===== TurboTerm v2.5 : Log : Thursday 04/29/1993 @ 18:19:14 ===== RQ  /\_-\ <((_))> \- \/ /\_-\(:::::::::)/\_-\ <((_)) MindVox ((_))> \- \/(:::::::::)\- \/ /\_-\ <((_))> \- \/ _________________________________________________________ To take a look around MindVox use the "guest" account To apply for an account enter as GUEST, then REGISTER _________________________________________________________ (c) Copyright 1992-93, Phantom Access Technologies, Inc. Login (User ID): und seen Password:  (+) [ MindVox ] (+) -=/[ Internet Site: phantom.com ]/=- _______________________________________________________________ Today Is: [29-Apr-93] Logging In: ( unseen ) Caller Number: (129470) Last Login: (19-Apr-93) New Messages: [ 1177 ] _______________________________________________________________ Your Identity on MindVox is: unseen@phantom.com _______________________________________________________________ Type UPDATE for System News MindVox was down for a few hours this morning due to electrical work. (We have three times the juice now, so our circuit breaker will stop -- more -- exploding!) We apologize for the inconvenience. -=]) [No New Mail] (9:38pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:38pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: chat CHAT is an invalid command. Type HELP for help. (9:39pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:39pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: go chat A Complete list of available Forums can be displayed with the INDEX command. If you know the full name of the forum you wish to go to you may enter it by typing it's name (ie: "Go Introductions"). To search for a pattern, add a slash to the beginning of the name. For instance, "go /puter" would take you to Computers:Amiga, the first Forum with the word Computers in the name. If you wish to continue a search you may do so by simply typing "Go /" again. In In the above case this would take you to Computers:Apple. Note that to return to Computers:Amiga, you can simply type "Go Amiga" Go to Forum: chat chat is not a valid Forum. Type INDEX for a list. (9:39pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: index NO CARRIER ARQ   /\_-\ <((_))> \- \/ /\_-\(:::::::::)/\_-\ <((_)) MindVox ((_))> \- \/(:::::::::)\- \/ /\_-\ <((_))> \- \/ _________________________________________________________ To take a look around MindVox use the "guest" account To apply for an account enter as GUEST, then REGISTER _________________________________________________________ (c) Copyright 1992-93, Phantom Access Technologies, Inc. Login (User ID): unseen Password:  (+) [ MindVox ] (+) -=/[ Internet Site: phantom.com ]/=- _______________________________________________________________ Today Is: [29-Apr-93] Logging In: ( unseen ) Caller Number: (129474) Last Login: (29-Apr-93) New Messages: [ 2 ] _______________________________________________________________ Your Identity on MindVox is: unseen@phantom.com _______________________________________________________________ Type UPDATE for System News MindVox was down for a few hours this morning due to electrical work. (We have three times the juice now, so our circuit breaker will stop -- more -- exploding!) We apologize for the inconvenience. -=]) [No New Mail] (9:41pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:42pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: help  MindVox [HELP] Section ___________________________________________________________ | | | Help - General Information on System Commands | |___________________________________________________________| | | | Archives - Detailed Information on Using the Archives | | Chat - Explanation of the Chat System Commands | | Forums - Complete Instructions for the Vox Forums | | FTP - How to Use Internet File Transfer Protocol | | Gateways - How to Send Mail to Various Networks | | Home - Setting up Plan, Login, and other Features | | IRC - Crash course on using Internet Relay Chat | | Jove - Documentation on Using the Jove Editor | | Mail - Using the MindVox mail system Capabilities | |___________________________________________________________| | | | QUIT - Exit Help and Return to Previous Menu | |___________________________________________________________| -- more -- [Topic]: chat  MindVox [HELP: CHAT] Conference Chat provides a venue for real-time Computer Mediated Conferencing. It is capable of supporting up to 50 simultaneous users, via local dialup lines and Internet telnet facilities. Using Chat you can communicate with individuals on a one-to-one basis, or with groups of people on public or private channels. Chat Presently Supports )[> An unlimited number of Channels <]( )[> Public and Private Messages <]( )[> Public and Private Channels <]( When using the Chat program, simply type a line of text terminated by a carriage return in order to send that line of text as a public message -- more -- to everyone on your channel. Other commands may also be used, and they are listed below. Commands Available in Chat /nick - Set or change your nickname to /join - Join channel number /join - Join protected channel number with password /pass - Set password for your current channel to /who - List of members in Chat, and what channels they are on /msg<#> - Send a private message to user (#) /quit - Exit from the Chat program /? - Display the help screen Chat is presently under construction. About a dozen additional features are planned. If there is anything you would like to see that doesn't exist at present, then let us know by sending mail to "support" or by bringing up the topic in a public message on the MindVox:Trajectory forum if you'd like to discuss the possibilities and merits of your suggestion with other members of MindVox. -- more -- [Topic]: (9:42pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: chat CHAT is an invalid command. Type HELP for help. (9:42pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: go chat A Complete list of available Forums can be displayed with the INDEX command. If you know the full name of the forum you wish to go to you may enter it by typing it's name (ie: "Go Introductions"). To search for a pattern, add a slash to the beginning of the name. For instance, "go /puter" would take you to Computers:Amiga, the first Forum with the word Computers in the name. If you wish to continue a search you may do so by simply typing "Go /" again. In In the above case this would take you to Computers:Apple. Note that to return to Computers:Amiga, you can simply type "Go Amiga" Go to Forum: That is not a valid Forum. Type INDEX for a list. (9:43pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: index  /\_-\(:::::::::)/\_-\ <((_)) MindVox ((_))> \- \/(:::::::::)\- \/ -=/[ Babylon ]/=- Bandwidth Club-Chaos ThugWorld -=/[ Computers (GUIs / Networks / Operating Systems) ]/=- Advocacy Amiga Silicon-Graphics NeXTSTEP Programming Apple Sun/SPARC NT Security Mac Laptops OS/2 Windows Viruses PC Networks Unix X -=/[ Creative-Arts ]/=- -- more -- Art Books Movies Writing Writing-Workshop -=/[ CyberSpace ]/=- Cyberpolis CPSR Ethics Media Piracy Round-Table Cyberpunk Gatherings Mondo Publications VR EFF Hacking Phrack Red-Tape Wired -=/[ Drugs ]/=- Cognitive-Enhancement Discussion Psychedelic Safety Steroids -=/[ Echoes ]/=- -=]) Under Construction ([=- -=/[ Erotica ]/=- -- more -- Sexuality -=/[ Health ]/=- Body-Building Beauty Life-Extension Weight-Loss -=/[ MindVox ]/=- Vox Archives Help Introductions Sightings Trajectory -=/[ Music ]/=- Alternative Concert-Info Gothic Heavy-Metal New-Releases Rap -=/[ NYC ]/=- -- more -- Apartments Events For-Sale Services -=/[ Religion ]/=- Christianity Eastern Judaism Satanism Wicca -=/[ Technology ]/=- Audio Encryption Hardware-Hacking Video WaveLength -=/[ Zones ]/=- Current-Headlines Games MaelStrom Philosophy Rave Education Humor NY Politics Recreation Fashion Legal Ontology Racism Women-Online (9:43pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: mail  MindVox [MAIL] Directory Type "?" to display the MENU or select [H]elp for detailed assistance No mail in your mailbox. [Mailbox is Empty] / [Mail]: (9:43pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:43pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: forums -=/[ [2227] New Messages / Begin Reading at (#1) ]/=- [ Area: Babylon / Forum: Bandwidth ] [Return] 1-2227, [Q]uit: Post: 1 of 2227 Subject: Popping the cherry... From: bwp (Jane Doe) Date: Tue, 15 Sep 92 15:37:20 EDT Just wanted to be the first to post to this forum. -bwp [ Area: Babylon / Forum: Bandwidth ] [Return] 1-2227, [Q]uit: q  -=/[ Returning to Main Menu ]/=- (9:44pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: (9:44pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:44pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: last  Last [20] Members Logged into MindVox / [P] = Member Posted Messages ______________________________________________________________________________ Call Member Name Login Logout Day Mv Stat ______________________________________________________________________________ 129449 sedition Todd Mueller 9:14p 9:18p THU 0 BYE 129425 keever Tom Dale Keever 8:47p 9:20p THU 0 LOST 129382 pkk james kelly 8:09p 9:21p THU 0 BYE 129453 sedition Todd Mueller 9:21p 9:23p THU 0 BYE 129431 molbloo Alissa Bader 8:57p 9:24p THU 0 BYE 129445 stevek Steve K [P] 9:13p 9:26p THU 0 BYE 129458 voidmstr Dennis Wilen 9:25p 9:26p THU 0 LOST 129446 deckard Mike Gwertzman [P] 9:18p 9:30p THU 0 LOST 129405 molehill Todd Larason 8:30p 9:32p THU 0 BYE 129451 elwood eli tishberg 9:30p 9:32p THU 0 BYE 129450 hagbard Jon Wiley 9:20p 9:35p THU 0 BYE 129407 enzyme Enzyme [P] 8:32p 9:36p THU 0 BYE 129456 kellyc Kelly Clark 9:23p 9:36p THU 0 BYE 129433 morpheus Scott Corbin 8:59p 9:36p THU 0 BYE 129413 geekus Haji Uesato 8:36p 9:37p THU 0 BYE 129468 lion5171 Albert Lione 9:36p 9:37p THU 0 LOST -- more -- 129467 dead Bruce Fancher 9:35p 9:37p THU 0 BYE 129452 keever Tom Dale Keever 9:20p 9:41p THU 0 LOST 129470 unseen Sara Jane Levinson 9:38p 9:41p THU 0 LOST 129461 voidmstr Dennis Wilen 9:27p 9:43p THU 0 BYE (9:44pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:44pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: , maestr   lstrom MindVox [MAELSTROM] Simulation Approaching the portal that leads to the world of MaelStrom your eyes are drawn to an old Edison record player that is skipping endlessly over the same portion of a thick record, sporadically emitting a riff from Stairway to Heaven amidst a lot of static. Just as you are about to move closer for a look, a large black hearse screeches to a halt in front of you. Your eyes travel along the smooth classic lines of the vehicle, stopping at the front bumper, adorned with bumper stickers bearing the inscriptions: [Grateful Dead] [LorDz AnoNYmOus wuZ HeRe] and [Madonna! VOGUE!] Before you have time to ponder the deep meaning in all this, the doors open with a rusty screech and a large dwarf leaps out of the car and runs towards you. As he gets near you can make out that he is dressed in rusted armour covered with some sort of pink slop that doesn't smell too good. Stepping back to draw a weapon as he nears you, he stops his forward movement and proclaims: "MaelStrom is closed. It ain't gonna be open for a while to anybody but da playin-testers. And you don't look like one of 'em to me..." -- more -- Pausing to re-adjust his leather hat, which has a garish neon-colored pin stuck in it, reading: "OS/2 is THE answer... What was the question again?" he continues: "If you want to be eaten alive by giant bugs, or smashed to pieces by core dumps den youz can contact the life support team and leave them mails..." Thinking for an instant, he suddenly gets a sly glint in his eye and says: "Oh say, I was walkin down dis street right, and holdin' mah ATM card and then dese muggers dey came and wuz stealin it, and dey trows wine all over me and den makes me a job offer only I got to joins my fambly in Joisey and I can't get a dollar for the bus to ride a cab ona broom right?..." Scratching his scraggly beard, the dwarf stops mid-sentence, looks at the sky, which appears to cycle through the color spectrum every minute or two. As his eyes travel across the shifting expanse, he begins to speak in a monotone voice; "TV is in the MIND you understand... It FLEW out of Bill Cook and into Dale Drew, where it squished around making his mind VERY SORE -- but then as the -- more -- breaded rain of studded nerf balls crashed onto the astro-turf, the outer- people of the inner-planes chose that instant to lodge massive complications about the convulsions in question. After the priceless documentation, valued at 12 billion dollars and so many man-years of effort that the universe hasn't existed long enough for it to be tangible, the black hat FLEW out of Clifford Stoll and into the cast-off sea of whale images. Wiping the spittle from his mouth, the dwarf finishes, "Yo-yo's are VERY dangerous" This said, he turns around and begins to walk back towards his vehicle. Within a few moments you lose sight of him as everything takes on the con- sistency of jello and begins melting into itself before finally dissappear- ing in a wave of static. (9:45pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:45pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: games  MindVox [SINGLE-PLAYER GAMES] Selection Adventure - Colossal Cave: the FIRST text Adventure Game Hack - Search Underground for the Amulet of Yendor Larn - Quest for the magical potion in the World of Larn Nethack - A More Challenging Version of Hack! Experts Only! Ogre - Battle Cybernetic tanks in a Futuristic war-zone Robots - Match wits against devious Robots out to get You Robots2 - Dodge and Destroy even Deadlier Metallic Enemies UltraRogue - Dungeon Exploration in the style of Hack & Rogue [ Quit - Return to MindVox | "?" - View this Menu again ] [Select Game]: hack Restoring old save file...--More----------|......||....<.||......||......||......|#@...d..|----+---Level 1 Hp 14(16) Ac 10 Str 18 Exp 1 Hello mindvox, welcome to hack!Long or short help?  Welcome to HACK! ( description of version 1.0.2 ) Hack is a Dungeons and Dragons like game where you (the adventurer) descend into the depths of the dungeon in search of the Amulet of Yendor (reputed to be hidden on the twentieth level). You are accompanied by a little dog that can help you in many ways and can be trained to do all sorts of things. On the way you will find useful (or useless) items, (quite possibly with magic properties) and assorted monsters. You attack a monster by trying to move into the space a monster is in (but often it is much wiser to leave it alone). Unlike most adventure games, which give you a verbal description of your location, hack gives you a visual image of the dungeon level you are on. Hack uses the following symbols: A to Z and a to z: monsters. You can find out what a letter represents by saying "/ (letter)", as in "/A", which will tell you that 'A' is a giant ant. - and | These form the walls of a room (or maze). . this is the floor of a room. # this is a corridor. > this is the staircase to the next level. --More-- < the staircase to the previous level. ` A large boulder. @ You (usually). ^ A trap. ) A weapon of some sort. ( Some other useful object (key, rope, dynamite, camera, ...) [ A suit of armor. % A piece of food (not necessarily healthy ...). / A wand. = A ring. ? A scroll. ! A magic potion. $ A pile or pot of gold. Commands: Hack knows the following commands: ? help: print this list. Q Quit the game. S Save the game. ! Escape to a shell. ^Z Suspend the game. < up: go up the staircase (if you are standing on it). --More-- > down: go down (just like up). kjhlyubn - go one step in the direction indicated. k: north (i.e., to the top of the screen), j: south, h: west, l: east, y: ne, u: nw, b: se, n: sw. KJHLYUBN - Go in that direction until you hit a wall or run into something. m (followed by one of kjhlyubn): move without picking up any objects. M (followed by one of KJHLYUBN): Move far, no pickup. f (followed by one of kjhlyubn): move until something interesting is found. F (followed by one of KJHLYUBN): as previous, but forking of corridors is not considered interesting. i print your inventory. I print selected parts of your inventory, like in I* - print all gems in inventory; IU - print all unpaid items; IX - print all used up items that are on your shopping bill; I$ - count your money. s search for secret doors and traps around you. ^ ask for the type of a trap you found earlier. ) ask for current wielded weapon. --More-- [ ask for current armor. = ask for current rings. $ count how many gold pieces you are carrying. . rest, do nothing. , pick up some things. : look at what is here. ^T teleport. ^R redraw the screen. ^P repeat last message (subsequent ^P's repeat earlier messages). / (followed by any symbol): tell what this symbol represents. e eat food. w wield weapon. w- means: wield nothing, use bare hands. q drink (quaff) a potion. r read a scroll. T Takeoff armor. R Remove Ring. W Wear armor. P Put on a ring. z zap a wand. t throw an object or shoot an arrow. p pay your shopping bill. --More-- d drop something. d7a: drop seven items of object a. D Drop several things. In answer to the question "What kinds of things do you want to drop? [!%= au]" you should give zero or more object symbols possibly followed by 'a' and/or 'u'. 'a' means: drop all such objects, without asking for confirmation. 'u' means: drop only unpaid objects (when in a shop). a use, apply - Generic command for using a key to lock or unlock a door, using a camera, using a rope, etc. c call: name a certain object or class of objects. C Call: Name an individual monster. E Engrave: Write a message in the dust on the floor. E- means: use fingers for writing. O Set options. You will be asked to enter an option line. If this is empty, the current options are reported. Otherwise it should be a list of options separated by commas. Possible boolean options are: oneline, time, news, tombstone, rest_on_space, beginner. They can be negated by prefixing them with '!' or "no". A string option is name; it supplies the answer to the question "Who are you?"; it may have a suffix. --More-- A compound option is endgame; it is followed by a description of what parts of the list of topscorers should be printed when the game is finished. Usually one will not want to use the 'o' command, but instead put a HACKOPTIONS="...." line in one's environment. v print version number. You can put a number before a command to repeat it that many times, as in "20s" or "40.". At present, some information is displayed on the bottom line. (It is expected that this information will go away in future versions.) You see on what dungeon level you are, how many hit points you have now (and will have when fully recovered), what your armor class is (the lower the better), your strength, experience level/experience points and the state of your stomach. Have Fun, and Good Hacking! --More----------|......||....<.||......||......||......|#@...d..|----+---Level 1 Hp 14(16) Ac 10 Str 18 Exp 1 You don't have anything to drink.Unknown command 'x'What do you want to eat [e or ?*]? Unknown command 'o'Really quit?Goodbye Cave-man mindvox... You quit on dungeon level 1 with 83 points, and 33 pieces of gold, after 62 moves. You were level 1 with a maximum of 16 hit points when you quit. You made the top ten list! Number Points Name Hp [max] 1 83 mindvox-C quit on dungeon level 1. 14 [16] 2 50 root-S quit on dungeon level 1. 12 [12] 3 50 mindvox-S quit on dungeon level 1. 12 [12] 4 50 mindvox-F quit on dungeon level 1. 14 [14] [Select Game]: [Select Game]: q (9:48pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:48pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: info  MindVox [INFORMATION] Section _____________________________________________________ | | | MindVox - Introduction to the MindVox System | |_____________________________________________________| | | | Access - Methods of Gaining Access to MindVox | | Address - Physical and Electronic Addresses | | Billing - System Rates and Payment Schedules | | Credits - MindVox Software and System Design | | FAQ - Frequently Asked Questions & Answers | | Features - List of Services Available on System | | Hardware - Details about the MindVox Platforms | | NewYork - Introduction for Local NYC/NY Users | | Status - CURRENT SYSTEM STATUS UPDATE - READ! | | Terms - Terms & Conditions Members Agreement | |_____________________________________________________| [Topic]: (9:48pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: update  Our apologies for the down-time that began yesterday at around 3am and lasted until this evening when our network went back online. We had a power supply blow out on the Sun that runs Vox. This wouldn't have been critical except when we brought it back up we found that it took a lot of the hard disk along with it, leaving us without a bootable image. Along with a permanent office copy of a bootable SunOS CD we also picked up two additional hard drives, so all Suns are capable of booting in stand-alone mode and don't need a network. In the event that anything ever happens to one of them again traffic will be moved to another machine within a few hours at most. In other updates News has been coming in since Monday afternoon and piling up on the NeXT which currently handles uucp and hasn't had any down-time during all this. You might want to CATCH some of the higher volume groups since the messages are going to be a few days out of date. Also, the counter when you login that says [xxxx] New Messages, pertains ONLY to MindVox Forums that you subscribe to, it does not count the Usenet, which can receive hundreds of thousands of messages a day. The News on Vox is still on PSI for a few more days, our contract doesn't -- more -- technically expire for another 3 weeks, but as of yesterday we have a new one with Alternet for real-time NNTP. Alternet is the single largest supplier of News in North America and unlike PSI, remains very stable. News will be moved over to NNTP and Alternet by early May, we will be receiving a complete newsfeed with all groups worldwide, including regional and international. At the time of our move if you have some special group you'd like to read that isn't online, leave FEEDBACK and it'll be added. No incoming mail has been lost, all mail is spooled to the NeXT at this time. Anyone needing personal attention or assistance with something, is asked to please leave FEEDBACK; do not send mail to Patrick or Bruce (digital, dead) directly. Neither one reads the board or their mail on a daily basis and may not know what you're talking about. Someone reads FEEDBACK every day and will try to reply to anything critical within a day or two. If you need immediate attention dial 911, then phone the poison control center and follow their instructions carefully. If that doesn't help, you can also call the office during regular business hours (noon to midnight), at: The number is +1 212 989-2418 -- more -- Again, our apologies for the unexpected down-time. While there will probably be a few additional hiccups as we finish changing the internal structure of the system during the month of April, we do not expect to go offline for any length of time. By May the system will be demi-stable and we can start blowing things up on the other machines that aren't running Vox. Sending faxes during moments like these is futile, yet highly encouraged since it gives us something to do at 3am other then order coffee, ingest stimulants, and call people in California who are still awake and have copies of SparcWarEZ!