 27878 19-Nov-92 risks-12.35 29512 19-Nov-92 risks-12.36 30341 19-Nov-92 risks-12.37 25356 19-Nov-92 risks-12.38 30794 19-Nov-92 risks-12.39 21943 19-Nov-92 risks-12.40 27610 19-Nov-92 risks-12.41 30886 19-Nov-92 risks-12.42 14272 19-Nov-92 risks-12.43 26529 19-Nov-92 risks-12.44 28731 19-Nov-92 risks-12.45 30411 19-Nov-92 risks-12.46 31986 19-Nov-92 risks-12.47 31654 19-Nov-92 risks-12.48 30655 19-Nov-92 risks-12.49 29896 19-Nov-92 risks-12.50 23637 19-Nov-92 risks-12.51 28999 19-Nov-92 -- more -- risks-12.52 30057 19-Nov-92 risks-12.53 29881 19-Nov-92 risks-12.54 26957 19-Nov-92 risks-12.55 28887 19-Nov-92 risks-12.55afp 3710 19-Nov-92 risks-12.56 24909 19-Nov-92 risks-12.57 30523 19-Nov-92 risks-12.58 23265 19-Nov-92 risks-12.59 28563 19-Nov-92 risks-12.60 31785 19-Nov-92 risks-12.61 31039 19-Nov-92 risks-12.62 27410 19-Nov-92 risks-12.63 23807 19-Nov-92 risks-12.64 21180 19-Nov-92 risks-12.65 27229 19-Nov-92 risks-12.66 30636 19-Nov-92 risks-12.67 30607 19-Nov-92 risks-12.68 30515 19-Nov-92 risks-12.69 23791 19-Nov-92 risks-12.70 29689 19-Nov-92 risks-12.71 8522 19-Nov-92 risks-12.72 14784 19-Nov-92 -- more -- risks-12.73 43947 19-Nov-92 risks-12.bowen 40756 19-Nov-92 risks-13.00 50069 19-Nov-92 risks-13.01 25268 19-Nov-92 risks-13.02 29040 19-Nov-92 risks-13.03 22107 19-Nov-92 risks-13.04 17472 19-Nov-92 risks-13.05 30537 19-Nov-92 risks-13.06 30231 19-Nov-92 risks-13.07 31502 19-Nov-92 risks-13.08 31184 19-Nov-92 risks-13.09 31216 19-Nov-92 risks-13.10 26618 19-Nov-92 risks-13.11 31032 19-Nov-92 risks-13.12 24394 19-Nov-92 risks-13.13 30218 19-Nov-92 risks-13.14 25235 19-Nov-92 risks-13.15 29576 19-Nov-92 risks-13.16 26823 19-Nov-92 risks-13.17 28424 19-Nov-92 risks-13.18 17759 19-Nov-92 risks-13.19 29950 19-Nov-92 -- more -- risks-13.20 27682 19-Nov-92 risks-13.21 29704 19-Nov-92 risks-13.22 30671 19-Nov-92 risks-13.23 27324 19-Nov-92 risks-13.24 28513 19-Nov-92 risks-13.25 29931 19-Nov-92 risks-13.26 30435 19-Nov-92 risks-13.27 22006 19-Nov-92 risks-13.28 30456 19-Nov-92 risks-13.29 25622 19-Nov-92 risks-13.30 15855 19-Nov-92 risks-13.31 22907 19-Nov-92 risks-13.32 29516 19-Nov-92 risks-13.33 29146 19-Nov-92 risks-13.34 30656 19-Nov-92 risks-13.35 28046 19-Nov-92 risks-13.36 11534 19-Nov-92 risks-13.37 29681 19-Nov-92 risks-13.38 24538 19-Nov-92 risks-13.39 29703 19-Nov-92 risks-13.40 30513 19-Nov-92 risks-13.41 31595 19-Nov-92 -- more -- risks-13.42 29500 19-Nov-92 risks-13.43 28453 19-Nov-92 risks-13.44 29085 19-Nov-92 risks-13.45 30693 19-Nov-92 risks-13.46 26360 19-Nov-92 risks-13.47 11913 19-Nov-92 risks-13.48 23233 19-Nov-92 risks-13.49 28990 19-Nov-92 risks-13.50 23099 19-Nov-92 risks-13.51 30352 19-Nov-92 risks-13.52 30142 19-Nov-92 risks-13.53 31562 19-Nov-92 risks-13.54 25215 19-Nov-92 risks-13.55 27500 19-Nov-92 risks-13.56 18170 19-Nov-92 risks-13.57 22607 19-Nov-92 risks-13.58 26609 19-Nov-92 risks-13.59 25100 19-Nov-92 risks-13.60 14590 19-Nov-92 risks-13.61 25121 19-Nov-92 risks-13.62 29469 19-Nov-92 risks-13.63 29484 19-Nov-92 -- more -- risks-13.64 18258 19-Nov-92 risks-13.65 29582 19-Nov-92 risks-13.66 13007 19-Nov-92 risks-13.67 28396 19-Nov-92 risks-13.68 22931 19-Nov-92 risks-13.69 17633 19-Nov-92 risks-13.70 29391 19-Nov-92 risks-13.71 27869 19-Nov-92 risks-13.72 30015 19-Nov-92 risks-13.73 26995 19-Nov-92 risks-13.74 24250 19-Nov-92 risks-13.75 20852 19-Nov-92 risks-13.76 30999 19-Nov-92 risks-13.77 15251 19-Nov-92 risks-13.78 30057 19-Nov-92 risks-13.79 22926 19-Nov-92 risks-13.80 25755 19-Nov-92 risks-13.81 29317 19-Nov-92 risks-13.82 25784 19-Nov-92 risks-13.83 24754 19-Nov-92 risks-13.84 30755 19-Nov-92 risks-13.85 25228 19-Nov-92 -- more -- risks-13.86 29814 19-Nov-92 risks-13.87 25740 19-Nov-92 risks-13.88 28219 19-Nov-92 risks-13.89 26025 19-Nov-92 risks-13.90 50069 19-Nov-92 risks-13.itsec 16899 19-Nov-92 risks-14.00 5481 19-Nov-92 risks-14.01 24116 19-Nov-92 risks-14.02 27155 19-Nov-92 risks-14.02las 14757 19-Nov-92 risks-14.03 30336 19-Nov-92 risks-14.04 29226 19-Nov-92 risks-14.05 30662 19-Nov-92 risks-14.06 29795 19-Nov-92 risks-2.00 16717 19-Nov-92 risks-2.01 15563 19-Nov-92 risks-2.02 17456 19-Nov-92 risks-2.03 9145 19-Nov-92 risks-2.04 11754 19-Nov-92 risks-2.05 12821 19-Nov-92 risks-2.06 14573 19-Nov-92 risks-2.07 14999 19-Nov-92 -- more -- risks-2.08 13537 19-Nov-92 risks-2.09 7272 19-Nov-92 risks-2.10 9014 19-Nov-92 risks-2.11 9673 19-Nov-92 risks-2.12 10127 19-Nov-92 risks-2.13 11210 19-Nov-92 risks-2.14 7481 19-Nov-92 risks-2.15 10960 19-Nov-92 risks-2.16 8334 19-Nov-92 risks-2.17 12793 19-Nov-92 risks-2.18 16341 19-Nov-92 risks-2.19 9787 19-Nov-92 risks-2.20 12159 19-Nov-92 risks-2.21 7917 19-Nov-92 risks-2.22 8757 19-Nov-92 risks-2.23 12298 19-Nov-92 risks-2.24 7799 19-Nov-92 risks-2.25 10971 19-Nov-92 risks-2.26 6225 19-Nov-92 risks-2.27 13833 19-Nov-92 risks-2.28 12296 19-Nov-92 risks-2.29 12389 19-Nov-92 -- more -- risks-2.30 10766 19-Nov-92 risks-2.31 17342 19-Nov-92 risks-2.32 14088 19-Nov-92 risks-2.33 12382 19-Nov-92 risks-2.34 5841 19-Nov-92 risks-2.35 3567 19-Nov-92 risks-2.36 11276 19-Nov-92 risks-2.37 9147 19-Nov-92 risks-2.38 11815 19-Nov-92 risks-2.39 11336 19-Nov-92 risks-2.40 16391 19-Nov-92 risks-2.41 8830 19-Nov-92 risks-2.42 20959 19-Nov-92 risks-2.43 9685 19-Nov-92 risks-2.44 11564 19-Nov-92 risks-2.45 19925 19-Nov-92 risks-2.46 14041 19-Nov-92 risks-2.47 9071 19-Nov-92 risks-2.48 13264 19-Nov-92 risks-2.49 19502 19-Nov-92 risks-2.50 15714 19-Nov-92 risks-2.51 11061 19-Nov-92 -- more -- risks-2.52 9098 19-Nov-92 risks-2.53 10143 19-Nov-92 risks-2.54 10215 19-Nov-92 risks-2.55 16022 19-Nov-92 risks-2.56 16622 19-Nov-92 risks-2.56wex 9072 19-Nov-92 risks-2.57 16717 19-Nov-92 risks-3.00 27805 19-Nov-92 risks-3.01 16211 19-Nov-92 risks-3.02 4315 19-Nov-92 risks-3.03 10085 19-Nov-92 risks-3.04 11328 19-Nov-92 risks-3.05 8904 19-Nov-92 risks-3.06 12902 19-Nov-92 risks-3.07 11744 19-Nov-92 risks-3.08 11434 19-Nov-92 risks-3.09 13606 19-Nov-92 risks-3.10 13207 19-Nov-92 risks-3.11 16690 19-Nov-92 risks-3.12 12342 19-Nov-92 risks-3.13 14954 19-Nov-92 risks-3.14 13358 19-Nov-92 -- more -- risks-3.15 9742 19-Nov-92 risks-3.16 9107 19-Nov-92 risks-3.17 18012 19-Nov-92 risks-3.18 11539 19-Nov-92 risks-3.19 10800 19-Nov-92 risks-3.20 15955 19-Nov-92 risks-3.21 12238 19-Nov-92 risks-3.22 11413 19-Nov-92 risks-3.23 6048 19-Nov-92 risks-3.24 12100 19-Nov-92 risks-3.25 16689 19-Nov-92 risks-3.26 14152 19-Nov-92 risks-3.27 7218 19-Nov-92 risks-3.28 8662 19-Nov-92 risks-3.29 10466 19-Nov-92 risks-3.30 8137 19-Nov-92 risks-3.31 15945 19-Nov-92 risks-3.32 9593 19-Nov-92 risks-3.33 9073 19-Nov-92 risks-3.34 14506 19-Nov-92 risks-3.35 11709 19-Nov-92 risks-3.36 11668 19-Nov-92 -- more -- risks-3.37 14243 19-Nov-92 risks-3.38 8850 19-Nov-92 risks-3.39 10659 19-Nov-92 risks-3.40 16753 19-Nov-92 risks-3.41 16338 19-Nov-92 risks-3.42 14662 19-Nov-92 risks-3.43 14045 19-Nov-92 risks-3.44 11831 19-Nov-92 risks-3.45 12958 19-Nov-92 risks-3.46 12768 19-Nov-92 risks-3.47 15666 19-Nov-92 risks-3.48 16093 19-Nov-92 risks-3.49 11128 19-Nov-92 risks-3.50 18972 19-Nov-92 risks-3.51 13931 19-Nov-92 risks-3.52 20717 19-Nov-92 risks-3.53 8997 19-Nov-92 risks-3.54 12957 19-Nov-92 risks-3.55 12198 19-Nov-92 risks-3.56 13558 19-Nov-92 risks-3.57 14766 19-Nov-92 risks-3.58 15672 19-Nov-92 -- more -- risks-3.59 15418 19-Nov-92 risks-3.60 20767 19-Nov-92 risks-3.61 11740 19-Nov-92 risks-3.62 13807 19-Nov-92 risks-3.63 12355 19-Nov-92 risks-3.64 17057 19-Nov-92 risks-3.65 11148 19-Nov-92 risks-3.66 15541 19-Nov-92 risks-3.67 15818 19-Nov-92 risks-3.68 19981 19-Nov-92 risks-3.69 18408 19-Nov-92 risks-3.70 9954 19-Nov-92 risks-3.71 19911 19-Nov-92 risks-3.72 12633 19-Nov-92 risks-3.73 11225 19-Nov-92 risks-3.74 22140 19-Nov-92 risks-3.75 15927 19-Nov-92 risks-3.76 9988 19-Nov-92 risks-3.77 13314 19-Nov-92 risks-3.78 19471 19-Nov-92 risks-3.79 9567 19-Nov-92 risks-3.80 13948 19-Nov-92 -- more -- risks-3.81 15318 19-Nov-92 risks-3.82 11125 19-Nov-92 risks-3.83 15006 19-Nov-92 risks-3.84 24354 19-Nov-92 risks-3.85 13577 19-Nov-92 risks-3.86 13079 19-Nov-92 risks-3.87 5229 19-Nov-92 risks-3.88 14916 19-Nov-92 risks-3.89 12736 19-Nov-92 risks-3.90 16599 19-Nov-92 