@#!@ System Management (9:49pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:49pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: Chat CHAT is an invalid command. Type HELP for help. (9:49pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: bullshg it BULLSHIT is an invalid command. Type HELP for help. (9:50pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: settings  MindVox [SETTINGS] Display -=/[ Account Statistics for: unseen ]/=- Total Calls: 1 Messages Posted: 0 Last Call Date: 29-Apr-93 Uploaded: 0 Minutes this CALL: 8 Downloaded: 0 Minutes this MONTH: 10 New Messages: 2 Joined MindVox: 19-Apr-93 Plan Type: -=/[ Account Options / Current Settings ]/=- -=/[ Flags ]/=- Your Name: Sara Jane Levinson Screen Clear Active: Y Comment: Panta Hrei. -- More -- Disabled: N Text Editor: line Allow User to Page You: Y Terminal Type: ansi Expert Mode: N Protocol: Z Password: [Not Shown] Type "?" to Re-display your Status or Select one of the Following [C]omment / [E]ditor / [F]lags / [P]assword / [T]erminal / [X]fer Protocol: e MindVox [EDITOR SELECTION] Mode Please Choose one of the following methods of entering text to the System: Visual - Full Screen Editor (Make sure your TERMINAL setting is correct!) Jove - EMACS-like Visual Editor (Allows BLOCK moves, Cut & Paste, etc.) Line - Line Editor Mode (System Default - not pretty, but ALWAYS works) Your Account is presently set to use the line Editor. Preferred Editor? Visual Type "?" to Re-display your Status or Select one of the Following [C]omment / [E]ditor / [F]lags / [P]assword / [T]erminal / [X]fer Protocol: ?  MindVox [SETTINGS] Display -=/[ Account Statistics for: unseen ]/=- Total Calls: 1 Messages Posted: 0 Last Call Date: 29-Apr-93 Uploaded: 0 Minutes this CALL: 9 Downloaded: 0 Minutes this MONTH: 11 New Messages: 2 Joined MindVox: 19-Apr-93 Plan Type: -=/[ Account Options / Current Settings ]/=- -=/[ Flags ]/=- Your Name: Sara Jane Levinson Screen Clear Active: Y Comment: Panta Hrei. -- More -- Disabled: N Text Editor: Visual Allow User to Page You: Y Terminal Type: ansi Expert Mode: N Protocol: Z Password: [Not Shown] Type "?" to Re-display your Status or Select one of the Following [C]omment / [E]ditor / [F]lags / [P]assword / [T]erminal / [X]fer Protocol: x MindVox [FILE-TRANSFER PROTOCOL] Selection [K]...Kermit / [X]...Xmodem / [Y]...Ymodem / [Z]...Zmodem [Z] is Selected Protocol: ? MindVox [FILE-TRANSFER PROTOCOL] Selection [K]...Kermit / [X]...Xmodem / [Y]...Ymodem / [Z]...Zmodem [Z] is Selected Type "?" to Re-display your Status or Select one of the Following [C]omment / [E]ditor / [F]lags / [P]assword / [T]erminal / [X]fer Protocol: ?  MindVox [SETTINGS] Display -=/[ Account Statistics for: unseen ]/=- Total Calls: 1 Messages Posted: 0 Last Call Date: 29-Apr-93 Uploaded: 0 Minutes this CALL: 9 Downloaded: 0 Minutes this MONTH: 11 New Messages: 2 Joined MindVox: 19-Apr-93 Plan Type: -=/[ Account Options / Current Settings ]/=- -=/[ Flags ]/=- Your Name: Sara Jane Levinson Screen Clear Active: Y Comment: Panta Hrei. -- More -- Disabled: N Text Editor: Visual Allow User to Page You: Y Terminal Type: ansi Expert Mode: N Protocol: Z Password: [Not Shown] Type "?" to Re-display your Status or Select one of the Following [C]omment / [E]ditor / [F]lags / [P]assword / [T]erminal / [X]fer Protocol: (9:51pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:51pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: who  MindVox [WHO] Listing ___________ _____________________ ________ ___________________________________ | | | | | | Account | Name | Page | Login Time | |___________|_____________________|________|___________________________________| gearhead Sean Hamilton YES Thu Apr 29 20:55:34 1993 mitchf Mitchell Feinstein YES Thu Apr 29 21:39:56 1993 simonm Simon Moon YES Thu Apr 29 21:42:11 1993 ddc Dean Crane YES Thu Apr 29 21:00:00 1993 nmn Im Nomeansno NO Thu Apr 29 18:06:02 1993 nihilis Joel Boutros NO Thu Apr 29 20:44:14 1993 ardala Brenda Yee NO Thu Apr 29 21:42:25 1993 detect Gregg Wanciak NO Thu Apr 29 21:44:33 1993 maccop Larry Coutorie NO Thu Apr 29 21:26:57 1993 falconer Steve Copold NO Thu Apr 29 20:59:04 1993 galt Carlton G. Brown NO Thu Apr 29 20:59:16 1993 sulam James Waldrop YES Thu Apr 29 13:41:07 1993 unseen Sara Jane Levinson YES Thu Apr 29 21:41:48 1993 ddjttllm Dan Herschlag YES Thu Apr 29 19:00:37 1993 keever Tom Dale Keever YES Thu Apr 29 21:42:11 1993 nemesis Sean tygrett YES Thu Apr 29 20:34:07 1993 -- more -- sherman Lloyd Hopkins YES Thu Apr 29 21:36:47 1993 deckard Mike Gwertzman YES Thu Apr 29 21:48:16 1993 elan Elan Portnoy YES Thu Apr 29 21:43:53 1993 phaedra jane weaver YES Thu Apr 29 21:25:18 1993 stevek Steve K YES Thu Apr 29 21:26:45 1993 asagao Michael Huff YES Thu Apr 29 21:29:05 1993 script Benjamin Fitts YES Thu Apr 29 21:31:27 1993 freedom Richard LaRock NO Thu Apr 29 21:31:46 1993 (9:51pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: index  /\_-\(:::::::::)/\_-\ <((_)) MindVox ((_))> \- \/(:::::::::)\- \/ -=/[ Babylon ]/=- Bandwidth Club-Chaos ThugWorld -=/[ Computers (GUIs / Networks / Operating Systems) ]/=- Advocacy Amiga Silicon-Graphics NeXTSTEP Programming Apple Sun/SPARC NT Security Mac Laptops OS/2 Windows Viruses PC Networks Unix X -=/[ Creative-Arts ]/=- -- more -- Art Books Movies Writing Writing-Workshop -=/[ CyberSpace ]/=- Cyberpolis CPSR Ethics Media Piracy Round-Table Cyberpunk Gatherings Mondo Publications VR EFF Hacking Phrack Red-Tape Wired -=/[ Drugs ]/=- Cognitive-Enhancement Discussion Psychedelic Safety Steroids -=/[ Echoes ]/=- -=]) Under Construction ([=- -=/[ Erotica ]/=- -- more -- (9:52pm) [ Area: Babylon / Forum: Bandwidth ] (? for Menu) [Main Menu]: go cyberoplis     polis A Complete list of available Forums can be displayed with the INDEX command. If you know the full name of the forum you wish to go to you may enter it by typing it's name (ie: "Go Introductions"). To search for a pattern, add a slash to the beginning of the name. For instance, "go /puter" would take you to Computers:Amiga, the first Forum with the word Computers in the name. If you wish to continue a search you may do so by simply typing "Go /" again. In In the above case this would take you to Computers:Apple. Note that to return to Computers:Amiga, you can simply type "Go Amiga" Go to Forum: cpsr (9:52pm) [ Area: CyberSpace / Forum: CPSR ] (? for Menu) [Main Menu]: ?  MindVox [MAIN MENU] Commands About - Summary of Each Forum Finger - Get Info on Another User Bye - Leave the MindVox System Last - List Last 20 Callers Editorial - Read Overture Article Members - List Members of MindVox Expert - Turn Expert Menus On/Off Page USER - Write Message to a User Feedback - Mail to Support Staff Who - List Users Online Now -=/[ Other Areas of MindVox ]/=- Archives - Software and Text Files IRC - World-Wide Chat Network Chat - Multi-User Chat Lounge Info - MindVox Info File Area Forums - Enter the MindVox FORUMS Maelstrom - Multi-User Fantasy Game Help - Help with Using MindVox Mail - Send Electronic Mail Home - Your Private File Area Settings - Alter Your Configuration Games - Play Single-Player Games Usenet - Enter USENET NewsGroups Phantom Access Technologies, Inc. (TM) (9:53pm) [ Area: CyberSpace / Forum: CPSR ] (? for Menu) [Main Menu]: about No detailed information available about CPSR (9:53pm) [ Area: CyberSpace / Forum: CPSR ] (? for Menu) [Main Menu]: ] ] is an invalid command. Type HELP for help. (9:53pm) [ Area: CyberSpace / Forum: CPSR ] (? for Menu) [Main Menu]: [ [ is an invalid command. Type HELP for help. (9:53pm) [ Area: CyberSpace / Forum: CPSR ] (? for Menu) [Main Menu]: go cyberpunk (9:53pm) [ Area: CyberSpace / Forum: Cyberpunk ] (? for Menu) [Main Menu]: about CYBERSPACE: CYBERPUNK An area devoted to the discussion of Cyberpunk; the literary movement, the lifestyle, the fiction that has taken off and begun shaping the way science evolves the technology that make its dreams become real. (9:54pm) [ Area: CyberSpace / Forum: Cyberpunk ] (? for Menu) [Main Menu]: rea   go cpsr (9:54pm) [ Area: CyberSpace / Forum: CPSR ] (? for Menu) [Main Menu]: read -=/[ [12] New Messages / Begin Reading at (#1) ]/=- [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 1 of 12 Subject: Welcome From: tc (Dave Banisar) Date: Fri, 09 Apr 93 18:07:59 EDT Welcome to the CPSR forum. CPSR (Computer Professionals for Social Responsibility) is a membership group of computer scientists and others interested in the social effects of technology on society. It is based in Palo Alto, Ca with offices in Cambridge, Mass and Washington, DC and over 2 dozen chapters across the United States (most urban areas). It is a non-profit organization with the board of directors elected by the membership (not some rich guy selecting himself ;-). CPSR started as a mailing list at XEROX PARC in 1981 discussing SDI and military uses of technology. Today, our focus is on civil liberties, privacy and information access. Some recent projects we have done include: Successfully obtaining the first Bush National Security Directive on Computer Security (nsd-42) and its implimenting document (NTISSIC-600). Forced the United States Secret Service to admit that they have files on the recent 2600 mall raid. Are currently working with the ACLU and EFF to file a civil suit against the Secret Service. -- more (55%) -- Forced the National institute of Standards and Technology to admit that the National Security Agency was the actual creator of the new govt. encryption scheme-the Digital Signature Standard. Took the lead in fighting the FBI's Digital Telephony proposal. Sued the FBI to require disclosure of their reasons for thier proposal. Uncovered an analysis by the General Services Administration that described the proposal as a "threat to national security." Submitted to President Clinton a report on policies related to information access and technology. The report was generated from a netwide solicitation for suggestions which recieved over 1200 responses. Created a electronic library of documents on privacy, information access and other issues available via ftp/wais/gopher and email from cpsr.org. For more information on CPSR, email cpsr@csli.stanford.edu or ftp to the CPSR Internet Library at cpsr.org. dave -- more (97%) -- [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 2 of 12 Subject: Re: Welcome From: bwp (Jane Doe) Date: Fri, 09 Apr 93 20:47:01 EDT In-Reply-To: <1BFR2B2w165w@mindvox.phantom.com> Dave, I was wondering what CPSR's position regarding PGP is, or if it has even approached the subject. -3j [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 3 of 12 Subject: 2600 Mall Raid From: clortnoc (Dan d00m rulez) Date: Sat, 10 Apr 93 01:32:51 EDT In-Reply-To: <3omR2B2w165w@mindvox.phantom.com> On behalf of hackerdom I just wanted to thank the CPSR for exposing the SS actions at the Pentagon City Mall. Good work and keep it up. [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 4 of 12 Subject: Re: 2600 Mall Raid From: tc (Dave Banisar) Date: Sun, 11 Apr 93 17:43:29 EDT In-Reply-To: Thanks for the encouragement. I frequently and vocally encourage the use and distribution of PGP, especially by those who really need it, like human rights groups in Central America and Asia. As an almost lawyer (only 30 days to go!), I find the arguement that a math formula can be patented to be dubious at best (caveat: I'm not an expert in IP and I dont have the $ to get sued by Bidzos and prove him wrong). CPSR has never taken a stand one way or the other but franly we'd like to see encryption built into everything as a default privacy mode. We also plan to discuss it at our next CPSR Crypto and Privacy Roundtable and may even demonstrate it to the congressional staff and exec agency officials there as an example of how bad people want crypto in the computer world. Dave -- more (97%) -- [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 5 of 12 Subject: Re: 2600 Mall Raid From: strat (Bob Stratton) Date: Mon, 12 Apr 93 09:08:21 EDT tc (Dave Banisar) writes: > > Thanks for the encouragement. > > I frequently and vocally encourage the use and distribution of PGP, > especially by those who really need it, like human rights groups in > Central America and Asia. As an almost lawyer (only 30 days to go!)... Does that mean you're going to be all grumpy and obnoxious for several weeks while doing the Bar Exam Thing? I figure I'd ask now, since I've already lived through it several times before when friends went to take the bar and metamorphosed into feisty people, at least until the results came back. With respect to PGP, there is a channel of communication between RSA and the developers of PGP, which may bear fruit. Stay tuned. Yours in fun, --Strat -- more (89%) -- The Constitution isn't perfect, but it's a damn sight better than what we have now. [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 6 of 12 Subject: Re: 2600 Mall Raid From: tc (Dave Banisar) Date: Mon, 12 Apr 93 13:17:08 EDT In-Reply-To: Yes Dammit! Now do you have any other dumb questions? It would be nice to have RSA get off their asses and sanction the use of PGP so that "netgods" like Sternlight dont feel some need to play policeman. i may have phil and Bidzos in the same small room pretty soon. Lets see what happens... [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 7 of 12 Subject: CPSR Comments on WH Encryption initiative From: tc (Dave Banisar) Date: Sat, 17 Apr 93 10:44:57 EDT CPSR Crypto Statement ----------------------------------------------- April 16, 1993 Washington, DC COMPUTER PROFESSIONALS CALL FOR PUBLIC DEBATE ON NEW GOVERNMENT ENCRYPTION INITIATIVE Computer Professionals for Social Responsibility (CPSR) today called for the public disclosure of technical data underlying the government's newly-announced "Public Encryption Management" initiative. The new cryptography scheme was announced today by the White House and the National Institute for Standards and Technology (NIST), which will implement the technical specifications of the plan. A NIST spokesman acknowledged that the National Security Agency (NSA), the super- secret military intelligence agency, had actually developed the encryption technology around which the new initiative is built. According to NIST, the technical specifications and the Presidential directive establishing the plan are classified. To open the -- more (34%) -- initiative to public review and debate, CPSR today filed a series of Freedom of Information Act (FOIA) requests with key agencies, including NSA, NIST, the National Security Council and the FBI for information relating to the encryption plan. The CPSR requests are in keeping with the spirit of the Computer Security Act, which Congress passed in 1987 in order to open the development of non-military computer security standards to public scrutiny and to limit NSA's role in the creation of such standards. CPSR previously has questioned the role of NSA in developing the so-called "digital signature standard" (DSS), a communications authentication technology that NIST proposed for government-wide use in 1991. After CPSR sued NIST in a FOIA lawsuit last year, the civilian agency disclosed for the first time that NSA had, in fact, developed that security standard. NSA is due to file papers in federal court next week justifying the classification of records concerning its creation of the DSS. David Sobel, CPSR Legal Counsel, called the administration's apparent commitment to the privacy of electronic communications, as reflected in today's official statement, "a step in the right direction." But he questioned the propriety of NSA's role in the process and the apparent secrecy that has thus far shielded the development process from public scrutiny. "At a time when we are moving towards the development of -- more (76%) -- a new information infrastructure, it is vital that standards designed to protect personal privacy be established openly and with full public participation. It is not appropriate for NSA -- an agency with a long tradition of secrecy and opposition to effective civilian cryptography -- to play a leading role in the development process." CPSR is a national public-interest alliance of computer industry professionals dedicated to examining the impact of technology on society. CPSR has 21 chapters in the U.S. and maintains offices in Palo Alto, California, Cambridge, Massachusetts and Washington, DC. For additional information on CPSR, call (415) 322-3778 or e-mail . ====================================== [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 8 of 12 Subject: More information on WH Initiative From: tc (Dave Banisar) Date: Sat, 17 Apr 93 10:48:56 EDT Comments on White House Clipper Plan I attended the "interesting" NIST press conference yesterday on the "Clipper Chip" and may be able to clear up a few quaestions. According to NIST: The Chip has 4 functions, including Key Encryption Serial Number Escrow functionality Thus, it sounds like a key management system may have to be built into the devices that will be sold with the chip. However this means that they will also be able to determine which key to get becuase they will know the serial number. It also seems likely that once your key is compromised, its gone forever. This is a serious problem The Attorney General will determine next week who will be the escrow agents for this. I am willing to bet $ that NIST/Commerce will be one of -- more (47%) -- them (not a lot, after all, I do work for a non-profit). Everything about this proposal is classified. The chip is classified but even more disturbing, the president directing ordering a review into crypto policy is also classified. CPSR has already filed 11 FOIA requests for all information, including the directive. You can expect that we will be filing suit shortly to get those documents and force this out into the open. When I questioned them about why the review was happening after the proposal, they did not answer me. This is not 1984 all over again-its '86. The NSA tried this exact same "black box" proposal (minus the escrow) in 1986. Industry laughed them out of the park. NIST also stated that the proposal has been implimented for 14 months and they (NSA actually) have been working on it for at least 4 years. AT&T announced yesterday that will will begin selling devices with these Clippers in them immediatly. We've been sold down the river by ma bell again. Dave Banisar CPSR Washington Office -- more (97%) -- [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 9 of 12 Subject: Re: More information on WH Initiative From: cudigest (Jim Thomas) Date: Sat, 17 Apr 93 15:43:56 EDT In-Reply-To: <0Bo62B2w165w@mindvox.phantom.com> I hear that Oliver North and Poindexter will be featured speakers at May's Electronic Conference. I've written for more info (number to call is 800-845-7685). Anybody have more info on this? [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 10 of 12 Subject: Re: More information on WH Initiative From: tc (Dave Banisar) Date: Sat, 17 Apr 93 16:35:08 EDT In-Reply-To: I have the brochure. Chris Goggins will be there talking about Computer Security and Ollie will be talking about privacy (snort, grunt, choke, puke). Oliie seems to have the same problem as Barlow-confusing secrecy as privacy [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 11 of 12 Subject: Re: More information on WH Initiative From: kurtphil (Kurt Phillips) Date: Sat, 17 Apr 93 23:11:48 EDT In-Reply-To: <0c562B1w165w@mindvox.phantom.com> It appears the fox is designing the lock to the hen house. A good deal of this Fed inspired encryption seems redundant given that PGP is widely available. I suppose a sufficiently paranoid user can PGP his/her stuff before sending it through the Clipper chip... K. [ Area: CyberSpace / Forum: CPSR ] [Return] 1-12, [Q]uit: Post: 12 of 12 Subject: New Info on 2600 Case (4/20/93) From: tc (Dave Banisar) Date: Sat, 24 Apr 93 14:39:21 EDT New disclosures in 2600 case As you may recall, last November at a shopping mall outside of Washington, DC, a group of people affiliated with the computer magazine "2600" was confronted by mall security personnel, local police officers and several unidentified individuals. The group members were ordered to identify themselves and to submit to searches of their personal property. Their names were recorded by mall security personnel and some of their property was confiscated. However, no charges were ever brought against any of the individuals at the meeting. Computer Professionals for Social Responsibility ("CPSR") filed suit under the Freedom of Information Act and today received the Secret Service's response to the FOIA lawsuit, in which we are seeking agency records concerning the break-up of the meeting. I think it's safe to say that our suspicions have now been confirmed -- the Secret Service *did* obtain a list of names from mall security identifying the people in attendance at the meeting. There are three main points contained in the Secret Service's -- more (44%) -- court papers that are significant: 1) The agency states that the information it possesses concerning the incident was obtained "in the course of a criminal investigation that is being conducted pursuant to the Secret Service's authority to investigate access device and computer fraud." 2) The agency possesses two relevant documents and the information in those documents "consists solely of information identifying individuals." 3) The information was obtained from a "confidential source," and the agency emphasizes that the FOIA's definition of such a source includes "any private institution which provided information on a confidential basis." Taken together, these facts seem to prove that the Secret Service wanted names, they had the mall security people collect them, and they came away from the incident with the list they wanted. The agency asserts that "[t]he premature release of the identities of the individual(s) at issue could easily result in interference to the Secret Service's investigation by alerting these individual(s) that they are under investigation and thus allowing the individual(s) to alter their behavior and/or evidence." CPSR, in conjunction with EFF and the ACLU, is planning to challenge the actions of the mall security personnel, the local police and -- more (91%) -- the Secret Service on the ground that the incident amounted to a warrantless search and seizure conducted at the behest of the Secret Service. David Sobel CPSR Legal Counsel dsobel@washofc.cpsr.org [ Area: CyberSpace / Forum: CPSR ] [P]ost, [L]ist, [1-12] [Q]uit: l 001: Welcome by tc (Dave Banisar) 002: Re: Welcome by bwp (Jane Doe) 003: 2600 Mall Raid by clortnoc (Dan d00m rulez) 004: Re: 2600 Mall Raid by tc (Dave Banisar) 005: Re: 2600 Mall Raid by strat (Bob Stratton) 006: Re: 2600 Mall Raid by tc (Dave Banisar) 007: CPSR Comments on WH Encryption initi by tc (Dave Banisar) 008: More information on WH Initiative by tc (Dave Banisar) 009: Re: More information on WH Initiativ by cudigest (Jim Thomas) 010: Re: More information on WH Initiativ by tc (Dave Banisar) 011: Re: More information on WH Initiativ by kurtphil (Kurt Phillips) 012: New Info on 2600 Case (4/20/93) by tc (Dave Banisar) [ Area: CyberSpace / Forum: CPSR ] [P]ost, [L]ist, [1-12] [Q]uit: -=/[ End of All Songs / [No Further Messages] ]/=- [ Area: CyberSpace / Forum: CPSR ] [P]ost, [L]ist, [1-12] [Q]uit: q  -=/[ Returning to Main Menu ]/=- (9:55pm) [ Area: CyberSpace / Forum: CPSR ] (? for Menu) [Main Menu]: fo cyberpunk There are Several Commands which begin with FO. (9:55pm) [ Area: CyberSpace / Forum: CPSR ] (? for Menu) [Main Menu]: go cyberpunk (9:55pm) [ Area: CyberSpace / Forum: Cyberpunk ] (? for Menu) [Main Menu]: rad  a ead -=/[ [133] New Messages / Begin Reading at (#1) ]/=- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 1 of 133 CYBERSPACE: CYBERPUNK An area devoted to the discussion of Cyberpunk; the literary movement, the lifestyle, the fiction that has taken off and begun shaping the way science evolves the technology that make its dreams become real. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 2 of 133 Subject: plug-plug-plug-plug From: ahawks@mindvox.phantom.com (c@:mg) Date: Sun, 12 Jul 92 16:48:13 EDT I run a mailing list dedicated to talking about cyberpunk (in the literal and cultural sense), vr, vcomputer underground, industrial music/culture, chaos theory, and whatever else...basically it's geared for "the future and fringes of culture"...It's called FutureCulture...If you'd like to subscribe to this on-line mailing list, send mail to 'future-request@nyx.cs.du.edu' asking for more info or asking to subscribe... BTW - I've also typed up this huge "cyberography" that lists suggested books, magazines, BBSes, music, and all sorts of shit the cyber crowd is into..It's around 100k....Bruce Sterling, Steve Brown of SF Eye, St Jude of Mondo, are some of the people who've had nice things to say about it...It's also appeared in some on-line publications..Anybody who's interested in this file, send mail to the above address - it'll be auto-sent to you when/if you subscribe to my list, to... [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 3 of 133 Subject: mailing list From: klarry@mindvox.phantom.com (Larry Kessler) Date: Mon, 13 Jul 92 15:55:08 EDT I tried to subscribe and it bounced my mail out from your listing. Can you move it to this section so that we can read it? Larry [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 4 of 133 Subject: future-culture From: siva@mindvox.phantom.com (Stu Klingman) Date: Mon, 13 Jul 92 22:26:53 EDT ...has been having some connectivity problems. They'll be ironed out shortly. The Future-culture paper is being re-written and enhanced a bit, and'll no doubt be available for downloading from this world momentarily. I think. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 5 of 133 Subject: Cyberpunk/MindVox From: blain@mindvox.phantom.com (Blain Strickel) Date: Tue, 14 Jul 92 09:40:05 EDT This was out of FutureCulture but since its broken and the members look like they are all showing up here. here: MindVox went up on Saturday, in 48 hours it has amassed about 100 members, including people from from the geographic locations of Austria, Australia, Germany, Holland and Sweden. Members of Computer Underground Digest, the Electronic Frontier Foundation, Mondo 2000, Spin and High Times are online and rounding out the picture are 50-60 New York users and some two dozen Internet people. On the negative side. You == couldn't == post until just last night, because the code wasn't set for the new accounts in the right way, so only in the last 12 hours have messages started to show up. Half the people -- more (38%) -- online have their no chat set to on, so you can't contact them and there are places where options don't work right yet for things that should be working. The most aggrevating thing is probably the choked up Internet connection, which usually has a lot of people trying to get through all at once and keeps things running slow for Internet users. This is all to be expected from any new system, especially one where some of the main programmers spend part of each day talking with their lawyers instead of fixing bugs and one would hope that Kroupa and friends would move to a T1 feed faster than this fall, because if the last 48 hours are a indication, they are going to have a == lot == of Internet traffic. As it is right now, MindVox is 3 or 4 times as fast as that other venerable -- more (70%) -- service called the Well, the software it offers is much simpler to use and pleasant to deal with and it looks like the migration to MindVox has begun. It's almost too early to say anything about anything, because the wrapper just went off and one would get the idea that MindVox is a party that is in the awkward phase right before the music comes on and everything starts to move. If you want to see the birth of a system that is going to be doing big things in Cyberspace and be part of that, check out MindVox. If you want to read a lot of things without taking part, wait at least two weeks. Best, Blain -- more (95%) -- Hello World! First spin on.......... [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 6 of 133 Subject: Aggripa From: sparc@mindvox.phantom.com (John Gaelum) Date: Sat, 18 Jul 92 12:40:49 EDT I have heard all kinds of stories about this one, what the hell is Aggripa going to be, or what is it? What little I've heard about it doesn't make any sense. If you don't know what I'm talking about, its Gibson's new book which has been described in too many different ways to repeat right now. if anyone knows the real deal, please enlighten us. Sparc [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 7 of 133 Subject: Agrippa / FC From: ahawks@mindvox.phantom.com (c@:mg) Date: Sat, 18 Jul 92 17:12:30 EDT First of all, FutureCulture: The machine it runs on is being moved, (nyx.cs.du.edu), so there have been problems....Approxiamtely every 3 hours, it forgets who ever single user is and deletes a couple thousand people from the password list - that is why when you send mail to future[-request] it bounces....There is a chance that mail can still get through, if you send it at the right time...:) :) :) Not much I can really do about it, hopefully the problems will be fixed soon... Agrippa: It is a poem, not a book. It is somewhat autobiographical. It is on disk. It costs between $450 and $7,500 depending on which edition you want. Gibson worked with 2 other artists in creating this "let's-blur-the-lines-of-art" work, Kevin Begos and Dennis Ashbaugh. The only people to *for sure* have a copy, that I know of, is the Mirrorshades group. The interesting thing about Agrippa: A Book of the Dead is the protection against redistribution. 2 rumors are going around that either: 1, it deletes itself after being read (remember, this work is on a disk) or, 2, it is encrypted after reading. Last I heard, Loyd Blankenship posted to alt.cyberpunk that he will try and get a copy and -- more (93%) -- distribute it to the net (which was *supposedly* intended for Agrippa) [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 8 of 133 Subject: Futurewhat? From: archer@mindvox.phantom.com (Richard Newson) Date: Sun, 19 Jul 92 16:25:15 EDT Read title Whatis Future Culture? [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 9 of 133 Subject: Future Culture From: blain@mindvox.phantom.com (Blain Strickel) Date: Mon, 20 Jul 92 00:06:56 EDT Is a very nice mailing list, that might be more useful if it was moved here or to another site where things == work == at least some of the time, I have been unable to get anything through for almost two weeks. Best, Blain [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 10 of 133 Subject: Agrippa From: wtap (Wire Tap!) Date: Fri, 24 Jul 92 23:53:18 EDT In an article I read, Agrippa was described as this: Only in the neighborhood of 500 copies are being made (if memory serves me correctly). It is on disk, and does delete itself after being read. The pages appear on screen (as regular text) and turn at a preordained rate. You cannot stop, and you cannot go back. As for copy protection, I do not know. I also heard the story was to be released to the net. It costs from $450 to $7500 (I think) and comes in from a regular box (the $450 version) to a hardwood case with brass insets and all that jazzy crap. I only know of Ashbaugh doing the art. The catch is, that there are techno interpretations of viruses on the case. Some dissapear after an hours exposure to light, some appear in an hour. All done with some crazy ink. This information was obtained from Details, in an article apppearing several months ago. Just think, the library of congress has to recieve 2 copies for evaluation. That leaves us with 2 less to buy! [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 11 of 133 Subject: Agrippa From: phiber (Phiber Optik) Date: Sat, 25 Jul 92 02:00:15 EDT It doesn't DELETE itself after being read, it ENCRYPTS itself. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 12 of 133 Subject: Yeah, it ENCRYPTS itself... From: siva (Stu Klingman) Date: Sat, 25 Jul 92 15:09:00 EDT In fact, that's why gibson had trouble getting the book exportable. Laws prohibit export of encryption technology. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 13 of 133 Subject: Agrripa From: tonyd (Anthony Desjardin) Date: Sat, 25 Jul 92 23:54:14 EDT SO where can you buy it ? [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 14 of 133 Subject: This book.. From: ahmed (Ahmed Kufuti) Date: Mon, 27 Jul 92 03:15:48 EDT This self-destructing book you speak of, it sounds like a really silly and crazy thing. Why are so few copies being printed? Is it ever going to come out in hardcover or paper back so that the general public could read it? And if not, why bother writing it in first place? These sci-fi writers, they are so crazy sometimes, you know.. ahmed [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 15 of 133 Subject: Agrippa From: ahawks (Andy) Date: Sat, 08 Aug 92 02:16:15 EDT The purpose of Agrippa is not to be "the next in the sprawl series" or something like that...It is an autobiographical poem by Gibson PLUS work from two OTHER artists...Agrippa is more of an art package than anything else.... If anyone actually want sto buy it, here's the address: Kevin Begos, Jr. Apartment #4D 1411 York Ave. New York, NY 10021 Phone @ 212.650.9324 Printing this with the hope that people here have respect, and Begos won't be baraged by inane phone calls as to what Agrippa is all about...Only call him if you're ready to spend at least $450 for it... -- more (83%) -- FutureCulture: It works now...Again, I had no control over the problems with the system...That was out of my hands... [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 16 of 133 Subject: Future Culture From: bruces (Bruce Sterling) Date: Wed, 23 Sep 92 22:06:38 EDT In-Reply-To: Subject: FutureCulture FAQ To: future@nyx.cs.du.edu Date: Mon, 17 Aug 92 13:44:11 MDT _____________________ ____________________ / __________________/ / ________________/ / /____________ / / / ____________/ / / / / / /_______________ /__/ uture /__________________/ ulture ____________________________________________________________ _______ | | | Tomorrow's Reality Today..... | -- more (26%) -- |___________________________________________________________ ________| A somewhat-definitive guide to resources bringing you the future..... updated: August.16.1992 ____________________________________________________________ ___________________ subscriptions to the futureculture mailinglist: future-request@nyx.cs.du.edu specify: real-time, digest, or faq only info: subject 'send info' typed/cut/pasted/copied by hawkeye (andy) ahawks@nyx.cs.du.edu 303.438.1481 (bbs) ____________________________________________________________ ___________________ -- more (46%) -- While no article that attempts to document an entire emerging subculture can be complete, I will do my best to give you enough complete and accurate information to get you on your way to the future. This article will focus mainly on cyberpunk culture, rave culture, industrial, post po-mo, virtual reality, drugs, computer underground, etc. Basically, the elements that make up the developing techno-underground, the new edge, the technoculture. Included in this article will be: suggested readings -- books, magazines, zines, requisite authors, etc., BBSes devoted to relevant topics, corporations and merchandise geared toward the techno-aware, Internet e-mail addresses for relevant figure-heads in this area, suggested music and movies/videos, FTP sites, etc. I will do my best to update this article every so often, as the techno-underground is not stagnant and is always shifting and changing and moving forward. If you have any complaints/comments/suggestions/errors or just wanna send someone mail, write to me on the Internet - -- more (78%) -- ahawks@nyx.cs.du.edu. I also welcome addition requests and such - feel free to say "hey man, add blah-blah to the list!" -----all the information contained in this article is for information purposes only - I am not responsible for anything but me and all that - I disclaim everything I possibly can and all that other stuff -----many thanks go out to The Butler for his article "An Introduction to the Computer Underground", which was an invaluable resource and model! ____________________________________________________________ . Frankly it just goes on like that for pages *8-) bruces@well [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 17 of 133 Subject: Statement of Principle From: bruces (Bruce Sterling) Date: Wed, 23 Sep 92 22:15:02 EDT In-Reply-To: Bruce Sterling bruces@well.sf.ca.us Catscan 10 From SCIENCE FICTION EYE #10 A STATEMENT OF PRINCIPLE I just wrote my first nonfiction book. It's called THE HACKER CRACKDOWN: LAW AND DISORDER ON THE ELECTRONIC FRONTIER. Writing this book has required me to spend much of the past year and a half in the company of hackers, cops, and civil libertarians. I've spent much time listening to arguments over what's legal, what's illegal, what's right and wrong, what's decent and what's despicable, what's moral and immoral, in the world of computers and civil liberties. My various informants were knowledgeable people who cared passionately about these issues, and most of them seemed well-intentioned. Considered as a whole, however, their opinions were a baffling mess of -- more (4%) -- contradictions. When I started this project, my ignorance of the issues involved was genuine and profound. I'd never knowingly met anyone from the computer underground. I'd never logged-on to an underground bulletin-board or read a semilegal hacker magazine. Although I did care a great deal about the issue of freedom of expression, I knew sadly little about the history of civil rights in America or the legal doctrines that surround freedom of the press, freedom of speech, and freedom of association. My relations with the police were firmly based on the stratagem of avoiding personal contact with police to the greatest extent possible. I didn't go looking for this project. This project came looking for me. I became inextricably involved when agents of the United States Secret Service, acting under the guidance of federal attorneys from Chicago, came to my home town of Austin on March 1, 1990, and confiscated the computers of a local science fiction gaming publisher. Steve Jackson Games, Inc., of Austin, was about to publish a gaming-book called GURPS Cyberpunk. When the federal law-enforcement agents discovered the electronic manuscript of CYBERPUNK on the computers they had seized from Mr. Jackson's offices, they expressed grave shock and alarm. They declared that CYBERPUNK was "a manual for computer crime." -- more (10%) -- It's not my intention to reprise the story of the Jackson case in this column. I've done that to the best of my ability in THE HACKER CRACKDOWN; and in any case the ramifications of March 1 are far from over. Mr Jackson was never charged with any crime. His civil suit against the raiders is still in federal court as I write this. I don't want to repeat here what some cops believe, what some hackers believe, or what some civil libertarians believe. Instead, I want to discuss my own moral beliefs as a science fiction writer -- such as they are. As an SF writer, I want to attempt a personal statement of principle. It has not escaped my attention that there are many people who believe that anyone called a "cyberpunk" must be, almost by definition, entirely devoid of principle. I offer as evidence an excerpt from Buck BloomBecker's 1990 book, SPECTACULAR COMPUTER CRIMES. On page 53, in a chapter titled "Who Are The Computer Criminals?", Mr. BloomBecker introduces the formal classification of "cyberpunk" criminality. "In the last few years, a new genre of science fiction has arisen under the evocative name of 'cyberpunk.' Introduced in the work of William Gibson, particularly in his prize-winning novel NEUROMANCER, cyberpunk takes an apocalyptic view of the technological future. In NEUROMANCER, the protagonist is a futuristic hacker who must use the most -- more (17%) -- sophisticated computer strategies to commit crimes for people who offer him enough money to buy the biological creations he needs to survive. His life is one of cynical despair, fueled by the desire to avoid death. Though none of the virus cases actually seen so far have been so devastating, this book certainly represents an attitude that should be watched for when we find new cases of computer virus and try to understand the motivations behind them. "The New York Times's John Markoff, one of the more perceptive and accomplished writers in the field, has written than a number of computer criminals demonstrate new levels of meanness. He characterizes them, as do I, as cyberpunks." Those of us who have read Gibson's NEUROMANCER closely will be aware of certain factual inaccuracies in Mr. BloomBecker's brief review. NEUROMANCER is not "apocalyptic." The chief conspirator in NEUROMANCER forces Case's loyalty, not by buying his services, but by planting poison-sacs in his brain. Case is "fueled" not by his greed for money or "biological creations," or even by the cynical "desire to avoid death," but rather by his burning desire to hack cyberspace. And so forth. However, I don't think this misreading of NEUROMANCER is based on carelessness or malice. The rest of Mr. BloomBecker's book generally is informative, well-organized, and thoughtful. Instead, I feel that Mr. -- more (23%) -- BloomBecker manfully absorbed as much of NEUROMANCER as he could without suffering a mental toxic reaction. This report of his is what he actually *saw* when reading the novel. NEUROMANCER has won quite a following in the world of computer crime investigation. A prominent law enforcement official once told me that police unfailingly conclude the worst when they find a teenager with a computer and a copy of NEUROMANCER. When I declared that I too was a "cyberpunk" writer, she asked me if I would print the recipe for a pipe-bomb in my works. I was astonished by this question, which struck me as bizarre rhetorical excess at the time. That was before I had actually examined bulletin-boards in the computer underground, which I found to be chock-a-block with recipes for pipe-bombs, and worse. (I didn't have the heart to tell her that my friend and colleague Walter Jon Williams had once written and published an SF story closely describing explosives derived from simple household chemicals.) Cyberpunk SF (along with SF in general) has, in fact, permeated the computer underground. I have met young underground hackers who use the aliases "Neuromancer," "Wintermute" and "Count Zero." The Legion of Doom, the absolute bete noire of computer law-enforcement, used to congregate on a bulletin-board called "Black Ice." In the past, I didn't know much about anyone in the underground, but they certainly knew about me. Since that time, I've had people -- more (30%) -- express sincere admiration for my novels, and then, in almost the same breath, brag to me about breaking into hospital computers to chortle over confidential medical reports about herpes victims. The single most stinging example of this syndrome is "Pengo," a member of the German hacker-group that broke into Internet computers while in the pay of the KGB. He told German police, and the judge at the trial of his co-conspirators, that he was inspired by NEUROMANCER and John Brunner's SHOCKWAVE RIDER. I didn't write NEUROMANCER. I did, however, read it in manuscript and offered many purportedly helpful comments. I praised the book publicly and repeatedly and at length. I've done everything I can to get people to read this book. I don't recall cautioning Gibson that his novel might lead to anarchist hackers selling their expertise to the ferocious and repulsive apparat that gave the world the Lubyanka and the Gulag Archipelago. I don't think I could have issued any such caution, even if I'd felt the danger of such a possibility, which I didn't. I still don't know in what fashion Gibson might have changed his book to avoid inciting evildoers, while still retaining the integrity of his vision -- the very quality about the book that makes it compelling and worthwhile. This leads me to my first statements of moral principle. -- more (36%) -- As a "cyberpunk" SF writer, I am not responsible for every act committed by a Bohemian with a computer. I don't own the word "cyberpunk" and cannot help where it is bestowed, or who uses it, or to what ends. As a science fiction writer, it is not my business to make people behave. It is my business to make people imagine. I cannot control other people's imaginations -- any more than I would allow them to control mine. I am, however, morally obliged to speak out when acts of evil are committed that use my ideas or my rhetoric, however distantly, as a justification. Pengo and his friends committed a grave crime that was worthy of condemnation and punishment. They were clever, but treacherously clever. They were imaginative, but it was imagination in a bad cause. They were technically accomplished, but they abused their expertise for illicit profit and to feed their egos. They may be "cyberpunks" -- according to many, they may deserve that title far more than I do -- but they're no friends of mine. What is "crime"? What is a moral offense? What actions are evil and dishonorable? I find these extraordinarily difficult questions. I have no special status that should allow me to speak with authority on -- more (41%) -- such subjects. Quite the contrary. As a writer in a scorned popular literature and a self-professed eccentric Bohemian, I have next to no authority of any kind. I'm not a moralist, philosopher, or prophet. I've always considered my "moral role," such as it is, to be that of a court jester -- a person sometimes allowed to speak the unspeakable, to explore ideas and issues in a format where they can be treated as games, thought-experiments, or metaphors, not as prescriptions, laws, or sermons. I have no religion, no sacred scripture to guide my