risks-3.91 15584 19-Nov-92 risks-3.92 27805 19-Nov-92 risks-4.00 39436 19-Nov-92 risks-4.01 22742 19-Nov-92 risks-4.02 15213 19-Nov-92 risks-4.03 11406 19-Nov-92 risks-4.04 10295 19-Nov-92 risks-4.05 12144 19-Nov-92 risks-4.06 11215 19-Nov-92 risks-4.07 16730 19-Nov-92 risks-4.08 14494 19-Nov-92 risks-4.09 17456 19-Nov-92 -- more -- risks-4.10 11864 19-Nov-92 risks-4.11 15396 19-Nov-92 risks-4.12 13824 19-Nov-92 risks-4.13 12597 19-Nov-92 risks-4.14 17004 19-Nov-92 risks-4.15 17212 19-Nov-92 risks-4.16 12400 19-Nov-92 risks-4.17 18681 19-Nov-92 risks-4.18 13231 19-Nov-92 risks-4.19 13456 19-Nov-92 risks-4.20 13210 19-Nov-92 risks-4.21 16469 19-Nov-92 risks-4.22 17410 19-Nov-92 risks-4.23 13103 19-Nov-92 risks-4.24 12535 19-Nov-92 risks-4.25 13705 19-Nov-92 risks-4.26 16137 19-Nov-92 risks-4.27 12430 19-Nov-92 risks-4.28 23116 19-Nov-92 risks-4.29 11094 19-Nov-92 risks-4.30 14540 19-Nov-92 risks-4.31 17114 19-Nov-92 -- more -- risks-4.32 5837 19-Nov-92 risks-4.33 19216 19-Nov-92 risks-4.34 17914 19-Nov-92 risks-4.35 23926 19-Nov-92 risks-4.36 26221 19-Nov-92 risks-4.37 16040 19-Nov-92 risks-4.38 17602 19-Nov-92 risks-4.39 12148 19-Nov-92 risks-4.40 16088 19-Nov-92 risks-4.41 10264 19-Nov-92 risks-4.42 16165 19-Nov-92 risks-4.43 15745 19-Nov-92 risks-4.44 17234 19-Nov-92 risks-4.45 8773 19-Nov-92 risks-4.46 16270 19-Nov-92 risks-4.47 18545 19-Nov-92 risks-4.48 15808 19-Nov-92 risks-4.49 14438 19-Nov-92 risks-4.50 19662 19-Nov-92 risks-4.51 22441 19-Nov-92 risks-4.52 28359 19-Nov-92 risks-4.53 10010 19-Nov-92 -- more -- risks-4.54 9717 19-Nov-92 risks-4.55 17399 19-Nov-92 risks-4.56 19186 19-Nov-92 risks-4.57 19015 19-Nov-92 risks-4.58 14660 19-Nov-92 risks-4.59 16620 19-Nov-92 risks-4.60 14147 19-Nov-92 risks-4.61 17150 19-Nov-92 risks-4.62 21639 19-Nov-92 risks-4.63 24243 19-Nov-92 risks-4.64 27311 19-Nov-92 risks-4.65 20648 19-Nov-92 risks-4.66 14073 19-Nov-92 risks-4.67 22249 19-Nov-92 risks-4.68 18085 19-Nov-92 risks-4.69 12453 19-Nov-92 risks-4.70 12016 19-Nov-92 risks-4.71 11106 19-Nov-92 risks-4.72 9455 19-Nov-92 risks-4.73 20087 19-Nov-92 risks-4.74 13931 19-Nov-92 risks-4.75 19212 19-Nov-92 -- more -- risks-4.76 8935 19-Nov-92 risks-4.77 12599 19-Nov-92 risks-4.78 11676 19-Nov-92 risks-4.79 24995 19-Nov-92 risks-4.80 9295 19-Nov-92 risks-4.81 17392 19-Nov-92 risks-4.82 12224 19-Nov-92 risks-4.83 14740 19-Nov-92 risks-4.84 15514 19-Nov-92 risks-4.85 11546 19-Nov-92 risks-4.85x 8912 19-Nov-92 risks-4.86 12157 19-Nov-92 risks-4.87 14982 19-Nov-92 risks-4.88 6992 19-Nov-92 risks-4.89 18001 19-Nov-92 risks-4.90 21219 19-Nov-92 risks-4.91 24644 19-Nov-92 risks-4.92 24476 19-Nov-92 risks-4.93 12312 19-Nov-92 risks-4.94 12680 19-Nov-92 risks-4.95 14332 19-Nov-92 risks-4.96 29444 19-Nov-92 -- more -- risks-4.97 39436 19-Nov-92 risks-5.00 37587 19-Nov-92 risks-5.01 841 19-Nov-92 risks-5.02 16888 19-Nov-92 risks-5.03 28553 19-Nov-92 risks-5.04 9858 19-Nov-92 risks-5.05 19060 19-Nov-92 risks-5.06 12589 19-Nov-92 risks-5.07 14281 19-Nov-92 risks-5.08 14179 19-Nov-92 risks-5.09 25788 19-Nov-92 risks-5.10 15343 19-Nov-92 risks-5.11 16787 19-Nov-92 risks-5.12 17426 19-Nov-92 risks-5.13 10497 19-Nov-92 risks-5.14 16322 19-Nov-92 risks-5.15 22764 19-Nov-92 risks-5.16 28962 19-Nov-92 risks-5.17 13193 19-Nov-92 risks-5.18 17471 19-Nov-92 risks-5.19 17639 19-Nov-92 risks-5.20 10290 19-Nov-92 -- more -- risks-5.21 14912 19-Nov-92 risks-5.22 15170 19-Nov-92 risks-5.23 21698 19-Nov-92 risks-5.24 15095 19-Nov-92 risks-5.25 24358 19-Nov-92 risks-5.26 14574 19-Nov-92 risks-5.27 14167 19-Nov-92 risks-5.28 28678 19-Nov-92 risks-5.29 16503 19-Nov-92 risks-5.30 12687 19-Nov-92 risks-5.31 17848 19-Nov-92 risks-5.32 17697 19-Nov-92 risks-5.33 24606 19-Nov-92 risks-5.34 9492 19-Nov-92 risks-5.35 16041 19-Nov-92 risks-5.36 11043 19-Nov-92 risks-5.37 11323 19-Nov-92 risks-5.38 14034 19-Nov-92 risks-5.39 13025 19-Nov-92 risks-5.40 15906 19-Nov-92 risks-5.41 10427 19-Nov-92 risks-5.42 22645 19-Nov-92 -- more -- risks-5.43 17803 19-Nov-92 risks-5.44 20972 19-Nov-92 risks-5.45 15067 19-Nov-92 risks-5.46 22445 19-Nov-92 risks-5.47 15728 19-Nov-92 risks-5.48 18770 19-Nov-92 risks-5.49 18446 19-Nov-92 risks-5.50 11061 19-Nov-92 risks-5.51 10574 19-Nov-92 risks-5.52 25949 19-Nov-92 risks-5.53 20199 19-Nov-92 risks-5.54 11537 19-Nov-92 risks-5.55 24928 19-Nov-92 risks-5.56 25434 19-Nov-92 risks-5.57 24406 19-Nov-92 risks-5.58 14596 19-Nov-92 risks-5.59 19899 19-Nov-92 risks-5.60 16535 19-Nov-92 risks-5.61 18403 19-Nov-92 risks-5.62 25954 19-Nov-92 risks-5.63 17473 19-Nov-92 risks-5.64 17901 19-Nov-92 -- more -- risks-5.65 10461 19-Nov-92 risks-5.66 18162 19-Nov-92 risks-5.67 20968 19-Nov-92 risks-5.68 15740 19-Nov-92 risks-5.69 26287 19-Nov-92 risks-5.70 18344 19-Nov-92 risks-5.71 29449 19-Nov-92 risks-5.72 20660 19-Nov-92 risks-5.73 25615 19-Nov-92 risks-5.74 19072 19-Nov-92 risks-5.75 22625 19-Nov-92 risks-5.76 18141 19-Nov-92 risks-5.77 15550 19-Nov-92 risks-5.78 24361 19-Nov-92 risks-5.79 20953 19-Nov-92 risks-5.80 14686 19-Nov-92 risks-5.81 23907 19-Nov-92 risks-5.82 16227 19-Nov-92 risks-5.83 17263 19-Nov-92 risks-5.84 19597 19-Nov-92 risks-5.85 37587 19-Nov-92 risks-5.95 0 19-Nov-92 -- more -- risks-6.00 44127 19-Nov-92 risks-6.01 23923 19-Nov-92 risks-6.02 15380 19-Nov-92 risks-6.03 25498 19-Nov-92 risks-6.04 16203 19-Nov-92 risks-6.05 16095 19-Nov-92 risks-6.06 14494 19-Nov-92 risks-6.07 14118 19-Nov-92 risks-6.08 15192 19-Nov-92 risks-6.09 18462 19-Nov-92 risks-6.10 10716 19-Nov-92 risks-6.11 20982 19-Nov-92 risks-6.12 21975 19-Nov-92 risks-6.13 19627 19-Nov-92 risks-6.14 13092 19-Nov-92 risks-6.15 13577 19-Nov-92 risks-6.16 19095 19-Nov-92 risks-6.17 10176 19-Nov-92 risks-6.18 17105 19-Nov-92 risks-6.19 21801 19-Nov-92 risks-6.20 23427 19-Nov-92 risks-6.21 17151 19-Nov-92 -- more -- risks-6.22 17600 19-Nov-92 risks-6.23 20347 19-Nov-92 risks-6.24 19734 19-Nov-92 risks-6.25 22303 19-Nov-92 risks-6.26 11290 19-Nov-92 risks-6.27 22773 19-Nov-92 risks-6.28 24748 19-Nov-92 risks-6.29 10645 19-Nov-92 risks-6.30 18202 19-Nov-92 risks-6.31 18329 19-Nov-92 risks-6.32 20212 19-Nov-92 risks-6.33 17812 19-Nov-92 risks-6.34 20983 19-Nov-92 risks-6.35 20259 19-Nov-92 risks-6.36 25235 19-Nov-92 risks-6.37 18538 19-Nov-92 risks-6.38 24961 19-Nov-92 risks-6.39 21056 19-Nov-92 risks-6.40 17586 19-Nov-92 risks-6.41 20045 19-Nov-92 risks-6.42 20577 19-Nov-92 risks-6.43 17390 19-Nov-92 -- more -- risks-6.44 20481 19-Nov-92 risks-6.45 23926 19-Nov-92 risks-6.46 27204 19-Nov-92 risks-6.47 21381 19-Nov-92 risks-6.48 18234 19-Nov-92 risks-6.49 24173 19-Nov-92 risks-6.50 30711 19-Nov-92 risks-6.51 18074 19-Nov-92 risks-6.52 28040 19-Nov-92 risks-6.53 22287 19-Nov-92 risks-6.54 22966 19-Nov-92 risks-6.55 23136 19-Nov-92 risks-6.56 22445 19-Nov-92 risks-6.57 21461 19-Nov-92 risks-6.58 22301 19-Nov-92 risks-6.59 13966 19-Nov-92 risks-6.60 22002 19-Nov-92 risks-6.61 16951 19-Nov-92 risks-6.62 19454 19-Nov-92 risks-6.63 22767 19-Nov-92 risks-6.64 18881 19-Nov-92 risks-6.65 18160 19-Nov-92 -- more -- risks-6.66 17769 19-Nov-92 risks-6.67 16879 19-Nov-92 risks-6.68 16232 19-Nov-92 risks-6.69 17152 19-Nov-92 risks-6.70 23859 19-Nov-92 risks-6.71 17964 19-Nov-92 risks-6.72 18413 19-Nov-92 risks-6.73 23504 19-Nov-92 risks-6.74 21021 19-Nov-92 risks-6.75 21872 19-Nov-92 risks-6.76 16971 19-Nov-92 risks-6.77 18546 19-Nov-92 risks-6.78 18294 19-Nov-92 risks-6.79 20920 19-Nov-92 risks-6.80 14857 19-Nov-92 risks-6.81 20619 19-Nov-92 risks-6.82 21928 19-Nov-92 risks-6.83 18292 19-Nov-92 risks-6.84 26468 19-Nov-92 risks-6.85 24325 19-Nov-92 risks-6.86 16441 19-Nov-92 risks-6.87 17327 19-Nov-92 -- more -- risks-6.88 16512 19-Nov-92 risks-6.89 12141 19-Nov-92 risks-6.90 16038 19-Nov-92 risks-6.91 18286 19-Nov-92 risks-6.92 10226 19-Nov-92 risks-6.93 24819 19-Nov-92 risks-6.94 11974 19-Nov-92 risks-6.95 44127 19-Nov-92 risks-6.april-1 8471 19-Nov-92 risks-6.feynman 33488 19-Nov-92 risks-6.markoff 10092 19-Nov-92 risks-6.seahawk 0 19-Nov-92 risks-7.00 42070 19-Nov-92 risks-7.01 19429 19-Nov-92 risks-7.02 20562 19-Nov-92 risks-7.03 12555 19-Nov-92 risks-7.04 22229 19-Nov-92 risks-7.05 22440 19-Nov-92 risks-7.06 12933 19-Nov-92 risks-7.07 17873 19-Nov-92 risks-7.08 21385 19-Nov-92 risks-7.09 13376 19-Nov-92 -- more -- risks-7.10 14916 19-Nov-92 risks-7.11 16525 19-Nov-92 risks-7.12 16643 19-Nov-92 risks-7.13 21210 19-Nov-92 risks-7.14 17130 19-Nov-92 risks-7.15 22106 19-Nov-92 risks-7.16 24062 19-Nov-92 risks-7.17 22673 19-Nov-92 risks-7.18 19003 19-Nov-92 risks-7.19 21659 19-Nov-92 risks-7.20 19561 19-Nov-92 risks-7.21 21929 19-Nov-92 risks-7.22 18308 19-Nov-92 risks-7.23 18496 19-Nov-92 risks-7.24 10381 19-Nov-92 risks-7.25 13952 19-Nov-92 risks-7.26 19613 19-Nov-92 risks-7.27 13660 19-Nov-92 risks-7.28 15948 19-Nov-92 risks-7.29 15503 19-Nov-92 risks-7.30 13799 19-Nov-92 risks-7.31 20838 19-Nov-92 -- more -- risks-7.32 22706 19-Nov-92 risks-7.33 20297 19-Nov-92 risks-7.34 18295 19-Nov-92 risks-7.35 14851 19-Nov-92 risks-7.36 19029 19-Nov-92 risks-7.37 19615 19-Nov-92 risks-7.38 22042 19-Nov-92 risks-7.39 18546 19-Nov-92 risks-7.40 23171 19-Nov-92 risks-7.41 23194 19-Nov-92 risks-7.42 21457 19-Nov-92 risks-7.43 16445 19-Nov-92 risks-7.44 17528 19-Nov-92 risks-7.45 17705 19-Nov-92 risks-7.46 18409 19-Nov-92 risks-7.47 16501 19-Nov-92 risks-7.48 21139 19-Nov-92 risks-7.49 21869 19-Nov-92 risks-7.50 18833 19-Nov-92 risks-7.51 16752 19-Nov-92 risks-7.52 13840 19-Nov-92 risks-7.53 18239 19-Nov-92 -- more -- risks-7.54 15263 19-Nov-92 risks-7.55 17399 19-Nov-92 risks-7.56 22132 19-Nov-92 risks-7.57 20411 19-Nov-92 risks-7.58 18904 19-Nov-92 risks-7.59 16483 19-Nov-92 risks-7.60 16619 19-Nov-92 risks-7.61 12055 19-Nov-92 risks-7.62 24569 19-Nov-92 risks-7.63 25978 19-Nov-92 risks-7.64 20297 19-Nov-92 risks-7.65 16780 19-Nov-92 risks-7.66 10471 19-Nov-92 risks-7.67 20566 19-Nov-92 risks-7.68 17943 19-Nov-92 risks-7.69 20880 19-Nov-92 risks-7.70 20051 19-Nov-92 risks-7.71 21332 19-Nov-92 risks-7.72 20951 19-Nov-92 risks-7.73 23114 19-Nov-92 risks-7.74 20115 19-Nov-92 risks-7.75 18667 19-Nov-92 -- more -- risks-7.76 23847 19-Nov-92 risks-7.77 20219 19-Nov-92 risks-7.78 18533 19-Nov-92 risks-7.79 20261 19-Nov-92 risks-7.80 16250 19-Nov-92 risks-7.81 20108 19-Nov-92 risks-7.82 19713 19-Nov-92 risks-7.83 11811 19-Nov-92 risks-7.84 17523 19-Nov-92 risks-7.85 10588 19-Nov-92 risks-7.86 13004 19-Nov-92 risks-7.87 25811 19-Nov-92 risks-7.88 18732 19-Nov-92 risks-7.89 15904 19-Nov-92 risks-7.90 20792 19-Nov-92 risks-7.91 21987 19-Nov-92 risks-7.92 21789 19-Nov-92 risks-7.93 22891 19-Nov-92 risks-7.94 8606 19-Nov-92 risks-7.95 18272 19-Nov-92 risks-7.96 18303 19-Nov-92 risks-7.97 16383 19-Nov-92 -- more -- risks-7.98 15419 19-Nov-92 risks-7.99 42070 19-Nov-92 risks-7.softgd 15020 19-Nov-92 risks-8.00 41046 19-Nov-92 risks-8.01 24165 19-Nov-92 risks-8.02 19118 19-Nov-92 risks-8.03 19086 19-Nov-92 risks-8.04 18495 19-Nov-92 risks-8.05 22575 19-Nov-92 risks-8.06 22289 19-Nov-92 risks-8.07 19751 19-Nov-92 risks-8.08 21243 19-Nov-92 risks-8.09 20840 19-Nov-92 risks-8.10 17028 19-Nov-92 risks-8.11 17186 19-Nov-92 risks-8.12 22425 19-Nov-92 risks-8.13 21229 19-Nov-92 risks-8.14 13422 19-Nov-92 risks-8.15 20130 19-Nov-92 risks-8.16 17699 19-Nov-92 risks-8.17 14722 19-Nov-92 risks-8.18 22306 19-Nov-92 -- more -- risks-8.19 19079 19-Nov-92 risks-8.20 21733 19-Nov-92 risks-8.21 15595 19-Nov-92 risks-8.22 19184 19-Nov-92 risks-8.23 20759 19-Nov-92 risks-8.24 19638 19-Nov-92 risks-8.25 16806 19-Nov-92 risks-8.26 18369 19-Nov-92 risks-8.27 20421 19-Nov-92 risks-8.28 19669 19-Nov-92 risks-8.29 17221 19-Nov-92 risks-8.30 19023 19-Nov-92 risks-8.31 21338 19-Nov-92 risks-8.32 12100 19-Nov-92 risks-8.33 18028 19-Nov-92 risks-8.34 19157 19-Nov-92 risks-8.35 16323 19-Nov-92 risks-8.36 19566 19-Nov-92 risks-8.37 18835 19-Nov-92 risks-8.38 24701 19-Nov-92 risks-8.39 20301 19-Nov-92 risks-8.40 16042 19-Nov-92 -- more -- risks-8.41 20348 19-Nov-92 risks-8.42 15372 19-Nov-92 risks-8.43 17242 19-Nov-92 risks-8.44 21411 19-Nov-92 risks-8.45 21413 19-Nov-92 risks-8.46 24705 19-Nov-92 risks-8.47 23540 19-Nov-92 risks-8.48 23048 19-Nov-92 risks-8.49 24280 19-Nov-92 risks-8.50 22300 19-Nov-92 risks-8.51 23532 19-Nov-92 risks-8.52 24312 19-Nov-92 risks-8.53 23926 19-Nov-92 risks-8.54 17588 19-Nov-92 risks-8.55 21136 19-Nov-92 risks-8.56 15807 19-Nov-92 risks-8.57 16120 19-Nov-92 risks-8.58 18912 19-Nov-92 risks-8.59 13528 19-Nov-92 risks-8.60 11090 19-Nov-92 risks-8.61 13988 19-Nov-92 risks-8.62 22083 19-Nov-92 -- more -- risks-8.63 15801 19-Nov-92 risks-8.64 18361 19-Nov-92 risks-8.65 16717 19-Nov-92 risks-8.66 22966 19-Nov-92 risks-8.67 23967 19-Nov-92 risks-8.68 23950 19-Nov-92 risks-8.69 8466 19-Nov-92 risks-8.70 18653 19-Nov-92 risks-8.71 7570 19-Nov-92 risks-8.72 13562 19-Nov-92 risks-8.73 16077 19-Nov-92 risks-8.74 19618 19-Nov-92 risks-8.75 21253 19-Nov-92 risks-8.76 14633 19-Nov-92 risks-8.77 18558 19-Nov-92 risks-8.78 20469 19-Nov-92 risks-8.79 18375 19-Nov-92 risks-8.80 18888 19-Nov-92 risks-8.81 14486 19-Nov-92 risks-8.82 17755 19-Nov-92 risks-8.83 18626 19-Nov-92 risks-8.84 18591 19-Nov-92 -- more -- risks-8.85 13643 19-Nov-92 risks-8.86 19994 19-Nov-92 risks-8.87 23318 19-Nov-92 risks-8.88 41046 19-Nov-92 risks-9.00 45466 19-Nov-92 risks-9.01 20145 19-Nov-92 risks-9.02 21069 19-Nov-92 risks-9.03 17002 19-Nov-92 risks-9.04 22798 19-Nov-92 risks-9.05 27561 19-Nov-92 risks-9.06 27538 19-Nov-92 risks-9.07 9189 19-Nov-92 risks-9.08 22014 19-Nov-92 risks-9.09 27124 19-Nov-92 risks-9.10 18502 19-Nov-92 risks-9.11 22217 19-Nov-92 risks-9.12 10447 19-Nov-92 risks-9.13 26065 19-Nov-92 risks-9.14 18261 19-Nov-92 risks-9.15 25472 19-Nov-92 risks-9.16 22056 19-Nov-92 risks-9.17 27802 19-Nov-92 -- more -- risks-9.18 24357 19-Nov-92 risks-9.19 17582 19-Nov-92 risks-9.20 16445 19-Nov-92 risks-9.21 16478 19-Nov-92 risks-9.22 20877 19-Nov-92 risks-9.23 10841 19-Nov-92 risks-9.24 14590 19-Nov-92 risks-9.25 20361 19-Nov-92 risks-9.26 16400 19-Nov-92 risks-9.27 22605 19-Nov-92 risks-9.28 25458 19-Nov-92 risks-9.29 16926 19-Nov-92 risks-9.30 9226 19-Nov-92 risks-9.31 21162 19-Nov-92 risks-9.32 10341 19-Nov-92 risks-9.33 15221 19-Nov-92 risks-9.34 16357 19-Nov-92 risks-9.35 17234 19-Nov-92 risks-9.36 20824 19-Nov-92 risks-9.37 7884 19-Nov-92 risks-9.38 14477 19-Nov-92 risks-9.39 15259 19-Nov-92 -- more -- risks-9.40 19554 19-Nov-92 risks-9.41 11655 19-Nov-92 risks-9.42 20191 19-Nov-92 risks-9.43 19294 19-Nov-92 risks-9.44 11739 19-Nov-92 risks-9.45 23483 19-Nov-92 risks-9.46 12832 19-Nov-92 risks-9.47 23478 19-Nov-92 risks-9.48 21929 19-Nov-92 risks-9.49 14225 19-Nov-92 risks-9.50 21306 19-Nov-92 risks-9.51 12928 19-Nov-92 risks-9.52 20010 19-Nov-92 risks-9.53 18305 19-Nov-92 risks-9.54 14265 19-Nov-92 risks-9.55 19963 19-Nov-92 risks-9.56 16178 19-Nov-92 risks-9.57 21928 19-Nov-92 risks-9.58 24322 19-Nov-92 risks-9.59 21619 19-Nov-92 risks-9.60 16486 19-Nov-92 risks-9.61 24602 19-Nov-92 -- more -- risks-9.62 25259 19-Nov-92 risks-9.63 38562 19-Nov-92 risks-9.64 13799 19-Nov-92 risks-9.65 16185 19-Nov-92 risks-9.66 32936 19-Nov-92 risks-9.67 21083 19-Nov-92 risks-9.68 27425 19-Nov-92 risks-9.69 20797 19-Nov-92 risks-9.70 28925 19-Nov-92 risks-9.71 16773 19-Nov-92 risks-9.72 19367 19-Nov-92 risks-9.73 26995 19-Nov-92 risks-9.74 27958 19-Nov-92 risks-9.75 24672 19-Nov-92 risks-9.76 12049 19-Nov-92 risks-9.77 20207 19-Nov-92 risks-9.78 29195 19-Nov-92 risks-9.79 26674 19-Nov-92 risks-9.80 25771 19-Nov-92 risks-9.81 20140 19-Nov-92 risks-9.82 9624 19-Nov-92 risks-9.83 14615 19-Nov-92 -- more -- risks-9.84 18846 19-Nov-92 risks-9.85 17667 19-Nov-92 risks-9.86 18988 19-Nov-92 risks-9.87 19836 19-Nov-92 risks-9.88 22000 19-Nov-92 risks-9.89 34202 19-Nov-92 risks-9.90 22686 19-Nov-92 risks-9.91 18398 19-Nov-92 risks-9.92 19644 19-Nov-92 risks-9.93 13253 19-Nov-92 risks-9.94 33118 19-Nov-92 risks-9.95 38019 19-Nov-92 risks-9.96 22121 19-Nov-92 risks-9.97 16155 19-Nov-92 risks-9.98 45466 19-Nov-92 risks.reid 15360 19-Nov-92 Current Directory: [Archives/Cyberspace/Risks] [Archives]: Returned to previous directory. Current Directory: [Archives/Cyberspace] [Archives]: Directory: * CUD < DIR > 24-Oct-92 The Computer Underground Digest EFF < DIR > 18-Sep-92 Electronic Frontier Foundation History < DIR > 17-Jan-93 Journals < DIR > 4-Jan-93 Electronic Texts from the Underground Legal < DIR > 30-May-92 