actions and provide an infallible moral bedrock. I'm not seeking political responsibilities or the power of public office. I habitually question any pronouncement of authority, and entertain the liveliest skepticism about the processes of law and justice. I feel no urge to conform to the behavior of the majority of my fellow citizens. I'm a pain in the neck. My behavior is far from flawless. I lived and thrived in Austin, Texas in the 1970s and 1980s, in a festering milieu of arty crypto-intellectual hippies. I've committed countless "crimes," like millions of other people in my generation. These crimes were of the glamorous "victimless" variety, but they would surely have served to put me in prison had I done them, say, in front of the State Legislature. Had I lived a hundred years ago as I live today, I would probably have been lynched by outraged fellow Texans as a moral abomination. If I -- more (48%) -- lived in Iran today and wrote and thought as I do, I would probably be tried and executed. As far as I can tell, moral relativism is a fact of life. I think it might be possible to outwardly conform to every jot and tittle of the taboos of one's society, while feeling no emotional or intellectual commitment to them. I understand that certain philosophers have argued that this is morally proper behavior for a good citizen. But I can't live that life. I feel, sincerely, that my society is engaged in many actions which are foolish and shortsighted and likely to lead to our destruction. I feel that our society must change, and change radically, in a process that will cause great damage to our present system of values. This doesn't excuse my own failings, which I regret, but it does explain, I hope, why my lifestyle and my actions are not likely to make authority feel entirely comfortable. Knowledge is power. The rise of computer networking, of the Information Society, is doing strange and disruptive things to the processes by which power and knowledge are currently distributed. Knowledge and information, supplied through these new conduits, are highly corrosive to the status quo. People living in the midst of technological revolution are living outside the law: not necessarily because they mean to break laws, but because the laws are vague, obsolete, overbroad, draconian, or unenforceable. Hackers break laws as a matter of course, -- more (55%) -- and some have been punished unduly for relatively minor infractions not motivated by malice. Even computer police, seeking earnestly to apprehend and punish wrongdoers, have been accused of abuse of their offices, and of violation of the Constitution and the civil statutes. These police may indeed have committed these "crimes." Some officials have already suffered grave damage to their reputations and careers -- all the time convinced that they were morally in the right; and, like the hackers they pursued, never feeling any genuine sense of shame, remorse, or guilt. I have lived, and still live, in a counterculture, with its own system of values. Counterculture -- Bohemia -- is never far from criminality. "To live outside the law you must be honest" was Bob Dylan's classic hippie motto. A Bohemian finds romance in the notion that "his clothes are dirty but his hands are clean." But there's danger in setting aside the strictures of the law to linchpin one's honor on one's personal integrity. If you throw away the rulebook to rely on your individual conscience you will be put in the way of temptation. And temptation is a burden. It hurts. It is grotesquely easy to justify, to rationalize, an action of which one should properly be ashamed. In investigating the milieu of computer-crime I have come into contact with a world of temptation formerly closed to me. Nowadays, it would take no great effort on my part to break into computers, to steal long-distance telephone service, to ingratiate myself with people who -- more (62%) -- would merrily supply me with huge amounts of illicitly copied software. I could even build pipe-bombs. I haven't done these things, and disapprove of them; in fact, having come to know these practices better than I cared to, I feel sincere revulsion for them now. But this knowledge is a kind of power, and power is tempting. Journalistic objectivity, or the urge to play with ideas, cannot entirely protect you. Temptation clings to the mind like a series of small but nagging weights. Carrying these weights may make you stronger. Or they may drag you down. "His clothes are dirty but his hands are clean." It's a fine ideal, when you can live up to it. Like a lot of Bohemians, I've gazed with a fine disdain on certain people in power whose clothes were clean but their hands conspicuously dirty. But I've also met a few people eager to pat me on the back, whose clothes were dirty and their hands as well. They're not pleasant company. Somehow one must draw a line. I'm not very good at drawing lines. When other people have drawn me a line, I've generally been quite anxious to have a good long contemplative look at the other side. I don't feel much confidence in my ability to draw these lines. But I feel that I should. The world won't wait. It only took a few guys with poolcues and switchblades to turn Woodstock Nation into Altamont. Haight-Ashbury was once full of people who could trust anyone they'd smoked grass with and love anyone they'd dropped acid with -- for about six months. Soon the -- more (69%) -- place was aswarm with speed-freaks and junkies, and heaven help us if they didn't look just like the love-bead dudes from the League of Spiritual Discovery. Corruption exists, temptation exists. Some people fall. And the temptation is there for all of us, all the time. I've come to draw a line at money. It's not a good line, but it's something. There are certain activities that are unorthodox, dubious, illegal or quasi-legal, but they might perhaps be justified by an honest person with unconventional standards. But in my opinion, when you're making a commercial living from breaking the law, you're beyond the pale. I find it hard to accept your countercultural sincerity when you're grinning and pocketing the cash, compadre. I can understand a kid swiping phone service when he's broke, powerless, and dying to explore the new world of the networks. I don't approve of this, but I can understand it. I scorn to do this myself, and I never have; but I don't find it so heinous that it deserves pitiless repression. But if you're stealing phone service and selling it -- if you've made yourself a miniature phone company and you're pimping off the energy of others just to line your own pockets -- you're a thief. When the heat comes to put you away, don't come crying "brother" to me. If you're creating software and giving it away, you're a fine human being. If you're writing software and letting other people copy it and try it out as shareware, I appreciate your sense of trust, and if I -- more (76%) -- like your work, I'll pay you. If you're copying other people's software and giving it away, you're damaging other people's interests, and should be ashamed, even if you're posing as a glamorous info-liberating subversive. But if you're copying other people's software and selling it, you're a crook and I despise you. Writing and spreading viruses is a vile, hurtful, and shameful activity that I unreservedly condemn. There's something wrong with the Information Society. There's something wrong with the idea that "information" is a commodity like a desk or a chair. There's something wrong with patenting software algorithms. There's something direly meanspirited and ungenerous about inventing a language and then renting it out to other people to speak. There's something unprecedented and sinister in this process of creeping commodification of data and knowledge. A computer is something too close to the human brain for me to rest entirely content with someone patenting or copyrighting the process of its thought. There's something sick and unworkable about an economic system which has already spewed forth such a vast black market. I don't think democracy will thrive in a milieu where vast empires of data are encrypted, restricted, proprietary, confidential, top secret, and sensitive. I fear for the stability of a society that builds sandcastles out of databits and tries to stop a real-world tide with royal commands. -- more (82%) -- Whole societies can fall. In Eastern Europe we have seen whole nations collapse in a slough of corruption. In pursuit of their unworkable economic doctrine, the Marxists doubled and redoubled their efforts at social control, while losing all sight of the values that make life worth living. At last the entire power structure was so discredited that the last remaining shred of moral integrity could only be found in Bohemia: in dissidents and dramatists and their illegal samizdat underground fanzines. Their clothes were dirty but their hands were clean. The only agitprop poster Vaclav Havel needed was a sign saying *Vaclav Havel Guarantees Free Elections.* He'd never held power, but people believed him, and they believed his Velvet Revolution friends. I wish there were people in the Computer Revolution who could inspire, and deserved to inspire, that level of trust. I wish there were people in the Electronic Frontier whose moral integrity unquestionably matched the unleashed power of those digital machines. A society is in dire straits when it puts its Bohemia in power. I tremble for my country when I contemplate this prospect. And yet it's possible. If dire straits come, it can even be the last best hope. The issues that enmeshed me in 1990 are not going to go away. I became involved as a writer and journalist, because I felt it was right. Having made that decision, I intend to stand by my commitment. I expect to stay involved in these issues, in this debate, for the rest of my -- more (89%) -- life. These are timeless issues: civil rights, knowledge, power, freedom and privacy, the necessary steps that a civilized society must take to protect itself from criminals. There is no finality in politics; it creates itself anew, it must be dealt with every day. The future is a dark road and our speed is headlong. I didn't ask for power or responsibility. I'm a science fiction writer, I only wanted to play with Big Ideas in my cheerfully lunatic sandbox. What little benefit I myself can contribute to society would likely be best employed in writing better SF novels. I intend to write those better novels, if I can. But in the meantime I seem to have accumulated a few odd shreds of influence. It's a very minor kind of power, and doubtless more than I deserve; but power without responsibility is a monstrous thing. In writing HACKER CRACKDOWN, I tried to describe the truth as other people saw it. I see it too, with my own eyes, but I can't yet pretend to understand what I'm seeing. The best I can do, it seems to me, is to try to approach the situation as an open-minded person of goodwill. I therefore offer the following final set of principles, which I hope will guide me in the days to come. I'll listen to anybody, and I'll try to imagine myself in their situation. I'll assume goodwill on the part of others until they fully earn my distrust. I won't cherish grudges. I'll forgive those who change their -- more (96%) -- minds and actions, just as I reserve the right to change my own mind and actions. I'll look hard for the disadvantages to others, in the things that give me advantage. I won't assume that the way I live today is the natural order of the universe, just because I happen to be benefiting from it at the moment. And while I don't plan to give up making money from my ethically dubious cyberpunk activities, I hope to temper my impropriety by giving more work away for no money at all. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 18 of 133 Subject: Re: Statement of Principle From: mcmullen (John F. McMullen) Date: Thu, 24 Sep 92 00:29:19 EDT In-Reply-To: Bruce's piece was originally published in the most recent Science Fiction Eye. It has, as I understand, received a lot of comment and the nexty isue of that quarterly will contain a good deal of response to Bruce's piece (including pieces from Charles Platt ("charles" on Mindvox) and myself -- once the piece is published, I will try as Bruce has, to post my piece here. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 19 of 133 Subject: Re: Statement of Principle From: chrmsync (Chrome Sync) Date: Thu, 24 Sep 92 02:56:47 EDT In-Reply-To: Bully to Bruce! Let's stop the government from pulling our mirrorshades over our own eyes in an attempt to remove all personal freedoms under the auspices of catching "dangerous criminals". I don't want and end to assurances against unreasonable search and seizure in the "war on drugs" (personally, I'm for decriminalization, on libertarian grounds, but that aside ...) or on a war against explorers in the information age. Some are unscrupulous, some are principled, and some are just joy riding the electron wave. But none of this justifies and end to the individual rights to life, liberty, and property ... that pursuit of hapiness is too valuable an idea to be violated by law enforcement trying to catch a few criminals. I opposed, but eventually begrugingly accepted sobriety checkpoints, but that's about it!! -- more (93%) -- "Information wants to be free." Chrome Sync [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 20 of 133 Subject: Electronic Cowboys and the Information Age From: deathlok (Keith Mezzina) Date: Fri, 13 Nov 92 01:47:54 EST In-Reply-To: Hey, that subject almost sounds like the name of a Techno Group... Greetings, folks. This happens to be my First post here, lets hope it works well. The one thing that amazes me more than ANYTHING else about "Data Security" is this: If you don't want John Q. Public reading it, don't put it on a public net. If you don't want Smith the Hacker reading it, either encrypt it, or keep it away from a computer with a modem connected to it. Most of the information that is "Confidential" and "Hush Hush" is next to useless to 99.9% of the population, .05% might actually have a use for it, and .05% just think it's neato to say "Hey, look what I found." I could understand pressing charges against someone who hacks his way into a system, then crashes it, and actually causes damage. Then you are costing people time and money. But what's the harm of looking? It all comes down to the same old question... "Why'd you climb that mountain?" -- more (94%) -- Because it's there, folks. Because it's there. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 21 of 133 Subject: Re: Electronic Cowboys and the Information Age From: ozone (Al Macey) Date: Sat, 14 Nov 92 15:22:28 EST In-Reply-To: The difference is that climbing the mountain doesn't require subversive tactics, unless you wanna climb Space Mountain after hours. I do think that it is funny that in America, we have these "liability" laws, suggesting that if you hop a fence, go swimming in someone's pool, and drown, its their fault for having a pool. This doesn't seem to apply to computers. People are not held liable for leaving their dirty laundry laying around. Nevertheless, most companies/organizations consider their computers to be private property, and they dno't understand that hooking said computer up to the net makes their hardware more public. The distinction is lost, somewhere, and I really think that serous time and considera{_tion will be needed to make applicable laws for computers that are accessible by phone or telnet. On the other hand, if they are going to arrest hackers for "lying" about who they are in order to gain access, then they should arrest anone who lies about who they are to gain information. Including reporters, collection agencies, and what not. Really, what is the difference between fooling a stupid system and fooling a stupid person? -- more (96%) -- Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 22 of 133 Subject: Re: Electronic Cowboys and the Information Age From: deathlok (Keith Mezzina) Date: Mon, 16 Nov 92 19:13:29 EST In-Reply-To: <64w9TB1w165w@mindvox.phantom.com> I think the difference comes down to this: When you fool a stupid computer, you offend a bunch of folks; The system administrators, the programmers, and the whole taco. When you fool one person, it's more personal. Who wants to admit they were strung along? (Pardon the rather chopped up style of the last post, I was almost asleep at the keyboard.) I DO agree with the bit on misdirection on the part of the 'Guilty' parties. What's the difference between a reporter that lies to someone to about his identity to get a story, a cop who does the same thing to make an arrest, and a hacker who lies about his ID to gain access to a system? Well, the reporter and the cop have a whole lot of people standing behind them saying "It's in the public's interest and welfare." Nobody stands behind the hackers. It's about numbers and popularity. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 23 of 133 Subject: Re: plug-plug-plug-plug From: fetus (Gregory Hempel) Date: Fri, 04 Dec 92 03:28:32 EST ahawks@mindvox.phantom.com (c@:mg) writes: > I run a mailing list dedicated to talking about cyberpunk (in the literal > and cultural sense), vr, vcomputer underground, industrial music/culture, > chaos theory, and whatever else...basically it's geared for "the future > and fringes of culture"...It's called FutureCulture...If you'd like to > subscribe to this on-line mailing list, send mail to > 'future-request@nyx.cs.du.edu' asking for more info or asking to > subscribe... > > BTW - I've also typed up this huge "cyberography" that lists suggested > books, magazines, BBSes, music, and all sorts of shit the cyber crowd is > into..It's around 100k....Bruce Sterling, Steve Brown of SF Eye, St Jude > of Mondo, are some of the people who've had nice things to say about > it...It's also appeared in some on-line publications..Anybody who's > interested in this file, send mail to the above address - it'll be > auto-sent to you when/if you subscribe to my list, to... > -- more (79%) -- We some where along the line and I dont know how some one sent via UUPC a Future Culture to my system. Go figure... And well I was interested in where exactly the KrackerBox was at??? The number in the MOndo is wrong the nmber in the FC is wrong etc etc... Help??? FeTuS [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 24 of 133 Subject: Re: plug-plug-plug-plug From: ahawks (Andy Hawks) Date: Fri, 04 Dec 92 22:40:58 EST In-Reply-To: <0D29uB2w165w@mindvox.phantom.com> Don't call the Kracker Box...It changed numbers, and is now run by a guy who, well, honestly I don't know too well...My friend Rober (oops Robert) Scorpio did all the funk-e programming, and modded the software beyond belief (word has it the creators call it once and didn't recognize it...And, of course, backdoors were removed very carefully)...At any rate, Scopio doesn't call it anymore, nor do I... And the guy who runs it now doesn't care much about it, and is foolish enough to let an idiot hacker borrow his account and run Crack from it...At any rate, that hacker guy got caught hacking into Nyx and some other places recently, Scorpio has more important things to do, as do I, thus the Kracker Box is not rreally supported by it's Originators (the 2 who labored over 2 5 1/4's and an Apple //e)... ahawks@nyx.cs.du.edu FutureCulture E-List: [future-request@nyx.cs.du.edu] andy (hawkeye)(dali) new edge, technoculture, cyberpunk, virtual reality, (freshjive) raves, etc. Home of the famous =) FutureCulture FAQ! -- more (98%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 25 of 133 Subject: Re: plug-plug-plug-plug From: fetus (Gregory Hempel) Date: Sat, 05 Dec 92 05:13:01 EST In-Reply-To: Well it seems that the Mondo had the number listed, I had the old one St.Jude didnt know. They feel really stupid and told them that they should have checked first, but thats in the past... Ok. I still really not up on the whole idea behind all of this. I really got in here cuase I like the mail, like reading and what not, Ive read about and had a couple friend who were the hacker types. Good at that. But never really got into the stuff my self. How ever I do collect magazines (Online) and what ever else for the sake of reading and collecting, all of which is available through my BBS. I was wondering, since I do get the INET.EFF.TALK & INET.EFF.NEWS if the FC's are placed there? Or If by some means I can get them sent to FIDO 1:130/603 ? If this is at all possible I would really like to get on that listing. Also am working on UFGATE at the moment and have it working rather well , BUT I still need a place to get them from local (Dallas/FtWorth) but am -- more (71%) -- having no real luck... Who knows... Any way, leaving the Cyberpunk behind, I figure I should get back to that. I just faxed a article to StJude @ Mondo and this should be in the Jan/Feb issue. Contains a listing of BBS's that I have called and found to be either unique in interest or just plain neat. Sooooo I was wondering if you can direct me to a BBS list (possibly) that would have some GOOD "alternative" BBS's. Appreciate any help! FeTuS [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 26 of 133 Subject: Re: plug-plug-plug-plug From: ahawks (Andy Hawks) Date: Sun, 06 Dec 92 11:50:50 EST In-Reply-To: FutureCulture is an on-line email list, not like a newsgroup (like comp.org.eff.talk)....To subscribe, send mail to future-request@nyx.cs.du.edu with the subject 'send info', and then decide which format you want to receive the list in. You can get a copy of the FAQ at any time by mailing to the same address with 'send faq'....But my homemade piece-o-crap listserver has been behaving very odd lately, so, let me know if you don't get what you requested.... BTW, that FAQ has a evergrowing pulsating list of BBSes.... ahawks@nyx.cs.du.edu FutureCulture E-List: [future-request@nyx.cs.du.edu] andy (hawkeye)(dali) new edge, technoculture, cyberpunk, virtual reality, (freshjive) raves, etc. Home of the famous =) FutureCulture FAQ! -- more (97%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 27 of 133 Subject: Re: plug-plug-plug-plug From: fetus (Gregory Hempel) Date: Mon, 07 Dec 92 01:54:31 EST ahawks (Andy Hawks) writes: > FutureCulture is an on-line email list, not like a newsgroup > (like comp.org.eff.talk)....To subscribe, send mail to > future-request@nyx.cs.du.edu with the subject 'send info', and then > decide which format you want to receive the list in. You can get a > copy of the FAQ at any time by mailing to the same address with > requested.... Oh, I know what it is, I have a couple of them. I was wondering if you can gate it or some how send it through a fido gate to my system? Thanks! Fetus [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 28 of 133 Subject: Re: plug-plug-plug-plug From: inhuman (inhuman inhuman) Date: Mon, 07 Dec 92 22:28:02 EST In-Reply-To: Is there someplace I can FTP Future Culture digests or something? I got a user on my BBS who claimed to have gotten the number from the Future Culture newsletter. I thought he had said it was related to the WELL, but I could be mistaken. I'm just curious to see in what context my board was mentioned. Are there any archives? [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 29 of 133 Subject: Re: plug-plug-plug-plug From: ahawks (Andy Hawks) Date: Tue, 08 Dec 92 18:20:53 EST In-Reply-To: I have no idea what the hell that meant, but, I think you want the FC FAQ...Mail to future-request@nyx.cs.du.edu with 'send faq' somewhere in there.... As far as gating FC to newsgroup/echo, *I* can't do that...I just run the list...It's up to individual sysadmins to do that, but, you certainly can receive it that way if you figure out how... ahawks@nyx.cs.du.edu FutureCulture E-List: [future-request@nyx.cs.du.edu] andy (hawkeye)(dali) new edge, technoculture, cyberpunk, virtual reality, (freshjive) raves, etc. Home of the famous =) FutureCulture FAQ! [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 30 of 133 Subject: Re: plug-plug-plug-plug From: reid (Ron Wilhelm) Date: Tue, 08 Dec 92 21:33:12 EST In-Reply-To: The ftp site for the alt.cyberpunk group is milton.u.washington.edu you can get the latest version of the alt.cyberpunk FAQ there. I think he has the Future Culture FAQ there too, but it's not the latest version. THe directory is /public/alt.cyberpunk. There's Virtual Reality stuff there, but I forget the directory. I think it's /public/virtual-worlds. reid [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 31 of 133 Subject: Cyberpunk & Futureculture From: deadboy (The Dead) Date: Wed, 09 Dec 92 10:43:30 EST In-Reply-To: <20THVB1w165w@mindvox.phantom.com> All that stuff is in the Archives already, both authors of the faqs are on Mindvox, the question I have is can we gate Futureculture into one of the Mindvox groups so that we can read it and reply to it as a system instead of all these people getting seperate copies of the same thing. I know at least 25 people here who get futureculture, inlucluding me and I read someone elses' copy of it. Just a htougth The Dead Shall Rise [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 32 of 133 Subject: Re: Cyberpunk & Futureculture From: ahawks (Andy Hawks) Date: Wed, 09 Dec 92 20:48:52 EST In-Reply-To: <8uuiVB5w165w@mindvox.phantom.com> Hhmmm, welp, honestly, I don't know how to go about doing that, but it's certainly ok by me.... However, you might want to aoid it for at least awhile since futcult in realtime mode has no filter - everything sent to the address gets sent out, which means "unsub me d00d" and mailer errors occasionally get sent there.... Another guy at my site is busy tring to install procmail, which would clean everything up and make the list a lot smoother, yet, I tried to install procmail before, but was unsusccessful....But, since then Nyx has changed to a Sun platform, and, who knows, it might work now.... We'll haveta wait and see, I guess... At any rate, most people who gate it to a newsgroup just subscribe in -- more (68%) -- realtime or digest with an alias like "future@mindvox.phatom.com" and everything sent to future@mindvox gets bounced to a forum (somehow, that's the part I don't know how to do).... ahawks@nyx.cs.du.edu FutureCulture E-List: [future-request@nyx.cs.du.edu] andy (hawkeye)(dali) new edge, technoculture, cyberpunk, virtual reality, (freshjive) raves, etc. Home of the famous =) FutureCulture FAQ! [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 33 of 133 Subject: Agrippa Sterling & Gibson From: deadboy (The Dead) Date: Sun, 13 Dec 92 18:43:12 EST In-Reply-To: <6VmJVB2w165w@mindvox.phantom.com> According to what went down in IRC a few minutes ago Bruce Sterling was talking to William Gibson today, who is aware that Agrippa was cracked and is online MindVox. The real copy is here, Sterling was sent a copy of it and called Kroupa today to relay Gibson's best wishes and say that this was a "planned progression" of his work. Mindvox has some kind of deal that it is allowed to keep agrippa online. Would somebody (Sterling, Kroupa, anyone?) please back this up or deny it! The Dead Shall Rise [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 34 of 133 Subject: Sterling/Cyberpunk bookks From: tomlin (James Tomlin) Date: Tue, 15 Dec 92 15:42:39 EST In-Reply-To: <6VmJVB2w165w@mindvox.phantom.com> Having read Sterling's Hacker Crackdown (Damn good read), my appetite for more cyberpunk/cyberspace books has increased. Anyone have and good suggestions? Thanks [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 35 of 133 Subject: Re: Sterling/Cyberpunk bookks From: jagged (Alexander Garrett) Date: Tue, 15 Dec 92 19:12:04 EST In-Reply-To: Now, is it just me, or did _Hacker_Crackdown_ seem like one of those "anthropologist investigates some primitive culture and relates the peculiarities of said culture to the happy-at-home public". A sort of objective eye/I tale. I'm not quite sure what Sterling was trying to say. If on one hand he was trying to present an objective and on all sides fair overview of the hacker/law/civil_libertarian viewpoint, he used some pretty loaded words/phrases that colored his communication and distorted what he was trying to say (IMHO). On the other hand, if he was trying to make a point somewhere along the line about truth, justice, || the american way, I missed it. And what was the bit with the street people again? That was kind of weird. Alex "I know Derrida, I've read Derrida and you're no Derrida" Garrett. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 36 of 133 Subject: Re: Sterling/Cyberpunk bookks From: cudigest (Jim Thomas) Date: Tue, 15 Dec 92 23:17:36 EST In-Reply-To: I'm not sure that Sterling is properly labeled as an "anthropologist" looking at a "primitive culture." He's one of the original cyberpunk sci-fi writers. He's written much on his own (eg, "Islands in the Net") and co-author The Difference Engine with Gibson. His purpose was simply to chronicle the events of the 90s, and he did a decent job. What, specifically, did you find objectionable? [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 37 of 133 Subject: Re: Sterling/Cyberpunk bookks From: jcrome (Johnny Monocrome) Date: Tue, 15 Dec 92 23:52:53 EST I thought it was a great book. sometimes it wandered and hiped and hoped here and there, but I like that in a book. Whatever the object of the book was (anthropohlogy or just social history...) it told the story of The Hacker Crackdown. The parts like the street person gave it flavor, a personal touch, so as not to be a textbbok study into whatever maybe. I personaly dislked the quotes in the middle of the pages. And iss it fone wire that is supposed to be surrunding the quotes.? sorry for spealing misktakes, too long w/ no sleep. Johnny Monocrome [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 38 of 133 Subject: gibson/sterling kroupa and agr1ppa From: deadboy (The Dead) Date: Wed, 16 Dec 92 00:58:13 EST In-Reply-To: There isn't that big a reading list I can think of offhand, I had a bigger when when the system went suddenly down and then back up but reading through the _editor.save file, it was a bad reply, so I'm better off not reposting it. Cyberpunk by Markoff and his ex-wife is one that comes up frequently. something else that I'm more then a little po'ed about, I'm talking about "Agr1ppa" and I'd like to get the real story and if in fact its being pulled. From IRC last night I get : AGR1PPA 2.01 - NEW & IMPROVED (Fixes Bugs from Version 2.00) (A Book of The Mentally Disturbed -- Even FUNNIER than the original!) Text by US@phantom.com Etching by THOSE_PEOPLE@phantom.com (C)1992 THE POWER COMPUTER (In My Mind Since 1979) -- more (44%) -- syberspa(e All Bytes Preserved And then tonight God came down from the mountain and spoke to Kroupa. William Gibson called him on the phone to talk to him. And Kroupa pulled it out of "respect for Gibson's work" which I think is a crock. It's a joke, if Gibson can't take a joke, then why bother............ I am totally angry at this, it is extremely cool that William Gibson is into all this and behind Mindvox, its almost like the God of cyberpunk smiling on it all, but I think its a total crock that something which is obviously a joke can get pulled because Gibson might frown and get upset. My unasked for .02 cents. 1) Since email takes about 4 weeks to get back, why are the actual participants never in IRC and always "people who just talked to them" 2) if this is true, why? Why pull something, thats almost censorship. If -- more (82%) -- gibson said "I dont like this about phantom access and I won't put you guys into a story if you don't change it" would you? Maybe I'm being a jerk and putting my foot into the middle of something that isn't mine to do, but I am totally furious that Gibson can snap his fingers and make this type of shit happen! The Dead Shall Rise [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 39 of 133 Subject: Re: Sterling/Cyberpunk bookks From: jagged (Alexander Garrett) Date: Wed, 16 Dec 92 16:58:20 EST In-Reply-To: <2RXuVB1w165w@mindvox.phantom.com> Well, I didn't find anything particularily /objectionable/. I couldn't tell whether he was trying to make a point or merely provide an objective history (if there is any such animal) of the events which occurred. If the former, I have no idea what point he was trying to make. Cops good, hackers bad? Hackers good, cops bad? Hackers misunderstood, cops misunderstood, civil libertarians ready to take a stand on anything? And like I said, the street person part seemed out of place. For a brief moment, it seemed like he was going to tie it all together and then missed the boat. If the latter (objective history), then he seemed to be using loaded statements fairly often. This may be due to his background in writing very intense and dramatic literature. Perhaps he can't seperate himself emotionally from the events he's portraying. At times, though, he seemed to alternately ridicule, and laud. I just had a difficult time trying to figure out where he was coming from. -- more (88%) -- As far as the information content goes, I thought it was a marvelous book. To quote the eminent Lex Luthor, "I learned a lot." :-) Alex [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 40 of 133 Subject: Re: Sterling/Cyberpunk bookks From: alibaba (Nick Mordanzo) Date: Thu, 17 Dec 92 15:54:29 EST jagged (Alexander Garrett) writes: > > As far as the information content goes, I thought it was a marvelous > book. To quote the eminent Lex Luthor, "I learned a lot." :-) > To quote the emminent Lex Luthor from this system "They took my quote out of context. What can I expect, sigh." What/where huh? Agr1ppa? $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 41 of 133 Subject: Re: Sterling/Cyberpunk bookks From: brendan (Brendan Kehoe) Date: Thu, 17 Dec 92 18:30:51 EST tomlin (James Tomlin) writes: > Having read Sterling's Hacker Crackdown (Damn good read), my appetite > for more cyberpunk/cyberspace books has increased. Anyone have and good > suggestions? "Hackers" by Steven Levy, "The Cuckoo's Egg" by Cliff Stoll, and "Cyberpunks" by Katie Hafner and John Markoff. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 42 of 133 Subject: Re: Sterling/Cyberpunk bookks From: ahawks (Andy Hawks) Date: Thu, 17 Dec 92 21:18:12 EST In-Reply-To: <5T0XVB1w165w@mindvox.phantom.com> Or get the mong0id futureculture faq....Lists lots of real cp-sf, slipstream, computer stuff (off-hand Brendan missed COmputers Under Attack, ed. by Peter J. Denning), lots of other books.... and lots of other stuff....send to future-request@nyx.cs.du.edu w/ sub 'send faq'.... Hey, I just heard about this thing called Agrippa...looks like Gibson's new book....Anyone know where I can get a copy? ahawks@nyx.cs.du.edu FutureCulture E-List: [future-request@nyx.cs.du.edu] andy (hawkeye)(dali) new edge, technoculture, cyberpunk, virtual reality, (freshjive) raves, etc. Home of the famous =) FutureCulture FAQ! [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 43 of 133 Subject: Re: Sterling/Cyberpunk bookks From: deadboy (The Dead) Date: Fri, 18 Dec 92 02:11:19 EST ahawks (Andy Hawks) writes: > Hey, I just heard about this thing called Agrippa...looks like Gibson's > new book....Anyone know where I can get a copy? > That was subtle :) You're not.....BEING SARCASTIC r u? The Dead Shall Rise [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 44 of 133 Subject: Re: Sterling/Cyberpunk bookks From: simonm (Simon Moon) Date: Fri, 18 Dec 92 11:42:14 EST In-Reply-To: ahawks (Andy Hawks) writes: > Hey, I just heard about this thing called Agrippa...looks like Gibson's > new book....Anyone know where I can get a copy? deadboy (The Dead): writes: > That was subtle :) You're not.....BEING SARCASTIC r u? Well, at least you caught the sarcasm this time. Very good, you're improving. - Simon [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 45 of 133 Subject: Re: Sterling/Cyberpunk bookks From: chemist (The Chemist) Date: Fri, 18 Dec 92 17:48:08 EST simonm (Simon Moon) writes: > ahawks (Andy Hawks) writes: > > > Hey, I just heard about this thing called Agrippa...looks like Gibson's > > new book....Anyone know where I can get a copy? > > deadboy (The Dead): writes: > > > That was subtle :) You're not.....BEING SARCASTIC r u? > > Well, at least you caught the sarcasm this time. Very good, you're improving. > Simon, had too much coffee today dude? Three messages on three boards so far I've read and every one of yours is bitchy and sarcastic. Not that I'm against bitchy and sarcastic, but .........ever consider therapy or members of the opposite sex or even the same sex? -- more (77%) -- Reading his message he asked what "Agr1ppa" is, over which there was some question on mailing lists in the near past because Patrick wrote something called that, which was supposed to be a parody of Agrippa. RTFM -tC [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 46 of 133 Subject: Re: Sterling/Cyberpunk bookks From: hotblack (Dana Watanabe) Date: Fri, 18 Dec 92 21:36:16 EST In-Reply-To: not that this matters or belongs anywhere but someone brought up the fact that i pay for this system so why not waste the resources... but i would like to say that the comment that 3jane made was perfectly plausible post had not 3jane made itr so why dont yall back off DeadBoy posts interestinbg stuff usu and its a bit better than i could do cuz i just post stuff and so what if something gtets bitten cuz of a bitchy post then life is like a rotting worm flying through the sky eating up all the little piggies that suck out the blood of tomatoes like bunnicula and man if god could make the moon then why cant he jump out of airplanes just cuz he wants to or wear dr schols sandalls and have green wings and mom and dad went to a show and dropped me off at grandma joes and -- more (82%) -- after dinner we had i ce cream and i fell asleep and watched tv and i woke up in my mothers arms and its been too long since i heard this song but i like to sing along and i like to shoot my gun [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 47 of 133 Subject: SJG From: belgo (Chris Shepherd) Date: Sat, 19 Dec 92 15:46:46 EST This might be of interest to you who wanna order "Hacker" for the holidays.. Steve Jackson Games's Phone Number is: 512-447-7866 ... I spent all day hunting for it so I could call them. Hope it does someone else some good as well. :) - Belgo [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 48 of 133 Subject: Re: SJG From: chrmsync (Chrome Sync) Date: Sun, 20 Dec 92 00:07:00 EST In-Reply-To: Hunting all day ??? Geez, I've known the number for years ... don't hunt .. ask me. If you don't have access to their BBS (not InterNet accessible!) or it's too excessive, just ask me (I call often enough, and keep *reaonably* up-to-date) ... GRUPS Geek, etc. ... [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 49 of 133 Subject: Article in Texas Monthly From: falconer (Steve Copold) Date: Sun, 20 Dec 92 01:29:57 EST (cross-posted from Convergence) I urge you all to run down to the local newstand and pick up the Jan.93 issue of Texas Monthly magazine. There is a lengthy article in it titled _The Clash of the Cyberpunks_ by Gary Cartwright. The entire piece focuses on the feud between Mark Abene (Phiber Optik) and Chris Goggans (Erik Bloodaxe). I cannot comment on its accuracy, but it is a superb read and seems to be fundamentally unbiased in its commentary. Included with the text is a quarter-page portrait of Mark Abene, and a full-page, color toned professional portrait of Chris Goggans. The story is literate, well organized, very detailed, and very long. Cartwright did a review of _The Hacker Crackdown_ last month and had less than a page. This story covers 6 to 7 pages of text in fairly fine print. I am genuinely anxious to hear comments from the folks actually involved in this episode...Particularly in reference to the article's accuracy. A great deal of the history of LOD and MOD is covered from the perspectives -- more (84%) -- of both groups. After the Geraldo Show and the crap that Forbes published under the guise of journalism, this article provided a much needed breath of fresh air. Read it soon! -Falconer [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 50 of 133 Subject: Re: Article in Texas Monthly From: alibaba (Nick Mordanzo) Date: Sun, 20 Dec 92 03:19:00 EST In-Reply-To: Falconer, don't take this the wrong way, I worship you in writing and all but why did you post that one article in 3 places into my newscan already! I know the boards are dis-organized and changing around an all, but I have this feeling that before my quickscan ends I'm going to see it at least 3 more times :) $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 51 of 133 Subject: Re: Article in Texas Monthly From: falconer (Steve Copold) Date: Sun, 20 Dec 92 10:53:11 EST In-Reply-To: No offense taken, and there is a reason for cross-posting the message. It's really very simple...Vox is getting pretty big. I certainly could be wrong, but I don't believe that everyone is joined to all the forums anymore. In my own case, the reading became such an immense task that I dropped all the music forums. I assume, and it is only an assumption, that other folks on Vox are doing the same thing. I don't want to turn it into Usenet, but cross-posting the notice about the article seemed to be a sensible thing to do. The piece needed to be in Convergence as I certainly hope that most subscribers to Vox read that forum. It also felt very appropriate to cross-p it to Cyberpunk, Hacking, and Miscellaneous Publications as those were at the heart of the story. As I really have no way of knowing who reads what anymore, it was the only way to know for sure that all interested parties would see it. Nick, I don't do it often, but I feel that article merits a read by everyone on Vox. It could be pure bullshit. But if it is, it's some of the -- more (71%) -- best written bullshit I've ever read...I know that Mark is not on the system anymore, but Chris Goggans is and I'd really like to hear what he has to say about the story. I've been reading Gary Cartwright's work for quite awhile and he's always seemed very credible...but after the Forbe's trash, I'd like to hear it from someone that actually knows the truth. It's like Ripley says, "I say we go to the Sulaco and nuke the site from orbit. It's the only way to be sure." -Falconer [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 52 of 133 Subject: Re: Article in Texas Monthly From: bwp (Jane Doe) Date: Sun, 20 Dec 92 15:19:05 EST falconer (Steve Copold) writes: > anymore. In my own case, the reading became such an immense task that I Yo, falc, d00d, get Hooked on Phonics, and the USE it. And quit moving your lips when you read, that alone will add 50 wpm... -3j [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 53 of 133 Subject: Re: Article in Texas Monthly From: falconer (Steve Copold) Date: Sun, 20 Dec 92 16:45:49 EST bwp (Jane Doe) writes: > Yo, falc, d00d, get Hooked on Phonics, and the USE it. And quit moving > your lips when you read, that alone will add 50 wpm... Okay Jane, but I want no complaints from you about going too fast when I read to you. Until you learn to do it for yourself (I know you can do SOME things for yourself...Unfortunately, reading not being one of them), I thought it would be a good idea to keep it slow. I wouldn't want to exceed your maximum rate of comprehension...Which we both know is below 50 wpm. -Falconer [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 54 of 133 Subject: Hooked on phonics From: ahawks (Andy Hawks) Date: Sun, 20 Dec 92 18:46:35 EST In-Reply-To: <3yo4VB1w165w@mindvox.phantom.com> Is it just me or does anyone else find it sincerely ironic that the phone number for hooked on phonics is 1.800.ABCDEFG..... Sounds like a prank....I'd call 'em, but I don't speak English, and I can't read....Guess I'l haveta go on being illiterate for the rest of my life.... ObCP: My FutureCulture FAQ is being released again in a couple weeks... More info follows.... tomorrow and tomorrow and tomorrow.... ahawks@nyx.cs.du.edu FutureCulture E-List: [future-request@nyx.cs.du.edu] andy (hawkeye)(dali) new edge, technoculture, cyberpunk, virtual reality, (freshjive) raves, etc. Home of the famous =) FutureCulture FAQ! -- more (97%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 55 of 133 Subject: Re: Hooked on phonics From: inhuman (Inhuman) Date: Sun, 20 Dec 92 19:00:31 EST In-Reply-To: Where can I pick up a copy of Texas Monthly? Anywhere besides the big Lone Star? Also, thank you for cross posting it, because I only read it once in my newscan, so I might have missed it otherwise. --- Inhuman (inhuman@mindvox.phantom.com) "The truth? The truth, Lazarus, is perhaps something so unbearable, so terrible, something so deadly, that simple people could not live with it!" -Miguel de Unamuno, _Saint Emmanuel the Good, Martyr_ [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 56 of 133 Subject: Re: Hooked on phonics From: kieran (Aaron Dickey) Date: Mon, 21 Dec 92 00:32:22 EST ahawks (Andy Hawks) writes: > Is it just me or does anyone else find it sincerely ironic that the > phone number for hooked on phonics is 1.800.ABCDEFG..... I don't find it ironic...literacy education in this country is a joke. About ten years ago, my father decided to join a program to help teach others to read. After spending about two months taking "How-to-teach" courses and "graduating", he was given the name of his first pupil. How should he contact this guy? "Write him a letter." [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 57 of 133 Subject: Re: Hooked on phonics From: dexter (M. Lawrence Lopp) Date: Mon, 21 Dec 92 14:23:17 EST inhuman (Inhuman) writes: > Where can I pick up a copy of Texas Monthly? Anywhere besides > the big Lone Star? Also, thank you for cross posting it, because I only > read it once in my newscan, so I might have missed it otherwise. > Just called Waldenbooks here on the West Coast - Bay Area. Seems they do have Texas Monthly which gives me the impression that any decent newsstand/bookStore should have it. Comments forthcoming. dex. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 58 of 133 Subject: Lone Star Monthly From: pyrus (Pyrus) Date: Wed, 23 Dec 92 17:29:03 EST In-Reply-To: The "Clash of the Cyberpunks" article is a good one.. recommened to anyone who wants to be informed/enjoy some good reading. To those who are in the middle of nowhere (isn't Texas Monthly read everywhere, though?) I hate to say that I will photocopy the article for you (it being copyrighted and all), but I will mail you the Jan'93 or whatever.. leave me email here. pyrus (deep in the heart of texas) [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 59 of 133 Subject: Text Barrage! From: bruces (Bruce Sterling) Date: Sun, 27 Dec 92 01:53:12 EST In-Reply-To: <5ya0VB5w165w@mindvox.phantom.com> Bruce Sterling bruces@well.sf.ca.us Literary Freeware --- Not For Commercial Use Bruce Sterling's Idea of What Every Well-Appointed "Cyberpunk SF" Library Collection Should Possess (circa Dec 92) The Canon: BURNING CHROME William Gibson Gibson's short stories. NEUROMANCER, COUNT ZERO, MONA LISA OVERDRIVE William Gibson The "Cyberspace Trilogy." MIRRORSHADES THE CYBERPUNK ANTHOLOGY Bruce Sterling ed. Useful pointer to actual no-kidding Movement Cyberpunks. -- more (17%) -- MINDPLAYERS Pat Cadigan Her best novel. An absolute must-have. HEATSEEKER John Shirley Shirley's short-stories. His most significant and influential work. DESERTED CITIES OF THE HEART Lewis Shiner Shiner's best SF novel. SLAM Lewis Shiner Intriguing cyberpunk mainstream non-genre novel. SOFTWARE and WETWARE Rudy Rucker Best-known novels of deranged math-professor/hacker/cyberpunk. TRANSREAL Rudy Rucker Every short piece Rucker ever wrote. Enormous. Like being hit in the head with a bowling ball. BLOOD MUSIC Greg Bear Bear's most c-wordish book. CRYSTAL EXPRESS Bruce Sterling Sterling's short work. SCHISMATRIX Bruce Sterling Posthuman space opera. ISLANDS IN THE NET Bruce Sterling 21st-century global information politics. THE DIFFERENCE ENGINE William Gibson and Bruce Sterling -- more (36%) -- 19th-century cyberpunk by subgenre's foremost critics'-darlings. Other Useful Fiction: HALO Tom Maddox Remarkable SF treatment of robots and artificial intelligence. GLOBALHEAD Bruce Sterling Sterling's second story collection. PATTERNS Pat Cadigan Cadigan's short work. Great range of topics and treatments. SYNNERS Pat Cadigan Cadigan's well-received second novel. FRONTERA Lewis Shiner Shiner's first novel, about mission to Mars. LOOK INTO THE SUN James Patrick Kelly Interesting novel by peripheral cyberpunk. ARACHNE Lisa Mason Cyberspace robots vs drug-addict San Francisco lawyer-careerists. Weirdissimo. SNOW CRASH Neal Stephenson Fine example of second-generation cyberpunk by Seattle hacker. HARDWIRED Walter Jon Williams -- more (54%) -- Williams' most successful effort. SPACETIME DONUTS, WHITE LIGHT Rudy Rucker Rucker's early novels. Brilliantly deranged. INVOLUTION OCEAN, THE ARTIFICIAL KID Bruce Sterling Sterling's first two novels. SF adventures. SEMIOTEXT(E) SF Rudy Rucker, Peter Lamborn Wilson, Robert Anton Wilson, eds. Story anthology of bad craziness. Quite likely to cause protests from scandalized parents and censors. Magazines MONDO 2000. "Cyberpunk" as glossy West Coast fashion magazine. It Had To Happen. bOING bOING Ultra-happening cyberslacker antizine from the heart of digitized desktop bohemia. ISAAC ASIMOV'S SCIENCE FICTION MAGAZINE. Least reactionary of the standard American SF magazines. INTERZONE Foremost British SF magazine. Libraries should carry this worthy zine as a public service, since individual US subscriptions are costly. -- more (75%) -- SCIENCE FICTION EYE More-or-less official lit-crit organ of cyberpunk SF and assorted fellow-travellers. Like most fanzines, sadly sporadic. SCIENCE FICTION STUDIES Dull gray academic rag seized in startling coup by wacky post-modernists. Now almost readable! Non-Fiction, Critical Studies STORMING THE REALITY STUDIO Larry McCaffery ed. Cyberpunk's man-in-academe gives his highly postmodern take on matters in this bug-crusher anthology. CYBERPUNK: OUTLAWS AND HACKERS ON THE COMPUTER FRONTIER by Katie Hafner and John Markoff. The best book to date on the outlaw "computer underground." ACROSS THE WOUNDED GALAXIES Larry McCaffery ed. McCaffery interviews various weirdo leading-lights of pomo SF, including Gibson and Sterling. THE HACKER CRACKDOWN, LAW AND DISORDER ON THE ELECTRONIC FRONTIER by Bruce Sterling. It's not just for breakfast any more. -- more (96%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 60 of 133 Subject: Re: Text Barrage! From: bruces (Bruce Sterling) Date: Sun, 27 Dec 92 01:56:54 EST In-Reply-To: Science Fiction Research Association June 1992 Bruce Sterling (bruces@well.sf.ca.us) WHOLE EARTH REVIEW P. O Box 38 Sausalito, CA 94966-9932 $20/yr; four issues MONDO 2000 P O Box 10171 Berkeley, CA 94709-5171 $24 five issues more or less quarterly bOING bOING (World's Greatest Neurozine) 11288 Ventura Blvd #818 Studio City CA 91604 -- more (31%) -- $14/ 4 issues kind of quarterly SCIENCE FICTION EYE P O Box 18539 Asheville, NC 28814 $10 three issues; two a year, more or less ISAAC ASIMOV'S SCIENCE FICTION MAGAZINE P O Box 7058 Red Oak, IA 51591-2058 $34.95 thirteen issues a year THE MAGAZINE OF FANTASY AND SCIENCE FICTION P O Box 56 Cornwall, CT 06753 $26 twelve issues a year SCIENCE FICTION STUDIES SF-TH Inc. Arthur B. Evans East College DePauw University -- more (54%) -- Greencastle, IN 46135-0037 $14 three issues/yr Mark Ziesing Books PO Box 76 Shingletown, CA 96088 $1/ catalog Whole Earth 'Lectronic Link (WELL) 27 Gate Five Rd Sausalito CA 94966 $15/mo; $2/hr (415) 332-4335 ELECTRONIC FRONTIER FOUNDATION 155 Second Street Cambridge MA 02141 EFFector 4 times/ yr eff@eff.org $20/yr students, $40/ yr others -- more (73%) -- FUTURE CULTURE FAQ ahawks@isis.cs.du.edu Computers and Academic Freedom listserv@eff.org Computer Underground Digest tk0jut2@niu.bitnet Phrack phracksub@stormking.com RISKS Digest risks-request@csl.sri.com Media Magic PO Box 507 Nicasio, CA 94946 415.662.2426 computer graphics/ chaos/ scientific visualization/ cyberspace/ virtual reality -- more (94%) -- free catalog [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 61 of 133 Subject: Re: Text Barrage! From: bruces (Bruce Sterling) Date: Sun, 27 Dec 92 01:59:25 EST In-Reply-To: Bruce Sterling bruces@well.sf.ca.us Literary Freeware -- Not for Commercial Use From THE MAGAZINE OF FANTASY AND SCIENCE FICTION, Feb 1993. F&SF, Box 56, Cornwall CT 06753 $26/yr USA $31/yr other F&SF Science Column #5 INTERNET Some thirty years ago, the RAND Corporation, America's foremost Cold War think-tank, faced a strange strategic problem. How could the US authorities successfully communicate after a nuclear war? Postnuclear America would need a command-and-control network, linked from city to city, state to state, base to base. But no -- more (3%) -- matter how thoroughly that network was armored or protected, its switches and wiring would always be vulnerable to the impact of atomic bombs. A nuclear attack would reduce any conceivable network to tatters. And how would the network itself be commanded and controlled? Any central authority, any network central citadel, would be an obvious and immediate target for an enemy missile. The center of the network would be the very first place to go. RAND mulled over this grim puzzle in deep military secrecy, and arrived at a daring solution. The RAND proposal (the brainchild of RAND staffer Paul Baran) was made public in 1964. In the first place, the network would *have no central authority.* Furthermore, it would be *designed from the beginning to operate while in tatters.* The principles were simple. The network itself would be assumed to be unreliable at all times. It would be designed from the get-go to transcend its own unreliability. All the nodes in the network would be equal in status to all other nodes, each node with its own authority to originate, pass, and receive messages. The messages themselves would be divided into packets, each packet separately addressed. Each packet would begin at some specified source node, and end at some other specified destination node. Each -- more (9%) -- packet would wind its way through the network on an individual basis. The particular route that the packet took would be unimportant. Only final results would count. Basically, the packet would be tossed like a hot potato from node to node to node, more or less in the direction of its destination, until it ended up in the proper place. If big pieces of the network had been blown away, that simply wouldn't matter; the packets would still stay airborne, lateralled wildly across the field by whatever nodes happened to survive. This rather haphazard delivery system might be "inefficient" in the usual sense (especially compared to, say, the telephone system) -- but it would be extremely rugged. During the 60s, this intriguing concept of a decentralized, blastproof, packet-switching network was kicked around by RAND, MIT and UCLA. The National Physical Laboratory in Great Britain set up the first test network on these principles in 1968. Shortly afterward, the Pentagon's Advanced Research Projects Agency decided to fund a larger, more ambitious project in the USA. The nodes of the network were to be high-speed supercomputers (or what passed for supercomputers at the time). These were rare and valuable machines which were in real need of good solid networking, for the sake of national research-and-development projects. -- more (15%) -- In fall 1969, the first such node was installed in UCLA. By December 1969, there were four nodes on the infant network, which was named ARPANET, after its Pentagon sponsor. The four computers could transfer data on dedicated high- speed transmission lines. They could even be programmed remotely from the other nodes. Thanks to ARPANET, scientists and researchers could share one another's computer facilities by long-distance. This was a very handy service, for computer-time was precious in the early '70s. In 1971 there were fifteen nodes in ARPANET; by 1972, thirty-seven nodes. And it was good. By the second year of operation, however, an odd fact became clear. ARPANET's users had warped the computer-sharing network into a dedicated, high-speed, federally subsidized electronic post- office. The main traffic on ARPANET was not long-distance computing. Instead, it was news and personal messages. Researchers were using ARPANET to collaborate on projects, to trade notes on work, and eventually, to downright gossip and schmooze. People had their own personal user accounts on the ARPANET computers, and their own personal addresses for electronic mail. Not only were they using ARPANET for person-to-person communication, but they were very enthusiastic about this particular service -- far more enthusiastic than they were about long-distance computation. -- more (21%) -- It wasn't long before the invention of the mailing-list, an ARPANET broadcasting technique in which an identical message could be sent automatically to large numbers of network subscribers. Interestingly, one of the first really big mailing-lists was "SF- LOVERS," for science fiction fans. Discussing science fiction on the network was not work-related and was frowned upon by many ARPANET computer administrators, but this didn't stop it from happening. Throughout the '70s, ARPA's network grew. Its decentralized structure made expansion easy. Unlike standard corporate computer networks, the ARPA network could accommodate many different kinds of machine. As long as individual machines could speak the packet-switching lingua franca of the new, anarchic network, their brand-names, and their content, and even their ownership, were irrelevant. The ARPA's original standard for communication was known as NCP, "Network Control Protocol," but as time passed and the technique advanced, NCP was superceded by a higher-level, more sophisticated standard known as TCP/IP. TCP, or "Transmission Control Protocol," converts messages into streams of packets at the source, then reassembles them back into messages at the destination. IP, or "Internet Protocol," handles the addressing, seeing to it that packets -- more (27%) -- are routed across multiple nodes and even across multiple networks with multiple standards -- not only ARPA's pioneering NCP standard, but others like Ethernet, FDDI, and X.25. As early as 1977, TCP/IP was being used by other networks to link to ARPANET. ARPANET itself remained fairly tightly controlled, at least until 1983, when its military segment broke off and became MILNET. But TCP/IP linked them all. And ARPANET itself, though it was growing, became a smaller and smaller neighborhood amid the vastly growing galaxy of other linked machines. As the '70s and '80s advanced, many very different social groups found themselves in possession of powerful computers. It was fairly easy to link these computers to the growing network-of- networks. As the use of TCP/IP became more common, entire other networks fell into the digital embrace of the Internet, and messily adhered. Since the software called TCP/IP was public-domain, and the basic technology was decentralized and rather anarchic by its very nature, it was difficult to stop people from barging in and linking up somewhere-or-other. In point of fact, nobody *wanted* to stop them from joining this branching complex of networks, which came to be known as the "Internet." Connecting to the Internet cost the taxpayer little or nothing, since each node was independent, and had to handle its own financing -- more (34%) -- and its own technical requirements. The more, the merrier. Like the phone network, the computer network became steadily more valuable as it embraced larger and larger territories of people and resources. A fax machine is only valuable if *everybody else* has a fax machine. Until they do, a fax machine is just a curiosity. ARPANET, too, was a curiosity for a while. Then computer-networking became an utter necessity. In 1984 the National Science Foundation got into the act, through its Office of Advanced Scientific Computing. The new NSFNET set a blistering pace for technical advancement, linking newer, faster, shinier supercomputers, through thicker, faster links, upgraded and expanded, again and again, in 1986, 1988, 1990. And other government agencies leapt in: NASA, the National Institutes of Health, the Department of Energy, each of them maintaining a digital satrapy in the Internet confederation. The nodes in this growing network-of-networks were divvied up into basic varieties. Foreign computers, and a few American ones, chose to be denoted by their geographical locations. The others were grouped by the six basic Internet "domains": gov, mil, edu, com, org and net. (Graceless abbreviations such as this are a standard feature of the TCP/IP protocols.) Gov, Mil, and Edu denoted governmental, military and educational institutions, which were, of -- more (40%) -- course, the pioneers, since ARPANET had begun as a high-tech research exercise in national security. Com, however, stood for "commercial" institutions, which were soon bursting into the network like rodeo bulls, surrounded by a dust-cloud of eager nonprofit "orgs." (The "net" computers served as gateways between networks.) ARPANET itself formally expired in 1989, a happy victim of its own overwhelming success. Its users scarcely noticed, for ARPANET's functions not only continued but steadily improved. The use of TCP/IP standards for computer networking is now global. In 1971, a mere twenty-one years ago, there were only four nodes in the ARPANET network. Today there are tens of thousands of nodes in the Internet, scattered over forty-two countries, with more coming on-line every day. Three million, possibly four million people use this gigantic mother-of-all-computer-networks. The Internet is especially popular among scientists, and is probably the most important scientific instrument of the late twentieth century. The powerful, sophisticated access that it provides to specialized data and personal communication has sped up the pace of scientific research enormously. The Internet's pace of growth in the early 1990s is spectacular, almost ferocious. It is spreading faster than cellular phones, faster -- more (46%) -- than fax machines. Last year the Internet was growing at a rate of twenty percent a *month.* The number of "host" machines with direct connection to TCP/IP has been doubling every year since 1988. The Internet is moving out of its original base in military and research institutions, into elementary and high schools, as well as into public libraries and the commercial sector. Why do people want to be "on the Internet?" One of the main reasons is simple freedom. The Internet is a rare example of a true, modern, functional anarchy. There is no "Internet Inc." There are no official censors, no bosses, no board of directors, no stockholders. In principle, any node can speak as a peer to any other node, as long as it obeys the rules of the TCP/IP protocols, which are strictly technical, not social or political. (There has been some struggle over commercial use of the Internet, but that situation is changing as businesses supply their own links). The Internet is also a bargain. The Internet as a whole, unlike the phone system, doesn't charge for long-distance service. And unlike most commercial computer networks, it doesn't charge for access time, either. In fact the "Internet" itself, which doesn't even officially exist as an entity, never "charges" for anything. Each group of people accessing the Internet is responsible for their own machine and their own section of line. -- more (52%) -- The Internet's "anarchy" may seem strange or even unnatural, but it makes a certain deep and basic sense. It's rather like the "anarchy" of the English language. Nobody rents English, and nobody owns English. As an English-speaking person, it's up to you to learn how to speak English properly and make whatever use you please of it (though the government provides certain subsidies to help you learn to read and write a bit). Otherwise, everybody just sort of pitches in, and somehow the thing evolves on its own, and somehow turns out workable. And interesting. Fascinating, even. Though a lot of people earn their living from using and exploiting and teaching English, "English" as an institution is public property, a public good. Much the same goes for the Internet. Would English be improved if the "The English Language, Inc." had a board of directors and a chief executive officer, or a President and a Congress? There'd probably be a lot fewer new words in English, and a lot fewer new ideas. People on the Internet feel much the same way about their own institution. It's an institution that resists institutionalization. The Internet belongs to everyone and no one. Still, its various interest groups all have a claim. Business people want the Internet put on a sounder financial footing. Government people want the Internet more fully regulated. -- more (59%) -- Academics want it dedicated exclusively to scholarly research. Military people want it spy-proof and secure. And so on and so on. All these sources of conflict remain in a stumbling balance today, and the Internet, so far, remains in a thrivingly anarchical condition. Once upon a time, the NSFnet's high-speed, high-capacity lines were known as the "Internet Backbone," and their owners could rather lord it over the rest of the Internet; but today there are "backbones" in Canada, Japan, and Europe, and even privately owned commercial Internet backbones specially created for carrying business traffic. Today, even privately owned desktop computers can become Internet nodes. You can carry one under your arm. Soon, perhaps, on your wrist. But what does one *do* with the Internet? Four things, basically: mail, discussion groups, long-distance computing, and file transfers. Internet mail is "e-mail," electronic mail, faster by several orders of magnitude than the US Mail, which is scornfully known by Internet regulars as "snailmail." Internet mail is somewhat like fax. It's electronic text. But you don't have to pay for it (at least not directly), and it's global in scope. E-mail can also send software and certain forms of compressed digital imagery. New forms of mail are in the works. -- more (65%) -- The discussion groups, or "newsgroups," are a world of their own. This world of news, debate and argument is generally known as "USENET. " USENET is, in point of fact, quite different from the Internet. USENET is rather like an enormous billowing crowd of gossipy, news-hungry people, wandering in and through the Internet on their way to various private backyard barbecues. USENET is not so much a physical network as a set of social conventions. In any case, at the moment there are some 2,500 separate newsgroups on USENET, and their discussions generate about 7 million words of typed commentary every single day. Naturally there is a vast amount of talk about computers on USENET, but the variety of subjects discussed is enormous, and it's growing larger all the time. USENET also distributes various free electronic journals and publications. Both netnews and e-mail are very widely available, even outside the high-speed core of the Internet itself. News and e-mail are easily available over common phone-lines, from Internet fringe- realms like BITnet, UUCP and Fidonet. The last two Internet services, long-distance computing and file transfer, require what is known as "direct Internet access" -- using TCP/IP. Long-distance computing was an original inspiration for ARPANET and is still a very useful service, at least for some. -- more (71%) -- Programmers can maintain accounts on distant, powerful computers, run programs there or write their own. Scientists can make use of powerful supercomputers a continent away. Libraries offer their electronic card catalogs for free search. Enormous CD-ROM catalogs are increasingly available through this service. And there are fantastic amounts of free software available. File transfers allow Internet users to access remote machines and retrieve programs or text. Many Internet computers -- some two thousand of them, so far -- allow any person to access them anonymously, and to simply copy their public files, free of charge. This is no small deal, since entire books can be transferred through direct Internet access in a matter of minutes. Today, in 1992, there are over a million such public files available to anyone who asks for them (and many more millions of files are available to people with accounts). Internet file-transfers are becoming a new form of publishing, in which the reader simply electronically copies the work on demand, in any quantity he or she wants, for free. New Internet programs, such as "archie," "gopher," and "WAIS," have been developed to catalog and explore these enormous archives of material. The headless, anarchic, million-limbed Internet is spreading like bread-mold. Any computer of sufficient power is a potential spore -- more (77%) -- for the Internet, and today such computers sell for less than $2,000 and are in the hands of people all over the world. ARPA's network, designed to assure control of a ravaged society after a nuclear holocaust, has been superceded by its mutant child the Internet, which is thoroughly out of control, and spreading exponentially through the post-Cold War electronic global