Federal & State Laws, Misc. Net Policies Risks < DIR > 19-Nov-92 The Risks Digest Current Directory: [Archives/Cyberspace] [Archives]: Returned to previous directory. Current Directory: [Archives] [Archives]: Directory: * Computers < DIR > 28-Apr-93 Software for Download Cyberpunk < DIR > 9-Apr-93 Fiction and Files Cyberspace < DIR > 9-Apr-93 Drugs < DIR > 9-Apr-93 Encryption < DIR > 9-Apr-93 Internet < DIR > 10-Apr-93 Everything about the InterNet MindVox < DIR > 9-Apr-93 Help and Information about MindVox Security < DIR > 9-Apr-93 Computer Security TheArts < DIR > 9-Apr-93 Film, Music, Theatre and Fiction Uploads < DIR > 29-Apr-93 VR < DIR > 9-Apr-93 Virtual Reality and its Impact Virus < DIR > 9-Apr-93 Articles and Papers about Viruses Current Directory: [Archives] [Archives]: Change Directory: drugs     Drugs Current Directory: [Archives/Drugs] [Archives]: Directory: * Cocaine < DIR > 9-Feb-93 Heroin < DIR > 9-Feb-93 Journals < DIR > 9-Feb-93 LSD < DIR > 9-Feb-93 Legal < DIR > 17-Nov-92 MDMA < DIR > 9-Feb-93 Marijuana < DIR > 9-Feb-93 Misc < DIR > 9-Feb-93 Nootropics < DIR > 9-Feb-93 Shrooms < DIR > 9-Feb-93 WOD < DIR > 9-Feb-93 Current Directory: [Archives/Drugs] [Archives]: Change Directory: Journa  nals Current Directory: [Archives/Drugs/Journals] [Archives]: Directory: * FJ < DIR > 17-Nov-92 HardCopy < DIR > 14-Apr-93 Current Directory: [Archives/Drugs/Journals] [Archives]: Change Directory: FJ Current Directory: [Archives/Drugs/Journals/FJ] [Archives]: Directory: * fj-1.1 7959 17-Nov-92 fj-1.2 10152 17-Nov-92 fj-1.3 12884 17-Nov-92 fj-2.1 13681 17-Nov-92 fj-2.2 13948 17-Nov-92 fj-2.4 15813 17-Nov-92 fj-2.5 16985 17-Nov-92 fj-2.6 20967 17-Nov-92 fj-index 1589 17-Nov-92 Current Directory: [Archives/Drugs/Journals/FJ] [Archives]: View: fj-1.1 The Free Journal/ASCII Edition Volume I, Issue 1 Copyright 1991 Sameer Parekh (Individual articles copyright by author) Editor-in-Chief: Sameer Parekh (fj@infopls.chi.il.us) This is The Free Journal--ASCII edition. Submissions welcome. Distribute at will; cite authors. (Or editors if no author given.) _______________________________________________________________________________ Disclaimer: The opinions expressed herein do not necessarily reflect the attitudes of the editorial staff, Libertyville High School, the government of the United States, the Federal Bureau of Investigation, the National Security Agency, the Central Intelligence Agency, or any other institution or person. Do not believe anything you hear, here and otherwise. If sources are cited, check the sources. We do not expect you to trust us any more than we expect you to trust any other information source. This is the Information Age--do not beleive everything you hear. Check references. Do I Have the Right to Distribute This? -- more -- Here is what the ACLU Handbook _The Rights of Students_ (3rd edition) by Janet R. Price, Alan H. Levine, and Eve Cary says: -------begin quote------- [question:] Can a school prohibit students from handing out all literature, including underground newspapers, on school property? [answer:] No. This would violate the Supreme Court's decision in _Tinker_. Literature may be barred from school property only if its distribution materially and substantially interferes with school activities,{32} and even some disruption in handing out the literature does not justify banning the literature completely. As one court said of students in a particular case, "It is their misconduct in the manner in which they distributed the paper which should have been stopped, not the idea of printing newspapers itself.{33} That same court emphasized that point that minor disruptions must be tolerated to accommodate the right of students to express their views. Since the "interruption of class periods caused by the 'newspaper' were minor and relatively few in number," the source said, the -- more -- _Tinker_ standard of "material and substantial disruption" had not been met. [Addendum to Chapter Two] As this book went to press, the United States Supreme Court, in _Hazelwood School District v. Kuhmeire_ (decided January 15, 1988), upheld the power of [high] school officials to control the content of school-financed newspapers. [...] As a result of the _Kuhmeire_ decision, school officials now may censor stories in official school publications so long as, in the words of the Supreme Court, "their actions are reasonably related to legitimate pedagogical concerns."[...] The Court's decision distinguished between student speech that is part of the school curriculum, such as official publications, theatrical productions, and other school-sponsored activities, and all other forms of student speech that take place on school property. The latter would include leaflets, buttons, unofficial, or so-called underground, newspapers, and other literature that is not school financed. As to all such forms of speech, the _Tinker_ standards discussed throughout this chapter continue to apply. In other words, _Kuhlmeier_ gives -- more -- school officials no greater power to control either the content or form of such student speech than they had previously. Thus, school officials may _not_ censor such speech merely because they believe it to be biased, poorly written, vulgar, or unsuitable for immature students. Speech that is not part of the school curriculum may be prohibited only if there is evidence that it will materially and substantially disrupt the word of the school. [References] _Tinker v. Des Moines Independent Community School Dist._, 393 U.S. 503 (1969) {32} _Eisner v. Stamford Board of Education_, 440 F.2d 803 (2d Cir. 1971); _Quarterman v. Byrd_, 453 F.2d 54 (4th Cir. 1971); _Schanley v. Northeast Independent School District_, 462 F.2d 960 (5th Cir. 1972); _Scoville v. Board of Education of Joliet Township_, 425 F.2d 10 (7th Cir. 1970) {33} _Sullivan v. Houston Independent School District_, 307 F. Supp. 1328 (S.D. Tex. 1969). -- more -- Welcome to the Free Journal This is the first issue of the Free Journal. This issue is devoted mainly to the rights which I have to publish this. I hope you will be able to see the precedent and realize that this and every other paper have every right to exist. First of all, the point of this is to provide a forum of ideas and discussion about issues. Any article which I (or the editors if I ever get support) feel is good, I will publish. I will not publish libel, but I will use the true definition of libel. (i. e. something which is knowingly false, will harm someone's social standing, and has malicious intent.) (A cartoon making fun of someone is not libel--an article stating that someone cheated on a test when that is false would be.) Therefore, submissions are welcomed. The means by which they can be submitted will be dealt with when the time arises. (And if someone wants to let me use their Postscript laser printer, I'd appreciate it greatly.) Remember, nothing should be believed without question; question everything. That is my most important statement. If someone tells you something, ask for proof. It does not matter whether that -- more -- person is supported by any agency of authority, it is necessary to question everything you hear. Therefore, I would like to repeat the statement that anything you find in here is neither trash nor gospel. Treat it like you would any other article. Give it your thought, check its sources, and formulate an opinion. Thank you. The Bill of Rights: Alive After 200 Years? Amendment I Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the press; or the right of the people peaceably to assemble, and to petition the Government for a redress of grievances. The Bill of Rights (excerpt) Ratified, 15 December 1791 This is first in a series of articles about the Bill of Rights and how it is being ignored. My most important source is Eric -- more -- Postpischil's article of October 1990 listing violations of the Bill of Rights. Contact me if you would like a copy or other sources for this article. (I have run out of space.) First let me mention our president. "I don't know that atheists should be considered as citizens, nor should they be considered patriots." I assume he hasn't heard of "respecting an establishment of religion." In addition, Native Americans are prohibited from using peyote, a mild hallucinogen derived from cactus plants, as a religious sacrament. However, the Roman Catholic Church is permitted to serve alcohol, a drug known to cause more deaths than peyote, marijuana, and cocaine combined, to minors during Holy Communion. The Supreme Court has upheld this law. I don't know what happened to "prohibiting the free exercise thereof" either. Maybe it has been voided by the All Holy War on Rights, er, Drugs. The Federal Communications Commission claims that because radio frequencies are limited, they have the right not only to regulate who broadcasts over these frequencies, but what exactly they can say. In fact, a broadcaster supporting decriminalization of marijuana would be at risk of FCC intervention. Another loss to the War on Truth, I would assume. In Alexandria, Virginia, there is a law that prohibits people -- more -- from loitering for more than seven minutes and exchanging small objects. Punishment is two years in jail. Sherman Jones, 15, was assaulted by a police officer's hands around his neck after putting the last bit of pizza crust into his mouth. I guess "the right of the people peaceably to assemble" is given up in the Inquisition too. This was only a summary of First Amendment violations. Keep in touch for summaries of the other amendment's violations. Current Directory: [Archives/Drugs/Journals/FJ] [Archives]: Returned to previous directory. Current Directory: [Archives/Drugs/Journals] [Archives]: Directory: * FJ < DIR > 17-Nov-92 HardCopy < DIR > 14-Apr-93 Current Directory: [Archives/Drugs/Journals] [Archives]: Change Directory: HardCopy Current Directory: [Archives/Drugs/Journals/HardCopy] [Archives]: Directory: * publications 11453 10-Sep-92 Current Directory: [Archives/Drugs/Journals/HardCopy] [Archives]: View: publications From: aldis@peg.pegasus.oz.au Date: 2 May 92 13:23:00 GMT Newsgroups: talk.politics.drugs Subject: Anti-WoD Activists' List May 1992 UPDATED LIBERTY ACTIVISTS' LIST v 1.03 5/1992 So you're sick of the WoD? Here's an alphabetical list of over 90 organisations which support drug law reform, mostly in the US, though some are based in other countries. Look for one in your area. There's an active group here for almost any taste. Joining your favourite organisation is best, though if you're worried about persecution, just send anonymous money or a letter of appreciation. Take advantage of your democratic rights while you still have some! If you're already in a law reform organisation, you can use -- more -- this list to contact others with similar interests, and share information or facilities. Just knowing that there are others working on these issues can be a big morale booster. Many entries in the following list of groups are reproduced _with permission_ from the February, 1992 issue of _High Times_ magazine. Additional listings have been added from other sources. Please reproduce and distribute widely with this acknowledgment. Post it on bulletin boards if you can. PLEASE SEND NEW LISTINGS I don't know any more about most of these groups, than what appears here. If you know about other active groups not listed here, or if any entries need correction, please e-mail me at "aldis@peg.pegasus.oz.au" or "aldis@kralizec.zeta.org.au", for incorporation in future editions of this list. Aldis Ozols Sydney, Australia -- more -- * * * * * _High Times_ is a monthly magazine produced in the US, devoted to psychedelic drugs and alternative culture issues. Their address is: c/- Trans-High Corporation 235 Park Avenue South New York NY 10003 USA Phone: +1 212 387 0500 For subscription details, call 1-800-827-0228 within the US. If you contact _High Times_, mention this posting. I'm trying to persuade them that it's worthwhile getting on the Net. * * * * * Alaskans for Hemp Awareness -- more -- 1013 E. Dimond St, #227 Anchorage, AK 99515 USA Alliance for Cannabis Therapeutics PO Box 21210 Kalorama Station Washington, DC 20009 USA Phone: (202) 483 8595 American Anti-Prohibitionist League 3929 SE Madison Portland, OR 97214 USA (Floyd Ferris Landrath) American Cannabis Research Experiment PO Box 3240 Charlottesville, VA 22903 USA -- more -- American Civil Liberties Union 132 West 43rd St. New York, NY 10036 USA Phone: (212) 944 9800 American Hemp Council PO Box 71093 Los Angeles, CA 90071 USA Phone: (213) 288 4152 American Medical Marijuana Movement (San Francisco Headquarters) 3745 Seventeenth Street San Francisco, CA 94114 USA Phone: (415) 864 1961 Antiochans for Hemp Awareness Antioch College Community Government -- more -- Yellow Springs, OH 45387 USA Phone: (513) 767 6427 Austin, Texas NORML PO Box 13549 Austin, TX 78711 USA Phone: (512) 837 4674, (512) 467 6021 AZ 4 NORML PO Box 50434 Phoenix, AZ 85076 USA Bill of Rights Society PO Box 44485 P.C., CA 91412 USA Buffalo B.A.C.H. 336 Esser Avenue -- more -- Buffalo, NY 14207 USA Phone: (716) 873 0255 (Marilyn Craig) Business Alliance for Commerce in Hemp PO Box 71093 Los Angeles, CA 90071 USA Phone: (213) 288 4152 California NORML 2215R Market St. #278 San Francisco, CA 94114 USA Phone: (415) 563 5858 (Dale Gieringer) Cannabis Action Network PO Box 54528 Lexington, KY 40555 USA -- more -- Phone: (606) 873 9707 CCCO - Western Region PO Box 42249 San Francisco, CA 94142 USA Phone: (415) 474 3002 Central Committee for Conscientious Objectors (CCCO) 2208 South St. Philadelphia, PA 19146 USA Phone/Fax: (215) 545 4626 Christic Institute (Causes and Cures Campaign) 1324 North Capitol Street, N.W. Washington, DC 20002 USA Phone: (202) 797 8106 Fax: (202) 462 5138 Internet: christic@igc.org Write to contact local campaign organiser -- more -- Clergy for Enlightened Drug Policy St Luke's Methodist Church Wisconsin Ave. and Calvert St., NW Washington, DC 20007 USA Coalition for Personal Rights PO Box 73 Des Moines, IA 50301 USA (Carl Olsen) CODD (Committee for an Open Debate on Drugs) BCM Entwine, London WC1N 3XX UNITED KINGDOM College Station NORML PO Box 9077 College Station, TX 77842 USA -- more -- Phone: (409) 268 1180 Community for Creative Non-Violence 425 Second Street, NW Washington, DC 20001 USA Phone: (202) 393 1909 Community Improvement, Inc. 104 E.Fowler Ave., Suite 203 Tampa, FL33612 USA Phone: (813) 931 8028 Daytona Beach Hemp Awareness Council PO Box 10384 Daytona Beach, FL 32120 USA DC Metro NORML PO Box 10384 Washington, DC 20013 -- more -- USA Phone: (703) 660 WEED, (301) 540 TOKE Drug Policy Foundation 4801 Massachusetts Ave. NW Ste. 400 Washington, DC 20016 USA Phone: (202) 895 1634 Fax: (202) 537 3007 Compuserve: 76546,215 Usenet: 76546.215@compuserve.com Drug Reform Coalition 225 Lafayette St., Ste. 911 New York, NY 10012 USA Families Against Destructive Drug Rehab (FADD) 4654 Dower Drive Ellicott City, MD 21043 USA -- more -- Families Against Mandatory Minimums 2000 L Street NW, Ste. 702 Washington, DC 20016 USA Phone: (202) 833 3266 Family Council on Drug Awareness PO Box 71093 Los Angeles, CA 90071-0093 USA Phone: (213) 288 4152 Flinders NORML c/- Clubs and Societies Association, Inc. Flinders University Bedford Park, SA 5042 AUSTRALIA Florida Legalization Organization c/- Michael Geison PO Box 350 -- more -- LaCrosse, FL 32658 USA Freedom Fighters of America 235 Park Ave. So., 5th Flr. New York, NY 10003 USA Friends of Hemp PO Box 981 Mars Hill, NC 28754 USA Phone: (704) 652 8919 Fully Informed Jury Association PO Box 59 Helmville, MT 59843 USA The Future of Freedom Foundation PO Box 9752 Denver, CO 80209 -- more -- USA Georgia NORML PO Box 821 Lithia Springs, GA 30057 USA Phone: (404) 739 1870 (James Bell) Green Panthers 1718 M St., NW, Ste. 322 Washington, DC 20036 USA Phone: (202) 829 9419 Fax: (202) 265 1078 Help Eliminate Marijuana Prohibition 5632 Van Nuys Blvd. Van Nuys, CA 91401 USA Hemp Advocates -- more -- PO Box 10176 South Bend, IN 46680 USA Hemp Environmental Activists PO Box 4935 East Lansing, MI 48826 USA Phone: (517) 371 HEMP Hemp For Paper Consortium c/- Harmsens 430 