village. The spread of the Internet in the 90s resembles the spread of personal computing in the 1970s, though it is even faster and perhaps more important. More important, perhaps, because it may give those personal computers a means of cheap, easy storage and access that is truly planetary in scale. The future of the Internet bids fair to be bigger and exponentially faster. Commercialization of the Internet is a very hot topic today, with every manner of wild new commercial information- service promised. The federal government, pleased with an unsought success, is also still very much in the act. NREN, the National Research and Education Network, was approved by the US Congress in fall 1991, as a five-year, $2 billion project to upgrade the Internet "backbone." NREN will be some fifty times faster than the fastest network available today, allowing the electronic transfer of the entire Encyclopedia Britannica in one hot second. Computer networks worldwide will feature 3-D animated graphics, radio and cellular -- more (84%) -- phone-links to portable computers, as well as fax, voice, and high- definition television. A multimedia global circus! Or so it's hoped -- and planned. The real Internet of the future may bear very little resemblance to today's plans. Planning has never seemed to have much to do with the seething, fungal development of the Internet. After all, today's Internet bears little resemblance to those original grim plans for RAND's post- holocaust command grid. It's a fine and happy irony. How does one get access to the Internet? Well -- if you don't have a computer and a modem, get one. Your computer can act as a terminal, and you can use an ordinary telephone line to connect to an Internet-linked machine. These slower and simpler adjuncts to the Internet can provide you with the netnews discussion groups and your own e-mail address. These are services worth having -- though if you only have mail and news, you're not actually "on the Internet" proper. If you're on a campus, your university may have direct "dedicated access" to high-speed Internet TCP/IP lines. Apply for an Internet account on a dedicated campus machine, and you may be able to get those hot-dog long-distance computing and file-transfer functions. Some cities, such as Cleveland, supply "freenet" community access. Businesses increasingly have Internet access, and -- more (90%) -- are willing to sell it to subscribers. The standard fee is about $40 a month -- about the same as TV cable service. As the Nineties proceed, finding a link to the Internet will become much cheaper and easier. Its ease of use will also improve, which is fine news, for the savage UNIX interface of TCP/IP leaves plenty of room for advancements in user-friendliness. Learning the Internet now, or at least learning about it, is wise. By the turn of the century, "network literacy," like "computer literacy" before it, will be forcing itself into the very texture of your life. For Further Reading: The Whole Internet Catalog & User's Guide by Ed Krol. (1992) O'Reilly and Associates, Inc. A clear, non-jargonized introduction to the intimidating business of network literacy. Many computer- documentation manuals attempt to be funny. Mr. Krol's book is *actually* funny. The Matrix: Computer Networks and Conferencing Systems Worldwide. by John Quarterman. Digital Press: Bedford, MA. (1990) Massive and highly technical compendium detailing the mind-boggling scope and complexity of our newly networked planet. -- more (95%) -- The Internet Companion by Tracy LaQuey with Jeanne C. Ryer (1992) Addison Wesley. Evangelical etiquette guide to the Internet featuring anecdotal tales of life-changing Internet experiences. Foreword by Senator Al Gore. Zen and the Art of the Internet: A Beginner's Guide by Brendan P. Kehoe (1992) Prentice Hall. Brief but useful Internet guide with plenty of good advice on useful machines to paw over for data. Mr Kehoe's guide bears the singularly wonderful distinction of being available in electronic form free of charge. I'm doing the same with all my F&SF Science articles, including, of course, this one. My own Internet address is bruces@well.sf.ca.us. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 62 of 133 Subject: Re: Text Barrage! From: enzyme (David Pincus) Date: Sun, 27 Dec 92 04:02:31 EST In-Reply-To: Great article! I never knew RAND had a cyberchild! CU AUGAUCAUCGAUCGAUCGUACGCUAGCU A Think small |||||||||||||||||||||||||||| G RIBOZYME molecular biology UACUAGUAGCUAGCUAGCAUGCGAUCGA A UC [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 63 of 133 Subject: Re: Text Barrage! From: chrmsync (Chrome Sync) Date: Sun, 27 Dec 92 04:32:11 EST In-Reply-To: Rand has several followers 'bout these parts ... ;) [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 64 of 133 Subject: Re: Text Barrage! From: enzyme (David Pincus) Date: Sun, 27 Dec 92 16:37:27 EST chrmsync (Chrome Sync) writes: > Rand has several followers 'bout these parts ... ;) > Any other files I can check out on the venerable RAND? CU AUGAUCAUCGAUCGAUCGUACGCUAGCU A Think small |||||||||||||||||||||||||||| G RIBOZYME molecular biology UACUAGUAGCUAGCUAGCAUGCGAUCGA A UC [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 65 of 133 Subject: Re: Text Barrage! From: chrmsync (Chrome Sync) Date: Sun, 27 Dec 92 18:20:56 EST In-Reply-To: <59mgwB2w165w@mindvox.phantom.com> > Any other files I can check out on the venerable RAND? Not that I know of (offhand) ... but have you read her two best (IMHO) works: ANTHEM and ATLAS SHRUGGED ? I mean, let's tal;k about a society where individuality is at a minimum, and tech is running backwards ... heck, a lightbulb ain' no big deal to us now ... Would that make Atlas Shrugged 'Paleo-Cyberpunk' (individual = little, tech = deflated) ??? [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] -- more (96%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 66 of 133 Subject: Re: Text Barrage! From: doug (Douglas Luce) Date: Tue, 05 Jan 93 10:26:36 EST > Any other files I can check out on the venerable RAND? the rand of the rand corporation and the rand of ayn rand are a bit different. for the rand corporation, look in the library for some text on early 20th century high-tech business, or stuff about elmer ambrose sperry (of sperry rand, or remington-rand UNIVAC). for ayn rand, _the_fountainhead_ is probably a better suggested reading than _anthem._ while these books should probably not be burned, anyone who bases their life philosophy on them should certainly be. dug [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 67 of 133 Subject: Re: Text Barrage! From: chrmsync (Chrome Sync) Date: Tue, 05 Jan 93 17:20:26 EST In-Reply-To: <23TwwB1w165w@mindvox.phantom.com> Well, _The Fountainhead_ was made into quite the outstanding movie. But _Anthem_ and _Atlas Shrugged_ are considered by most Rand-o-philes as her best works. [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 68 of 133 Subject: Re: Text Barrage! From: otto (Bob Otto Barnes) Date: Tue, 05 Jan 93 17:56:44 EST In-Reply-To: <23TwwB1w165w@mindvox.phantom.com> Hey y'all The RAND corporation was an Air Force think tank formed in the late 50's and charged with Research ANd Development. Game theory was developed there as was much of the H-bomb and it's strategy. RAND proved that a conflict in Vietnam was unwinnable before we even entered the war. The Air Force's reaction to that finding? They commisioned another study. Once again it was unwinnable. More commisions were done, but I don't know how many. A professor of mine worked there in the early 60's. He ws a linguist and computational theorist and he developed the first automatic language translation program (Russian/English, of course). This project ws not too sucessful: the example he gave was that when the phrase "The spirit is willing but the flesh is weak" was translated into Russian and then back into english, it came out as "The wine is good but the meat is bad." From all the reports I've heard, they certainly were a bunch -- more (86%) -- of Dr. Strangeloves. I'm not sure if the RAND corp. is arround any more. It is, of course, not related in any way shape or form to the Ingersoll-Rand company. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 69 of 133 Subject: Re: Text Barrage! From: mwark (McKenzie Wark) Date: Fri, 08 Jan 93 11:07:55 EST In-Reply-To: <0weXwB1w165w@mindvox.phantom.com> Re RAND Corp. : Fred Kaplan's The Wizzards of Armageddon (Simon & Schuster) is a great book on RAND and very readable. Bernard Brodie (ed) The Absolute Weapon (1946) includes all of the conference papers from the forum that kicked off RAND. The forum was organised by Leo Rosten, a real renaissance man. He w He wrote comic jewish nvels, a pioneering analysis of Hollywood, a RAND report on the possibility of earth-orbiting satrellites. He wasn't at the proto-RAND conference because of the opening night of The Velvet Touch - a movie he scripted, which was on at the same time. Anyway, the Brodie papers make fascinating reading, now that the cold war is 'over'. As for the other RAND - she was a McCarthyite stooge. I hope she burns in hell. cheers ken [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 70 of 133 Subject: Re: Text Barrage! From: chrmsync (Chrome Sync) Date: Sat, 09 Jan 93 03:58:10 EST In-Reply-To: mw, you sure you live in the same world as the rest of us, or is this an adventure to reality for you ... Rand & McCarthy .... jeez ...you haven't read the works (well, speeches in one case) of the two, *obviously* .... Jesse Helms is too left-wing for me ... [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 71 of 133 Subject: Re: Text Barrage! From: mwark (McKenzie Wark) Date: Sat, 09 Jan 93 09:43:04 EST In-Reply-To: Re Ayn Rand anfd the House Unamerican Activities c'tee, for which she appeared as a friendly witness, see Victor Navasky, Naming Names: "The proceedings had comic overtones... Novelist and objectivist Ayn Rand found communist propaganda in the smiling faces of children in 'Song of Russia." Which helped get Richard Collins on the blacklist (he scripted it). The Leo Rosten story i related in the previous post is told (and told better) in Fred Kaplan's book The Wizards of Armageddon. Actually there are a few connections between the war machine and the media industries which date from that era. The bombing simulators the air force used employed a cine-camera and scale models. When the films were played back, they were narrated by Capt. Ronald Reagan. Of course, VR has made his old job obsolete! Naturally, i'll ignore the gratuitous insult in the previous post. Everyone is entitled to their own reality, altho' a little evidence helps! [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 72 of 133 Subject: Re: Text Barrage! From: chrmsync (Chrome Sync) Date: Sat, 09 Jan 93 10:34:49 EST In-Reply-To: ... then I sit corrected ... !! But, it seems odd that someone who believed that Democrats were okay, and that Communism was the real threat, and brought God into discussion (though I can't recall how often) would have as a toadie someone who wanted to dismantle as much of the government he was a part of is ... well ... odd, wouldn't you say?! Hey, trust me, I already "know" of enough conspiracies, thanks ... I need to get back to that game of computer solitaire ... Hmm, lessee, King of Clubs and Queen of Diamonds ... [ Cyber-Renaissance Man ] || || || Chrome Sync || -- more (92%) -- || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 73 of 133 Subject: Re: Text Barrage! From: mwark (McKenzie Wark) Date: Sat, 09 Jan 93 22:26:13 EST In-Reply-To: I was using 'McCarthyism' too loosely. It was a trend that predates him but which as a shorthand gets called mccarthyism. You could go back to the extermination of the Wobblies in WW1, the 'red bashing of the 20s that hoover helped organise, the violence and blacklisting in the labour movement in the late 40s and so on. What i hate about Rand is that she was complicit with parts of this process. Beware of people who in principle attack centres of power but in practice lend their name to attacks by the most powerful on the lesser centres of organised power within the state. Anyway, what does this have to do with cyberpunk? Lots, i think. Cyberculture in the US fills a space which in Europe & Australia is occupied by the kind of political and cultural forces that in the US were wiped out by cold war repression. There is *still* a vaccuum there that these strange and interesting developments whoosh into. cheers ken [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 74 of 133 Subject: Re: Text Barrage! From: chrmsync (Chrome Sync) Date: Mon, 11 Jan 93 11:55:23 EST In-Reply-To: Perhaps I take most Rand-ian thought to be a new "philosophy" fit for C-punk ... at tleast the masses. Y'know (boiled down): "Do what you will ... so long as you don't screw with someone else (especially if you're the government)" Or is that too braod-based Libertarian? [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 75 of 133 Subject: Ayn Rand: Devil Queen or Liberator of the Weak? (Was Re: Text Barrag From: simonm (Simon Moon) Date: Mon, 11 Jan 93 16:28:01 EST In-Reply-To: <1728wB2w165w@mindvox.phantom.com> Well, Chrm, that's part of it. But it seemed to me, on my grantedly-not- very-deep readings, that there is a _hell_of_a_lot_ of other stuff in it that is much more objectionable, mostly assumptions about human nature that pervade her books as an unspoken basis. If your digest of minding- your-own-business-ness was all there was to Rand's philosphy, I'd be the first to sign up. - Simon [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 76 of 133 Subject: Re: Text Barrage! From: mwark (McKenzie Wark) Date: Tue, 12 Jan 93 04:47:50 EST In-Reply-To: <1728wB2w165w@mindvox.phantom.com> "Do what you will ... so long as you don't screw with someone else" - thst's fine as far asi tgoes, but how far does it go? You or i are able to make such a statement only because a whole bunch of structures and processes we don't understand, running in the 'background' as it were, enable us to appear to ourself as free agents. In practice, EVERYTHING we do screws with someone else. A somewhat more elabotate ethics is required (damn this noisy line!) in order to think about something more than individual conduct. For example, competative hacker-ethic achieves the goal of getting people off their butts and trying to achieve something which others will think as cool. Its a competative striving for recognition. It works fine for getting certain things done and getting certain information moving around the scene quickly. But it creates no durable sense of community. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 77 of 133 Subject: Re: Ayn Rand: Devil Queen or Liberator of the Weak? (Was Re: Text Ba From: mwark (McKenzie Wark) Date: Tue, 12 Jan 93 04:57:41 EST In-Reply-To: - what simon said. There's no easy answers to the problem of living an ethical life. You can't get it from books alone. You can't get it from one book. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 78 of 133 Subject: Re: Ayn Rand: Devil Queen or Liberator of the Weak? (Was Re: Text Ba From: jagged (Alexander Garrett) Date: Tue, 12 Jan 93 23:08:01 EST In-Reply-To: Wasn't Atlanta Hope based on A.R.? Lj [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 79 of 133 Subject: Re: Ayn Rand: Devil Queen or Liberator of the Weak? (Was Re: Text Ba From: ozone (Al Macey) Date: Wed, 13 Jan 93 00:38:05 EST In-Reply-To: <3ZRaXB3w165w@mindvox.phantom.com> Oh SURE. Here is this high-falootin' convo goin' on 'bout like ethics and objectivism and all that sheet, and then you goes and ask 'bout some book fittin' into da pitcher and all. I'ze just gettin' into the swing and then boom the Wall hits. Or hell. I don't know what the hell I'm typing anymore. Yeah, I have to agree - 'cause someone is pointing a gun at me right now, telling me I should - that living a "truly" ethical life is impossible. At least, I think it is. The beauty of being human, as Card suggested in Speaker For the Dead, is that we can have contradictory thoughts: we can do something we know is wrong by deceiving ourself long enough to commit the act. If we couldn't do this, we would no doubt go insane trying to always do the supposed Right thing. And thus it is easier for us to accept the immediacy of our actions when we discount the threads they may bare down the proverbial (and cliche ridden) road. To conclude, and to paraphrase Hemmingway, "bullshit is bullshit is -- more (95%) -- bullshit." Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 80 of 133 Subject: Re: Ayn Rand: Devil Queen or Liberator of the Weak? (Was Re: Text Ba From: chrmsync (Chrome Sync) Date: Wed, 13 Jan 93 18:19:19 EST In-Reply-To: <76VaXB2w165w@mindvox.phantom.com> [echo off, 'coz I hate bothering wit' it!] I wasn't suggesting Rand can be boiled down cohesively to one statement ... just that that's the primary (or salient, if you prefer) one I get from her readings (or, should that be writings ... yeah, better). Certainly, every action we take has repercussions, some of which *MAY* harm others. Maybe because I'm on 'Vox right now, someone is getting a busy signal while trying to call the guy who had the number I use before me. Maybe he's gonna off himself, and desparately needed to talk to his old friend. And maybe if he got me, I'd realize what was goin' on, and talk him out of splattering his brains on the wall. but let's be realistic. insert an understood ("willful or knowing") into the "screw someone else" phrase. Does that make it more pallatible ? -- more (31%) -- Intention and action. Not always the same. But certainly, our current justice code is based on both (largely). "Criminal Mind" is required to convict someone of most any real crime (one perpetrated against a person, not some ambiguous "society" ... after all, if I have a right to face my accuser, let society come forth and accuse me at a hearing!) If I hack, read someone's diary, and do nothing with the information (take no action based on it, and do not redistribute it) is it really a crime? [ignoring the fact of how *damn* silly it'd be to keep a diary online ... ] Nevertheless, have I taken (physically) anything from them? Opressed them somehow? [IMHO, that's a moral, not legal issue. I feel obliged _not_ to read someone's diary. But I'm not here to enforce my morality on you.] There was a book written not too long ago titled _Absorb What is Useful_. I never read the book, just saw the title. How singularly brilliant! Certainly, my readings of Nietzche, Rand, Machiavelli, Plato, Arisotle [man, was *he* picky about theatre!], Sterling, Gibson, Moorcock, Lovecraft, Schwarzenegger and the Christian Bible have all affected my -- more (65%) -- outlook on life (as well as other sources). But I certainly don't adhere to the tenets of any one source completely (even Funakoshi or Musashi). One test I prefer to apply to an outlook or philosophy, or world view is this: If everyone in the world was you, and you all had this outlook, could you live in this world? How about if everybody that lives here now did? In my (simplified, perhaps overly so) example of "life, liberty and property, so long as it doesn't screw with anyone", I honestly believe the world would be a better place. [of course, if everyone drove like I did, I think there'd be less accidents, and everyone would get where they're going much more quickly, too .... ] Can any of you propose an alternate "philosophy" for the future that still allows for person freedom, and that serves all people (or, perhaps, treats) all people equally? And, how does it compare to the darker vision of the future Gibson, Sterling, et alis have foreseen? Just my thoughts for th' moments .. [ Cyber-Renaissance Man ] -- more (95%) -- || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 81 of 133 Subject: re:philosphies From: reive (Racheline Maltese) Date: Wed, 13 Jan 93 22:59:22 EST In-Reply-To: I kind of agree with a lot of the last post, but one thing that was said got me thinking.... Chrome Sync asked for others' philosphies for a liveable future, and mentioned the darker outlooks of Gibson, Sterling, etc.... Am I just really twisted, to find the darkness in those books just a little appealing? Most people I've talked to about Neuromancer in particular were just a little spooked by how appealing they did find it at times. I know we all want our freedoms and civil rights, but how much do we really care about each other's. I am not saying human nature is all bad, nor that I get my kicks out of screwing with other people's lives, but how likely is a liveable future? If people did live by the rule of do what you want and don't screw with others, a lot of what we do (hacking-- even if only for information purposes, etc) would be considered screwing with others. Not that we wouldn't continue to do these things, but, are we really willing to bind ourselves by our own rules? I like all the idealism I'm hearing from people about technology, unfortunately I find cynicism more interesting. -- more (91%) -- Not sure this answered this original query, but whatever..... -Racheline (yes, I know I ramble) :) [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 82 of 133 Subject: re:philosphies From: mwark (McKenzie Wark) Date: Thu, 14 Jan 93 09:25:26 EST In-Reply-To: The world offered in Gibson's vision of The Sprawl is appealing, because we assume we'd be among the winners. It sounds like a cool challenge. Of course most of us would proably be loosers, and not 'gentelmen loosers either. Total autonomy sounds very appealing when you foret you had it easy, surrounded by the most massive support systems ever invented on this earth to make life easy. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 83 of 133 Subject: re:philosphies From: chrmsync (Chrome Sync) Date: Thu, 14 Jan 93 12:26:59 EST In-Reply-To: <49eDXB1w165w@mindvox.phantom.com> Gibson's vision appealing ... yes, in a way ... The part of me that feels I have a scampering grasp on NewTek, understanding just enough about what goes on to be a minor leaguer. The part of me that thinks "I'm young, fast, and can walk the Sprawl." The part of me that can put a round in a coffee mug at 50' from a draw. My "lone wolf" side. But I'm soft. I want a wife and kids. The easy life. Corp sellout. Sarariman. Or maybe a cop in a cushy Zone. A faceless person in the Matrix. I can't have my life and live it too ... [ Cyber-Renaissance Man ] || || || Chrome Sync || -- more (92%) -- || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 84 of 133 Subject: re:philosphies From: critic (Terry Palfrey) Date: Sun, 17 Jan 93 01:32:13 EST In-Reply-To: The real revolutionary lives inside and waits for the moment of peak action to drop the monkey wrench into the establishment. After all it takes some considerable wisdom to know when to do that for the benefit of all. A family, contrary to your fuzzy happy image is not as easy or nice as you would like to believe, an if you know anything about the world you realise the impossible task of getting them ready to deal with the world in a meaningful fashion, but I know mine will be ready for it. The Boy Scouts still reign supreme when it comes to mottos. CritiC [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 85 of 133 Subject: re:philosphies From: chrmsync (Chrome Sync) Date: Tue, 19 Jan 93 23:12:37 EST In-Reply-To: Well, even if CritiC is too cynical to think of a family in a warm, fuzzy way, I want one ... and will have one. 