Tinderbox Road TINDERBOX TAS 7054 AUSTRALIA Phone: (002) 29 2063 Hoosier Cannabis Relegalization Campaign PO Box 5325 Bloomington, IN 47407 USA -- more -- Houston NORML PO Box 1952 Bellaire, TX 77401 USA Phone: (713) 465 8418 Human Environmental Mandate Proponents 1004 E. Preston St. Baltimore, MD 21202 USA Phone: (410) 547 6706 Modem: (410) 685 2894 (Larry Monoghan) Idaho B.A.C.H. 3310 Driftwood Dr. Coeur d'Alene, ID 83814 USA Phone: (208) 773 3974 (Tom Klein) -- more -- Illinois Marijuana Initiative PO Box 2242 Darien, IL 60559 USA E-mail: mrosing@igc.org or uunet!pyramid!cdp!mrosing International Anti-Prohibitionist League (Canada) c/- Marie-Andree Bertrand PO Box 6128 University of Montreal Criminology Dept. Montreal, Quebec H3C 3S7 CANADA International Anti-Prohibitionist League (Europe) 97 Rue Belliard, Rem.512 1040 Brussels BELGIUM Phone: (32 2) 230 4121 Fax: (32 2) 230 3670 Institute for HEMP -- more -- PO Box 65130 St. Paul, MN 55165 USA Phone: (612) 222 2628 Legalise Cannabis Campaign BM Box 2455 London WC1N 3XX GREAT BRITAIN Libertarian Party 1528 Pennsylvania Ave. SE Washington, DC 20003 USA Phone: (202) 543 1988 US Toll Free: (800) 682 1776 - call for local branch info Libertarian Party of Massachusetts PO Box 2610 Boston, MA 02208 USA Phone: (617) 426 4402 -- more -- Maine Vocals PO Box 189 Anson, ME 04911 USA Massachusetts Cannabis Action Network 1 Homestead Rd. Marblehead, MA 01945 USA Phone: (617) 599 3161 Minnesota NORML & Grassroots Party PO Box 8011 St Paul, MN 55108 USA Phone: (612) 827 2224 (Tim Davis) National Drug Strategy Network 2000 L St., Ste. 702 Washington, DC 20036 -- more -- USA National Organization for the Reform of Marijuana Laws (NORML) 1636 R St. NW Washington, DC 20009 USA Phone: (202) 483 5500 New Age Patriot PO Box 419 Dearborn Heights, MI 48127 USA Phone: (313) 563 3192 (Bruce W. Cain) New South Wales NORML GPO Box 91 Sydney, NSW 2001 AUSTRALIA NORML of New Jersey PO Box 668 -- more -- Navesink, NJ 07752 USA Phone: (609) 435 7363 In New Jersey & Philadelphia: (800) 742 202 Ohio NORML PO Box 36 New Plymouth, OH 45654 USA Phone: (614) 385 4167 PARTIE Party (People's Alliance to Reform, Transform and Improve Everything) PO Box 46853 Mt. Clemens, MI 48046 USA Phone: (313) 358 9869 Partnership for a Responsible America (Texas) (Part RATEX) PO Box 926042 Houston, TX 77292 -- more -- USA Phone: (713) 683 9639 (Richard Lee) Partnership for a Responsible Drug Policy 792 8th St. Lake Oswego, OR 97034 USA Phone: (503) 697 3974 (Anthony Taylor) Penn State University NORML USA Phone: (814) 867 2266 Pittsburgh NORML PO Box 4839 Pittsburgh, PA 15206 USA Prisoners of Conscience PO Box 4091 -- more -- Des Moines, IA 50333 USA Phone: (515) 243 7351 (Carl Olsen) Progressive Economic Alliances Cultivating Energy PO Box 623 Kula, Maui, HI 96790-0623 USA Phone/Fax: (808) 878 3630 Project for a Calculated Transition Green Haven Correctional Facility Drawer B Stormville, NY 12582 USA Religious Coalition for a Moral Drug Policy 3421 M St. NW, Ste. 351 Washington, DC 20007 USA -- more -- Republicans for Hemp PO Box 7644 Torrance, CA 90504 USA (Michael Scott) Rocky Mountain HEMP Network PO Box 150804 Lakewood, CO 80215 USA Phone: (303) 838 1235 San Antonio NORML 2138 Austin Highway San Antonio, TX 78218 USA Phone: (512) 654 8720 San Diego County NORML PO Box 171396 San Diego, CA 92197 USA -- more -- Phone: (619) 281 8586, (619) 571 0088, Save Our Constitution PO Box 4935 East Lansing, MI 48826 USA Save Our Liberties [Address Unknown] Mountain View, CA USA Phone: (415) 964 3655 Sonoma Civil Rights Action Project PO Box 410 Cazadero, CA 95421 USA Phone: (707) 847 3642 (Carol Miller) Students for Drug Policy Reform Washington University -- more -- HUB 207 Box 121 FM-25 Seattle, WA 98195 USA Students for the Legalization of Marijuana - University of Illinois PO Box 4205 Urbana, IL 61801 USA (Joshua Sloan) SVA Freedom Fighters 209 E. 23rd St. New York, NY 10010 USA Phone: (212) 679 7350 ext. 206 (Happy) Tampa Hemp Council PO Box 273764 Tampa, FL 33688-3764 USA -- more -- Phone: (813) 979 9527 Therapeutic & Ecological Applications of Cannabis Hemp (TEACH) 2833 Frankford Ave. Panama City, FL 32405 USA Phone: (904) 763 6812 Hemp Hotline: (213) 288 4152 Truth In Marijuana Education (TIME) PO Box 7036 Chico, CA 95972 USA Phone: (916) 345 1154 Tucson Hemp Coalition Box 78093 Tucson, AZ 85703-8093 USA University of Massachusetts at Amherst Cannabis Reform Coalition -- more -- 423 Studennt Union Building UMASS, Amherst, MA 01002 USA University of Minnesota NORML CMU 235 300 Washington Ave. SE MPLS, MN 55455 USA Verein Schweizer Hanf Freunde (Swiss Association of Hemp Friends) Postfach 323 9004 St. Gallen SWITZERLAND Vermont Vocals RFD 1 Box 148 Newport, VT 05855 USA Vermonters for Pot Peace -- more -- PO Box 237 Underhill, VT 05489 USA Virginia B.A.C.H. Route 1, Box 2142 Crewe, VA 23930 USA Phone: (804) 645 1038 (Lennice Werth) Washington Coalition for a Reform of Marijuana Laws PO Box 1731 Woodenville, WA 98072 USA Phone: (206) 622 5117 WI NORML 911 Williamson Street Madison, WI 53703 USA Phone: (608) 257 5456, (608) 257 HEMP -- more -- Email: bmasel@igc.org W. V. HEMP, Inc. 700 Kanawha Dr. Sutton, WV 26601 USA Phone: (304) 765 7444 WWU/NORML Viking Union Box E-9 Western Washington University Bellingham, WA 98225 USA Phone: (206) 671 8921 (Kevin Keyes) Current Directory: [Archives/Drugs/Journals/HardCopy] [Archives]: Current Directory: [Archives/Drugs/Journals/HardCopy] [Archives]: Returned to previous directory. Current Directory: [Archives/Drugs/Journals] [Archives]: Directory: * FJ < DIR > 17-Nov-92 HardCopy < DIR > 14-Apr-93 Current Directory: [Archives/Drugs/Journals] [Archives]: Returned to previous directory. Current Directory: [Archives/Drugs] [Archives]: Directory: * Cocaine < DIR > 9-Feb-93 Heroin < DIR > 9-Feb-93 Journals < DIR > 9-Feb-93 LSD < DIR > 9-Feb-93 Legal < DIR > 17-Nov-92 MDMA < DIR > 9-Feb-93 Marijuana < DIR > 9-Feb-93 Misc < DIR > 9-Feb-93 Nootropics < DIR > 9-Feb-93 Shrooms < DIR > 9-Feb-93 WOD < DIR > 9-Feb-93 Current Directory: [Archives/Drugs] [Archives]: Change Directory: WOD Current Directory: [Archives/Drugs/WOD] [Archives]: Directory: * neimoller 6345 10-Sep-92 political-candidates 7629 10-Sep-92 reges-from-ken-down 2999 10-Sep-92 reges-from-martinez 3116 10-Sep-92 reges-letter-daily-1 18236 10-Sep-92 reges-letter-daily-2 13032 10-Sep-92 reges-liberty-articl 21074 10-Sep-92 reges-net.statement- 5313 10-Sep-92 reges-net.statement- 3473 10-Sep-92 reges-nyt-article 5295 10-Sep-92 war-on-drugs-DPF 69046 10-Sep-92 war-on-drugs-DPF2 1837 10-Sep-92 war-on-drugs-aclu 17705 10-Sep-92 war-on-drugs-borsr 51081 10-Sep-92 war-on-drugs-const 25443 10-Sep-92 war-on-drugs-europe 8438 10-Sep-92 wod-references 391 10-Sep-92 war-on-drugs-misc 5437 10-Sep-92 war-on-drugs-problem 24067 10-Sep-92 war-on-drugs-refs 14168 10-Sep-92 war-on-drugs-tx-obs 18197 10-Sep-92 war-on-drugs.facts 28832 10-Sep-92 -- more -- wod.1 25505 21-Nov-92 wod.2 18930 21-Nov-92 wod.3 19258 21-Nov-92 wod.4 13787 21-Nov-92 Current Directory: [Archives/Drugs/WOD] [Archives]: Returned to previous directory. Current Directory: [Archives/Drugs] [Archives]: Directory: * Cocaine < DIR > 9-Feb-93 Heroin < DIR > 9-Feb-93 Journals < DIR > 9-Feb-93 LSD < DIR > 9-Feb-93 Legal < DIR > 17-Nov-92 MDMA < DIR > 9-Feb-93 Marijuana < DIR > 9-Feb-93 Misc < DIR > 9-Feb-93 Nootropics < DIR > 9-Feb-93 Shrooms < DIR > 9-Feb-93 WOD < DIR > 9-Feb-93 Current Directory: [Archives/Drugs] [Archives]: Change Directory: Misc Current Directory: [Archives/Drugs/Misc] [Archives]: Directory: * bibliography 17924 17-Nov-92 drug-statistics 7877 10-Sep-92 drug-test-impairment 2977 10-Sep-92 drugs-listing 31703 17-Nov-92 everclear 31518 17-Nov-92 hemp 4864 10-Sep-92 impairment 1535 10-Sep-92 mailing-drugs 1775 10-Sep-92 misc-references 3306 10-Sep-92 natural-highs 54562 17-Nov-92 piss-list 27737 10-Sep-92 prohibition-history 47596 10-Sep-92 source-guide 15995 17-Nov-92 water-intoxication 1858 10-Sep-92 Current Directory: [Archives/Drugs/Misc] [Archives]: Returned to previous directory. Current Directory: [Archives/Drugs] [Archives]: Change Directory: Marijuana Current Directory: [Archives/Drugs/Marijuana] [Archives]: Directory: * marijuana-consumptio 8168 10-Sep-92 marijuana-growing 7531 10-Sep-92 marijuana-hash 27745 10-Sep-92 marijuana-howto 11734 10-Sep-92 marijuana-misc 2686 10-Sep-92 marijuana-myths 12728 10-Sep-92 marijuana-references 9825 10-Sep-92 marijuana-seeds 1482 10-Sep-92 mj-faq 11958 17-Nov-92 mj-test 4896 17-Nov-92 Current Directory: [Archives/Drugs/Marijuana] [Archives]: Returned to previous directory. Current Directory: [Archives/Drugs] [Archives]: Returned to previous directory. Current Directory: [Archives] [Archives]: Directory: * Computers < DIR > 28-Apr-93 Software for Download Cyberpunk < DIR > 9-Apr-93 Fiction and Files Cyberspace < DIR > 9-Apr-93 Drugs < DIR > 9-Apr-93 Encryption < DIR > 9-Apr-93 Internet < DIR > 10-Apr-93 Everything about the InterNet MindVox < DIR > 9-Apr-93 Help and Information about MindVox Security < DIR > 9-Apr-93 Computer Security TheArts < DIR > 9-Apr-93 Film, Music, Theatre and Fiction Uploads < DIR > 29-Apr-93 VR < DIR > 9-Apr-93 Virtual Reality and its Impact Virus < DIR > 9-Apr-93 Articles and Papers about Viruses Current Directory: [Archives] [Archives]: Change Directory: VR Current Directory: [Archives/VR] [Archives]: Directory: * Citations < DIR > 27-Jan-92 Commercial < DIR > 26-Apr-92 Conferences < DIR > 22-Mar-92 Misc < DIR > 9-Feb-93 Other < DIR > 7-Apr-92 Papers < DIR > 3-Dec-92 Publications < DIR > 25-Apr-92 Research < DIR > 25-Apr-92 Schools < DIR > 26-Apr-92 Current Directory: [Archives/VR] [Archives]: Change Directory: Conferemnces     nces Current Directory: [Archives/VR/Conferences] [Archives]: Directory: * CyberConf1.proceedin 698 3-Jan-92 CyberConf2.CFP 11238 30-Dec-91 CyberConf2.review 7753 30-Dec-91 CyberConf2.review2 5444 30-Dec-91 CyberConf2.review3 8926 30-Dec-91 CyberConf2.review4 8185 30-Dec-91 CyberConf2.review5 4062 30-Dec-91 CyberConf3.info 32 22-Mar-92 Cyberarts.91.announc 7560 30-Dec-91 HITL.91.announce 3042 30-Dec-91 InCyberspace.91.anno 5375 30-Dec-91 InCyberspace.91.revi 19043 30-Dec-91 Meckler.91.announce 8360 30-Dec-91 Meckler.91.proceedin 2188 30-Dec-91 Nikkei.91.addr 567 26-Jan-92 Nikkei.91.announce 3956 30-Dec-91 Nikkei.91.announce2 2428 30-Dec-91 Nikkei.91.announce3 4829 30-Dec-91 Nikkei.91.review 5846 30-Dec-91 Nikkei.92.CFP 4250 22-Mar-92 SRI.91.announce 1556 30-Dec-91 SRI.91.review 7544 30-Dec-91 -- more -- SRI.91.review2 46894 30-Dec-91 Siggraph.91.CFP 5718 30-Dec-91 Siggraph.91.CFP2 2810 30-Dec-91 Current Directory: [Archives/VR/Conferences] [Archives]: Returned to previous directory. Current Directory: [Archives/VR] [Archives]: Directory: * Citations < DIR > 27-Jan-92 Commercial < DIR > 26-Apr-92 Conferences < DIR > 22-Mar-92 Misc < DIR > 9-Feb-93 Other < DIR > 7-Apr-92 Papers < DIR > 3-Dec-92 Publications < DIR > 25-Apr-92 Research < DIR > 25-Apr-92 Schools < DIR > 26-Apr-92 Current Directory: [Archives/VR] [Archives]: Change Directory: Publications Current Directory: [Archives/VR/Publications] [Archives]: Directory: * ArtificialRealityII 1441 26-Jan-92 Azimuth.newsletter 1761 27-Jan-92 CyberEdge 650 24-Feb-92 EccentricSpaces 2130 26-Jan-92 Graphics.hacking 1604 26-Jan-92 HITL.tapes 835 30-Dec-91 HumanScale 1685 26-Jan-92 MakingThemMove 6462 26-Jan-92 Mondo2000 239 7-Apr-92 Presence 3832 7-Apr-92 Random.magazine.arti 1037 26-Jan-92 Spatial.data.books 379 26-Jan-92 Theoretical.and.Gene 1236 26-Jan-92 VR.Index 1533 22-Mar-92 VR.Monitor 233 7-Apr-92 VRsourcebook 0 25-Apr-92 VirtualReality 20576 26-Jan-92 WholeEarthReview 463 7-Apr-92 Current Directory: [Archives/VR/Publications] [Archives]: Returned to previous directory. Current Directory: [Archives/VR] [Archives]: Directory: * Citations < DIR > 27-Jan-92 Commercial < DIR > 26-Apr-92 Conferences < DIR > 22-Mar-92 Misc < DIR > 9-Feb-93 Other < DIR > 7-Apr-92 Papers < DIR > 3-Dec-92 Publications < DIR > 25-Apr-92 Research < DIR > 25-Apr-92 Schools < DIR > 26-Apr-92 Current Directory: [Archives/VR] [Archives]: Change Directory: other     Other Current Directory: [Archives/VR/Other] [Archives]: Directory: * 3D.renderer.PC 1971 22-Mar-92 ALIFE 15464 30-Dec-91 ALIFE.2 836 30-Dec-91 ALIFE.Tierra 14275 30-Dec-91 BIX 550 7-Apr-92 BlipList 1984 30-Jan-92 George.Coates.info 1223 30-Dec-91 INGRAFX 4555 30-Dec-91 MUDs 3941 30-Dec-91 Meckler.videos 5543 30-Dec-91 Neural.interface 1606 30-Dec-91 Neural.interface.2 6630 30-Dec-91 Neural.interface.3 2045 30-Dec-91 Neural.interface.4 2871 30-Dec-91 Senate.hearing.summa 8039 30-Dec-91 Senate.hearing.video 1411 30-Dec-91 Stereoscopy.bulletin 2676 30-Dec-91 Tech2000.DC 1871 30-Dec-91 UserInterface.92.ann 6326 6-Feb-92 VR.Consortium 5017 30-Dec-91 VR.Film.doc 2799 30-Dec-91 Current Directory: [Archives/VR/Other] [Archives]: Returned to previous directory. Current Directory: [Archives/VR] [Archives]: Change Directory: Ps apers Current Directory: [Archives/VR/Papers] [Archives]: Directory: * 3dm-abstr.ps 877901 25-Oct-91 3dm-impl.ps 1026366 28-Oct-91 3dm-users.ps 1174035 28-Oct-91 Andersson.Scenario 8052 30-Dec-91 Barlow.BeingInNothin 38285 2-Jan-92 Barlow.CrimeAndPuzzl 64316 2-Jan-92 Bricken.DirectionsOf 41756 2-Jan-92 Carlson.VirtualMars 12653 30-Dec-91 Farmer.GettingThere 15078 22-Mar-92 Jacobson.TowardsGlob 23805 30-Dec-91 Jacobson.trip.report< DIR > 27-Jan-92 Norskog.5D 114670 26-Jan-92 Norskog.VRNeeds 14892 2-Jan-92 Pausch.5DollarsADay 22280 2-Jan-92 Taylor.Visualization 25449 3-Jan-92 VR.bib 8413 2-Jan-92 VR.tex 41315 2-Jan-92 VirtualEnvironments. 799651 26-Jan-92 Walser.CyberspacePla 31744 22-Mar-92 Wells.Overview 15480 30-Dec-91 Wolff.InsideVR 29362 22-Mar-92 Current Directory: [Archives/VR/Papers] [Archives]: Returned to previous directory. Current Directory: [Archives/VR] [Archives]: Returned to previous directory. Current Directory: [Archives] [Archives]: Directory: * Computers < DIR > 28-Apr-93 Software for Download Cyberpunk < DIR > 9-Apr-93 Fiction and Files Cyberspace < DIR > 9-Apr-93 Drugs < DIR > 9-Apr-93 Encryption < DIR > 9-Apr-93 Internet < DIR > 10-Apr-93 Everything about the InterNet MindVox < DIR > 9-Apr-93 Help and Information about MindVox Security < DIR > 9-Apr-93 Computer Security TheArts < DIR > 9-Apr-93 Film, Music, Theatre and Fiction Uploads < DIR > 29-Apr-93 VR < DIR > 9-Apr-93 Virtual Reality and its Impact Virus < DIR > 9-Apr-93 Articles and Papers about Viruses Current Directory: [Archives] [Archives]: Change Directory: Computers Current Directory: [Archives/Computers] [Archives]: Directory: * Amiga < DIR > 9-Jan-93 Intel < DIR > 8-Jan-93 Mac < DIR > 25-Apr-93 NeXT < DIR > 28-Apr-93 Current Directory: [Archives/Computers] [Archives]: Change Directory: Intel Current Directory: [Archives/Computers/Intel] [Archives]: Directory: * Disk < DIR > 8-Jan-93 Graphics < DIR > 11-Mar-93 Misc < DIR > 29-Apr-93 Utilities < DIR > 19-Jan-93 Current Directory: [Archives/Computers/Intel] [Archives]: Change Directory: Misc Current Directory: [Archives/Computers/Intel/Misc] [Archives]: Directory: * 00-index.txt 7994 22-Jul-92 bab200.zip 160837 29-Apr-91 boxer301.sdn 258048 2-May-91 himem33.zip 9233 12-Feb-92 japanese.lzh 90880 1-Jul-91 mt2up.zip 585461 24-Jul-92 mtii.zip 382132 24-Jul-92 mtiiinfo.txt 27498 24-Jul-92 vargr.zip 16256 24-Jul-92 vde161.zip 149612 28-Feb-92 vpic50c.zip 140032 8-Sep-92 zhodani.zip 16384 24-Jul-92 Current Directory: [Archives/Computers/Intel/Misc] [Archives]: Quit.. (6:02am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: who  MindVox [WHO] Listing ___________ _____________________ ________ ___________________________________ | | | | | | Account | Name | Page | Login Time | |___________|_____________________|________|___________________________________| (11 Accounts Currently Active) roark Eric Schneider NO Fri Apr 30 05:55:45 1993 alex Alex Zelchenko YES Fri Apr 30 05:50:24 1993 drow Doug Rau YES Fri Apr 30 05:21:12 1993 purlah The Dc Duke YES Fri Apr 30 05:52:03 1993 sulam James Waldrop YES Thu Apr 29 13:41:07 1993 unseen Sara Jane Levinson YES Fri Apr 30 03:08:16 1993 guest Guest Account YES Fri Apr 30 05:59:14 1993 thciii Thomas Connell NO Fri Apr 30 05:51:27 1993 galt Carlton G. Brown NO Fri Apr 30 05:59:05 1993 phaedra jane weaver NO Fri Apr 30 00:13:22 1993 dack Paul Recon NO Fri Apr 30 00:18:28 1993 (6:02am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: mail  MindVox [MAIL] Directory Type "?" to display the MENU or select [H]elp for detailed assistance 1 30 Apr 93 - alex (Alex Zelchenko) [Return] for Next Letter (#1) [Mail]: To: unseen Subject: know From: alex (Alex Zelchenko) Date: Fri, 30 Apr 93 05:52:14 EDT No. I don't know you. I do know Dr. Paul Levinson, director of Connected Education; and professor at the New School for Social Research. [Finished] / [Mail]: ?  MindVox [MAIL] System -=/[ Mail: Read Commands ]/=- -=/[ Mail: Creation Commands ]/=- Again - Re-read Current Message Follow - Reply to msg, with Quotes Back - Back up, by one Message Forward - Forward Mail to Someone List - Get Listing of ALL msgs Load - Send mail from HOME file Next - Read Next msg in Box Reply - Send mail to Author of msg Verbose - Re-display with Headers Send - Send/Compose a new Message Write - Save Message to a File Upload - Upload a message to Mail -=/[ Miscellaneous Commands ]/=- -=/[ Folder Commands ]/=- Clear - Clear Screen (Terminal) Delete - Delete the Current Message Go - Go to Different Folder Expand - Get Names in Mailing List Move - Move Message to Folder Help - Detailed Help with Mail Quit - Exit from Mail to MindVox [Additional Mail Functions Are Available Through HOME from the Main Menu] [Finished] / [Mail]: follow To: alex (Alex Zelchenko) Subject: Re: know - PICO ------------------------- New Buffer ------------------------ ^G Get Help ^Y Prev Pg ^K Del Line ^C Cur Pos ^X Exit ^J Justify ^W Where is ^V Next Pg ^U UnDel Lin^T To Spell [ Reading file ][ Read 6 lines ]- PICO ------------------------------ alex (Alex Zelchenko) writes:> No. I don't know you.> I do know Dr. Paul Levinson, director of Connected Education; and> professor at the New School for Social Research.- PICO ------------------------------Modified alex (Alex Zelchenko) writes:No. I don't know you.I do know Dr. Paul Levinson, director of Connected Education; and> professor at the New School for Social Research.alex (Alex Zelchenko) writes:No. I don't know you.I do know Dr. Paul Levinson, director of Connected Education; and> professor at the New School for Social Research.[ Unknown Command: ^“ ][ Unknown Command: ^‘ ][ line 3 of 9 (33), character 2 of 177 (1) ]2alex (Alex Zelchenko) writes:alex (Alex Zelchenko) writes: alex (Alex Zelchenko) writes:No. I don't know you.I do know Dr. Paul Levinson, director of Connected Education; and> professor at the New School for Social Research.alex (Alex Zelchenko) writes:> No. I don't know you.I do know Dr. Paul Levinson, director of Connected Education; andprofessor at the New School for Social Research.alex (Alex Zelchenko) writes:> No. I don't know you.I do know Dr. Paul Levinson, director of Connected Education; andprofessor at the New School for Social Research. alex (Alex Zelchenko) writes:alex (Alex Zelchenko) writes: [ line 2 of 8 (25), character 1 of 176 (0) ][ line 2 of 8 (25), character 1 of 176 (0) ][ line 2 of 8 (25), character 1 of 176 (0) ]Modified buffer: Save before leaving (y/n)? No  [L]ist, [E]dit, [S]ave, [H]eaders, or [A]bort: A [Finished] / [Mail]: -=]) Purge ALL Messages / [Default=NO]: (6:04am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: mail  MindVox [MAIL] Directory Type "?" to display the MENU or select [H]elp for detailed assistance [ No new mail - Last letter shown ] 1 30 Apr 93 - alex (Alex Zelchenko) [Return] for Next Letter (#1) [Mail]: To: unseen Subject: know From: alex (Alex Zelchenko) Date: Fri, 30 Apr 93 05:52:14 EDT No. I don't know you. I do know Dr. Paul Levinson, director of Connected Education; and professor at the New School for Social Research. [Finished] / [Mail]: -=]) Purge ALL Messages / [Default=NO]: (6:05am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (6:05am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: settings  MindVox [SETTINGS] Display -=/[ Account Statistics for: unseen ]/=- Total Calls: 2 Messages Posted: 0 Last Call Date: 29-Apr-93 Uploaded: 0 Minutes this CALL: 176 Downloaded: 8432 Minutes this MONTH: 262 New Messages: 60 Joined MindVox: 19-Apr-93 Plan Type: -=/[ Account Options / Current Settings ]/=- -=/[ Flags ]/=- Your Name: Sara Jane Levinson Screen Clear Active: Y Comment: Panta Hrei. -- More -- Disabled: N Text Editor: Visual Allow User to Page You: Y Terminal Type: ansi Expert Mode: N Protocol: Z Password: [Not Shown] Type "?" to Re-display your Status or Select one of the Following [C]omment / [E]ditor / [F]lags / [P]assword / [T]erminal / [X]fer Protocol: (6:05am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: ? m  MindVox [MAIL] Directory Type "?" to display the MENU or select [H]elp for detailed assistance [ No new mail - Last letter shown ] 1 30 Apr 93 - alex (Alex Zelchenko) [Return] for Next Letter (#1) [Mail]: To: unseen Subject: know From: alex (Alex Zelchenko) Date: Fri, 30 Apr 93 05:52:14 EDT No. I don't know you. I do know Dr. Paul Levinson, director of Connected Education; and professor at the New School for Social Research. [Finished] / [Mail]: -=]) Purge ALL Messages / [Default=NO]: (6:05am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: mail  MindVox [MAIL] Directory Type "?" to display the MENU or select [H]elp for detailed assistance [ No new mail - Last letter shown ] 1 30 Apr 93 - alex (Alex Zelchenko) [Return] for Next Letter (#1) [Mail]: To: unseen Subject: know From: alex (Alex Zelchenko) Date: Fri, 30 Apr 93 05:52:14 EDT No. I don't know you. I do know Dr. Paul Levinson, director of Connected Education; and professor at the New School for Social Research. [Finished] / [Mail]: ?  MindVox [MAIL] System -=/[ Mail: Read Commands ]/=- -=/[ Mail: Creation Commands ]/=- Again - Re-read Current Message Follow - Reply to msg, with Quotes Back - Back up, by one Message Forward - Forward Mail to Someone List - Get Listing of ALL msgs Load - Send mail from HOME file Next - Read Next msg in Box Reply - Send mail to Author of msg Verbose - Re-display with Headers Send - Send/Compose a new Message Write - Save Message to a File Upload - Upload a message to Mail -=/[ Miscellaneous Commands ]/=- -=/[ Folder Commands ]/=- Clear - Clear Screen (Terminal) Delete - Delete the Current Message Go - Go to Different Folder Expand - Get Names in Mailing List Move - Move Message to Folder Help - Detailed Help with Mail Quit - Exit from Mail to MindVox [Additional Mail Functions Are Available Through HOME from the Main Menu] [Finished] / [Mail]: m  -=]) Purge ALL Messages / [Default=NO]: (6:06am) [ Area: MindVox / Forum: Archives ] (? for Menu) [Main Menu]: home  MindVox [HOME] Directory Type "?" to display the MENU or Select [H]elp for detailed assistance [Home]: [Home]: ?  MindVox [HOME] Directory -=/[ File Manipulation Commands ]/=- -=/[ User Configuration Files ]/=- Copy - Create a Duplicate of a File Aliases - Mailing Lists Database Dir - List Files in Home Directory Forward - Mail Forwarding File Delete - Remove a File form Directory Login - Macro Executed @ Login Edit - Edit (Filename) Using Editor Mailsig - Your MAIL Signature Receive - Upload to Home with Protocol Plan - Information for Finger Rename - Change the Name of a File Sig - Your Forums Signature Send - Download a file from Home Tail - View the END of a Text File View - Display the Contents of File Help - Detailed Help about Home Quit - Run Away from Home [Home]: plan  Your Plan file is printed to a person's screen when they FINGER your ac- count. It can be left empty, or filled with whatever information you desire to give out about yourself to the other Members of MindVox. Some people cannot stay serious for more than a sentence or two, while others want to use this space to let people know something about who they are and what they do. As with most things, there are no rules regarding what you can or can- not put into your Plan file, but we'd ask that you try not to fill it with a lot of obscenities or control-codes that make people's terminals do strange things. A lot of peop