'Course, my future wife has to be able to shoot and dress wounds, too! Boy Scouts: Semper Paratus - "Always Prepared" .. who'd you think the Eagle Scout around here was ?!?!? [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 86 of 133 Subject: Boy scouts and stuff From: ehsmith (Ethan H. Smith) Date: Wed, 20 Jan 93 00:48:47 EST In-Reply-To: How do I get to be Grand Poobah in one of those deals? [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 87 of 133 Subject: Gibson From: tomlin (James Tomlin) Date: Wed, 20 Jan 93 17:30:16 EST In-Reply-To: <1BVNXB5w165w@mindvox.phantom.com> Where is good ol` William Gibson these days? I've seen Bruce Sterling post here but not Willy. ..Or have I missed something? Is he too busy or what? flame on, nobody [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 88 of 133 Subject: Boy Sprouts From: chrmsync (Chrome Sync) Date: Thu, 21 Jan 93 13:35:14 EST In-Reply-To: <6o6oXB2w165w@mindvox.phantom.com> [Title is not a typo, just Illuminati (Game) reference]. How to become a SCout leader... hmmm ... I imagine you' contact the local HQ, and mention interest in being an Assitant ScoutMaster or Adult Leader type. (sorry I can't be MoRe HeLpFuL ... ) Scout Law: A Scout is Trustworthy Loyal Helpful Friendly Courteous Kind Obedient -- more (74%) -- Cheerful Thrifty Brave Clean and Revent [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 89 of 133 Subject: Re: Boy Sprouts From: rebelion (Chris Jones) Date: Thu, 21 Jan 93 20:08:24 EST In-Reply-To: i'm not a boy scout, but i always have my portable hack tools with me...(nmn, where are you?) rl/SoG [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 90 of 133 Subject: Re: Boy Sprouts From: simonm (Simon Moon) Date: Fri, 22 Jan 93 02:47:25 EST In-Reply-To: I always knew there was a reason I didn't like the Scouts... ""Obedient"? "Revent"? "Cheerful" and "Clean" even? I'm glad I stayed away. - Simon [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 91 of 133 Subject: Re: Boy Sprouts From: drow (Doug Rau) Date: Fri, 22 Jan 93 04:24:19 EST In-Reply-To: oh wow it brings back MEMORIES... 'look. it's me, with my mother.' : rachael memories of fucking around in the church where we met, the lame troop leader, running through the halls shouting nasty jokes, everybody quit at once, really. hehe 'i design haven't your eyes.' played illuminati in a i just got : chew : long a %HACKER% time poster 4 my well, that's all folks! wall ps : chrmsync : where ru it's very nice listed in the espionage credits??? -- more (96%) -- : drow : [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 92 of 133 Subject: Re: Boy Sprouts From: chrmsync (Chrome Sync) Date: Sat, 23 Jan 93 04:29:26 EST In-Reply-To: <9muRXB8w165w@mindvox.phantom.com> drow: Under unindicted coplaytesters ... and if you're hip enough to get GURPSNet, I'm also listed in that current issue (#24) ... Wait for Hacker II and Hacker III (got briefs on plans for each last summer ... *wild* shit!!) [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 93 of 133 Subject: Boy Scouts From: ahawks (Andy Hawks) Date: Wed, 27 Jan 93 23:35:27 EST I was a boy scout once. Now I eat rhubarb. ahawks@nyx.cs.du.edu FutureCulture: In/f0rmation ahawks@mindvox.phantom.com future-request@nyx.cs.du.edu [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 94 of 133 Subject: Re: Boy Scouts From: squirrel (quazi) Date: Fri, 05 Feb 93 12:20:56 EST In-Reply-To: I flunked out of boy scouts Quazi [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 95 of 133 Subject: Re: Boy Scouts From: netw1z (Ama ama) Date: Sat, 06 Feb 93 08:34:17 EST In-Reply-To: what a bunch of fags .. and i mean that in a non-demeaning way to ligetitmate homo-sexuals who may use and read this message [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 96 of 133 Subject: Re: Boy Scouts From: chrmsync (Chrome Sync) Date: Sat, 06 Feb 93 09:06:49 EST In-Reply-To: Well, w1z, it's really a mini-"old boy" network ... kinda like DeMolay is for FreeMasons. scary trivia: both being a Boy Scout and achieving Eagle are listed on ROTC applications (well, '85 - '86) ... maybe it's that teramwork thing or discipline ... if only they knew ... Eagle Scout, [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 97 of 133 Subject: Re: Boy Scouts From: deadboy (The Dead) Date: Sat, 06 Feb 93 21:11:51 EST chrmsync (Chrome Sync) writes: > Well, w1z, it's really a mini-"old boy" network ... > kinda like DeMolay is for FreeMasons. No please, not this. If all the boy scouts in the world blew up or went away at the same time I can almost garantee that the number of future nightclerks at 7-11's who won't be able to work there because it'll be fully automatic by then, would go down by 90% Not even counting the millitary, ohmygod. I _like_ the Freemasons, they're cool. Has the guy who wrote Snow Crash ever written anything else? Short stories or articles, or did he just appear one day Snow Crash in hand? The Dead Shall Rise -- more (96%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 98 of 133 Subject: Re: Boy Scouts From: chrmsync (Chrome Sync) Date: Sat, 06 Feb 93 22:25:40 EST In-Reply-To: hey, deadboy, who will help the poor widow's son? I'd show you how some people shake ... but you're not here ... Spartacus' understudy, [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 99 of 133 Subject: Re: Boy Scouts From: hayden (Hugh Appet) Date: Sun, 07 Feb 93 10:42:16 EST chrmsync (Chrome Sync) writes: > > scary trivia: both being a Boy Scout and achieving Eagle are listed on > ROTC applications (well, '85 - '86) ... maybe it's that teramwork thing or > discipline ... if only they knew ... > What would a Voxer or someone in their right mind be doing w/an ROTC application in this day & Age? [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 100 of 133 Subject: Re: Boy Scouts From: chrmsync (Chrome Sync) Date: Sun, 07 Feb 93 11:14:40 EST In-Reply-To: <6syLyB1w165w@mindvox.phantom.com> Hey, '85 - '86 ain' exactly "this day & age" ... FYI, it was so I could get someone *else* to fund my education ... (my hearing kept me out of it). [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 101 of 133 Subject: Re: Boy Scouts From: ozone (Al Macey) Date: Sun, 07 Feb 93 21:22:20 EST In-Reply-To: <6a1LyB1w165w@mindvox.phantom.com> Heh. I can empathize a bit, Chrome. I chose to play Division III football at a school that didn't have ROTC instead. Ahh well. I was young. (Now, I'm in debt.) Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 102 of 133 Subject: Re: Boy Scouts From: scoundrl (Renal Boy) Date: Sun, 07 Feb 93 21:41:07 EST In-Reply-To: i was in boy scouts for 3 1/2 years, and i never got past first-class. now i can't motivate myself to do anything,and i am on a course to become a failure in life. do you think there's any connection? the Scoundrl [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 103 of 133 Subject: Re: Boy Scouts From: hotblack (Dana Watanabe) Date: Mon, 08 Feb 93 00:04:32 EST In-Reply-To: <9aTmyB1w165w@mindvox.phantom.com> definitely a connection hell it was the same with me except i think i made it farther than first class hmm.. maybe not, but it wasnt fair i was patrol leader adn spent the whole time helping my patrol get their badges [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 104 of 133 Subject: Re: Boy Scouts From: chrmsync (Chrome Sync) Date: Mon, 08 Feb 93 16:51:32 EST In-Reply-To: <0XZmyB2w165w@mindvox.phantom.com> Hey, it was a good place to hang out (wherever the troop went) ... we had a "cammie corps" ... older guys who went off and did whatever ... later we got "LEADERSHIP CORPS" badges ... mostly a crock ... still, was worth the experience. A few good connections. 'Sides, my old neighborhood had no cool, white-guy gangs ;) [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 105 of 133 Subject: Re: Boy Scouts From: scoundrl (Renal Boy) Date: Mon, 08 Feb 93 17:06:25 EST In-Reply-To: hey i didn't say that it was a bad experience. i even got to assistatn patrol leader once, and i was in it for THREE years, like i said, so there had to be something....going on campouts and then sneaking away to town, taking dirty magazines and cigarettes and feeling like MEN. geez...those were the dayz. the Scoundrl [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 106 of 133 Subject: Re: Boy Scouts From: chrmsync (Chrome Sync) Date: Tue, 09 Feb 93 12:26:28 EST In-Reply-To: And don't forge the fun ya got to have with the younger kids ... late in the night ... doing ... whatever ... to their tents. Puttin' rocks in people's packs, &tc. &tc. BTW, I was the first scout in my troop (to the best of my knowledge) to get the COMPUTERS merit badge. Even showed off the punchcards from DLI at Presidio, Monterey, California. [Defense Language Institute, where any DoD-type can be sent to learn a foreign language] [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 107 of 133 Subject: Re: Boy Scouts From: allah (Alex Metcalf) Date: Thu, 11 Feb 93 16:58:28 EST In-Reply-To: Boy Scouts. Boy Scouts. Boy Scouts... My Scoutmaster's sitting there, talking up a storm about this and that while we're on a camping trip. he's big, be's butch, he's a _man_. Only later, after he passes around a few copis of the new Penthouse for my buds to tease their meat puppets with, he confronts me with some serious gay porn and asks me what I think. One thing leads to another and my 12 year old self is scared and pissed so I kick him in the balls and run away into the forest...Got kicked out fo the scouts for assaulting my scout master. Be prepared! AL X [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 108 of 133 Subject: Re: Boy Scouts From: scoundrl (Renal Boy) Date: Thu, 11 Feb 93 17:52:32 EST In-Reply-To: <6VuTyB1w165w@mindvox.phantom.com> jeez.... my scout troop was never like taht. hmmm... that kind of perpetuates the idea of gay men trying to take advantage of little boys. did this really happen? if it did i think that its aweful, and did you ever tell anyone, did he ever get in trouble? the Scoundrl [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 109 of 133 Subject: Re: Boy Scouts From: chemist (The Chemist) Date: Thu, 11 Feb 93 19:41:17 EST In-Reply-To: <0DXTyB5w165w@mindvox.phantom.com> Dudes, not to crush your happy memories of playing with other boys, but this is the cyberpunk forum and I don't give a shit about hearing about the boy scouts! Petition the management to add a boys life bord or something so you can all bond there. -tC [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 110 of 133 Subject: Re: Boy Scouts From: siva (The Destroyer) Date: Fri, 12 Feb 93 00:43:53 EST In-Reply-To: No, hey, my scout troop was cool... they smoked anything they could get their hands on, they cut logging cables two inches thick, and watched the empty cars/hooks go thrashing down about 2000 feet of mountain side, taking out anything in it's path. They burned down old abandoned buildings. They made huge explosives. They once mistakenly attacked me with knives, because I was the patrol leader. No other reason. Blood was shed, they remembered why I was the leader. They rode trains to strange cities. All this was in japan. -- more (96%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 111 of 133 Subject: Re: Boy Scouts From: chrmsync (Chrome Sync) Date: Fri, 12 Feb 93 00:52:21 EST In-Reply-To: Well, can there be a 'CPunk' version of the Boy Scouts? Young'ns trying to help out others, say on the 'Net, introducing them to usage, netiquette, and whacking those who ... er ... well, disregard that last part ... Or would that be a cross with the Guardian Angels (who are by no means perfect ... but good-hearted (largely) do-gooders). And if so, who would sponsor such an organization? Still private as now, or would certain corps sponsor a troop or patrol? Turn 'em into mini-security guard (junior rent-a-cops)? .. just throwing the thread back into the weave ... [ Cyber-Renaissance Man ] -- more (87%) -- || || || Chrome Sync || || || [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 112 of 133 Subject: Re: Boy Scouts From: simonm (Simon Moon) Date: Fri, 12 Feb 93 13:07:03 EST In-Reply-To: And fer sure we'd want a CyberBrownies, or whatever little girls scouts are called. My sister would love it! (And so would Sassy, for that matter.) - Simon [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 113 of 133 Subject: re: Brownies From: reive (Racheline Maltese) Date: Fri, 12 Feb 93 19:16:25 EST In-Reply-To: I was a Brownie when i was in 2nd and 3rd grad; my mom was troop leader. We even actually had a meeting about how to use computers (comodore 64's) but I think we had some tecaher lead that, 'cause my mom still can't turn on a computer to this day. I remember being bummed that I couldn't get a badge for knowing computer junk, just cooking and artsy shit. Oh well. I think I still have my old uniform in a closet somewhere. -reive ******************************* * reive * * reive@mindvox.phantom.com * * zs840c@gwuvm.gwu.edu * ******************************* [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 114 of 133 Subject: re: Brownies From: sulam (James Waldrop) Date: Fri, 12 Feb 93 20:11:37 EST In-Reply-To: <3XVVyB1w165w@mindvox.phantom.com> Cyberbrownies?? *Sulam shivers in his ruby slippers, furiously clicking away* [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 115 of 133 Subject: re: Brownies From: chrmsync (Chrome Sync) Date: Sat, 13 Feb 93 03:42:26 EST In-Reply-To: <3HyVyB2w165w@mindvox.phantom.com> ANd instead of selling cookies, codez? or shareware? I guess it was cool, thinking that BS had a Computers merit badge and GS didn't ... 'course, there coould be a time wwarp effect. I got mine around 1982 or so (maybe '83) ... and it was certainly around before that! What aabotu the general idea of do-gooders in the future? Or is everyone to be too egocentric or selfish for it to matter? Just random thought during my graveyard shift ... [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [ in the material world ] -- more (96%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 116 of 133 Subject: re: do-gooders From: sulam (James Waldrop) Date: Sat, 13 Feb 93 09:25:15 EST In-Reply-To: Hmm, are we that bad? I would think that any new user could learn quite a bit about computing just by being on a few boards (not these PC warez boards I keep hearing about, I mean like real boards, or "smart" MUDs). Provided someone was willing to winnow away a lot of chaff, this sort of place is right up there with K-12 in my mind. And if you can't handle a little winnowing, you shouldn't be on the Internet. //Sulam [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 117 of 133 Subject: Exptopian list From: voidmstr (Dennis Wilen) Date: Fri, 19 Feb 93 16:45:08 EST In-Reply-To: I'd like to get the Extropian list. Anyone got an address? Thanx! [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 118 of 133 Subject: Re: Exptopian list From: blade (Terry Hoffman) Date: Fri, 19 Feb 93 17:40:37 EST voidmstr (Dennis Wilen) writes: > I'd like to get the Extropian list. Anyone got an address? Thanx! 1) Formal complaints and administrative requests MUST be sent to: Extropians-request@gnu.ai.mit.edu To join or discontinue the digest version send a request to: exi-daily-request@gnu.ai.mit.edu To join or discontinue the real time version send a request to: Extropians-request@gnu.ai.mit.edu 1a) Please allow up to 3 to 5 business days for your requests to be processed. Please note that most requests are handled with 12 to 32 -- more (77%) -- hours. The handling of requests on the days just prior to and after holidays maybe completely deferred or greatly delayed. 2a) Mail to the list should be sent to: extropians@gnu.ai.mit.edu [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 119 of 133 Subject: Re: Future Culture From: pjv (Max lansing) Date: Thu, 18 Mar 93 15:00:06 EST In-Reply-To: YES, I am very interested in your news letter. Does it cost anything? I am new when it comes to "Net" etiquette. But yes I am very interested in receiving your information. Here is my address: PJV@mindvox.phantom.com send [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 120 of 133 Subject: Re: Future Culture From: ahawks (Andy Hawks) Date: Wed, 24 Mar 93 21:12:44 EST In-Reply-To: sig says it all, subect 'send info'... ahawks@nyx.cs.du.edu FutureCulture: In/f0rmation ahawks@mindvox.phantom.com future-request@nyx.cs.du.edu [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 121 of 133 Subject: A Fun 'Hack' .. From: chrmsync (Chrome Sync) Date: Sun, 28 Mar 93 09:31:56 EST As a cold operator (it's friggin' 63 in the suite), I can run CPU-intencive work on the Convex C240; the increased workload raisess the exhaust temp. by 4-8 degrees ... Now, if I could just pop popcorn by the CRT radiation ... :) [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 122 of 133 Subject: Re: Boy Scouts From: lyre (Lyre) Date: Mon, 29 Mar 93 13:28:08 EST allah (Alex Metcalf) writes: > Boy Scouts. Boy Scouts. Boy Scouts... I was kicked out for refusing to wear the uniform. I said it was "paramilitary". [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 123 of 133 Subject: Re: Boy Scouts From: chrmsync (Chrome Sync) Date: Mon, 29 Mar 93 13:29:20 EST In-Reply-To: Heck, I *enjoyed* the uniform ... rank, rate/job, medals, pins and the baddest, nastiest (oops! ... errr, those with the most leadership skills) got berets ... ;^) Pow-well, Pow-well, uber alles ... {Powell = Lord Baden Powell, started Boy Scouts in England} A "retired" Eagle Scout, [ Cyber-Renaissance Man ] || || || Chrome Sync || || || -- more (92%) -- [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 124 of 133 Subject: Re: Boy Scouts From: allah (Alex Metcalf) Date: Tue, 30 Mar 93 09:41:02 EST In-Reply-To: Actually an eagle scout, hmmmm? Gonna let us in on those secret eagle ceremonies where they kidnap little children from the "lesser" races and sacrifice them to the great god of whiteness and light: Baden-Powell??? AL X [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 125 of 133 Subject: Re: Boy Scouts From: chrmsync (Chrome Sync) Date: Wed, 31 Mar 93 14:27:24 EST In-Reply-To: <4yB91B1w165w@mindvox.phantom.com> Ah, the "Order of the Arrow" was better -- AmerIndian-type stuff -- weird initiations (like the Knights of Columbus, but better; but not nearly so hip as higher-level Mason stuff ... ) [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [ in the material world ] [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 126 of 133 Subject: What the hell is Cyberpunk? From: cable (John D'Emic) Date: Wed, 07 Apr 93 21:55:49 EDT In-Reply-To: What the hell is this. What the fuck is a cyberpunk.The definition of one has become extreemely clouded lately. Media coins all cyberpunks to be computer hackers who break into systems with no reason whatsoever. The RPG'sand movies coin cyberpunks as gun toting cyborgs or (once again) hackers. The literal definition is one who is grafted or interacts with machines (cyber) and the anarchist (punk). Aren't then most people on the net cyberpunks because we interact with machines (modems) and we are take part in an anarchistic society (No one owns the internet, you can do whatever the hell you want it, no central 'government' ect.). -Cable- "Take Control of the Machine Now" -the Utah Saints- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 127 of 133 Subject: Re: What the hell is Cyberpunk? From: pjv (Max lansing) Date: Sun, 18 Apr 93 18:20:44 EDT In-Reply-To: RE: Sci-Fi Channel program - FTL Newsfeed To all interested, FTL Newsfeed is an original program on the SFC. It is news from 150 years in the future. Everyday on the SFC, FTL News comes on for 30 seconds and reports the news fro the future, except it is real-time. I would like to get feedback on the storyline, plots and characters etc. from people online. I will post a weekly summary of FTL News, and people can post feedback etc. I will do this if people our interested. Let me know if any of you are interested in providing a sounding board to this project. Thanks Max -- more (97%) -- [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 128 of 133 Subject: Re: What the hell is Cyberpunk? From: gearhead (Sean Hamilton) Date: Sun, 18 Apr 93 21:55:09 EDT In-Reply-To: <0w482B2w165w@mindvox.phantom.com> Yeah, man, post it. Since the Bastids at BQCable don't see fit to provide us with the SciFi channel I'm real curious about what youse guys is up to. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 129 of 133 Subject: Re: What the hell is Cyberpunk? From: deckard (Mike Gwertzman) Date: Sun, 18 Apr 93 22:40:33 EDT In-Reply-To: I've got this Sci Fi channel (it was put on my lame ass cable system two weeks ago or so) and so far all I can determine is that it has the rights to all the Battlestar Galactica and Space 1999 reruns. Its not listed in my tv guide, program guide, nothing. Dont move to riverdale. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 130 of 133 Subject: Re: What the hell is Cyberpunk? From: metalhed (metalhed) Date: Mon, 19 Apr 93 15:12:05 EDT In-Reply-To: Well i've had Sci-Fi for about.. 4 months? maybe longer.. i dunno but basicly it just show movies every now-and-then then it has it's own shows like... hmm god i's only got one of it's own shows i think, "Mysteries from Beyond the Other Domain", which is some dork talking about weird things that happened Before Christ mostly. Then it's got all of the reruns Buck Rogers, Alien Nation, Lost in Space, The Incredible Hulk, etc etc etc. nothing all that special Dekard - if it was only put on by you 2 weeks ago then the Cable Co. will probably have it listed in a month. [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 131 of 133 Subject: Sci-fi Channel From: l666 (Lucifer 666) Date: Thu, 29 Apr 93 13:16:31 EDT In-Reply-To: One interesting thing about the sci-fi channel is that it shows the Prisoner TV series which has been increasingly difficult to find.. (Damn VM machine)@|#@| L666 [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 132 of 133 Subject: Re: Sci-fi Channel From: drow (Doug Rau) Date: Thu, 29 Apr 93 16:48:30 EDT l666 (Lucifer 666) writes: > One interesting thing about the sci-fi channel is that it shows the > Prisoner TV series which > has been increasingly difficult to find.. (Damn VM machine)@|#@| this is an incredible reason to get the channel imho so of course the local cable company DOESN'T carry it *grumble* [ Area: CyberSpace / Forum: Cyberpunk ] [Return] 1-133, [Q]uit: Post: 133 of 133 Subject: Re: Sci-fi Channel From: molbloo (Alissa Bader) Date: Thu, 29 Apr 93 20:32:45 EDT In-Reply-To: CTI/Heritage Cable doesn't carry it, of course, but we have 24-hours-straight of the Nashville Network. Yet another downer in living in a mostly-hick state. *puke* "How much would you pay to spend an evening with Demi Moore's mind?" molbloo@phantom.com abader@umaxc.weeg.uiowa.edu [ Area: CyberSpace / Forum: Cyberpunk ] [P]ost, [L]ist, [1-133] [Q]uit: -=/[ End of All Songs / [No Further Messages] ]/=- [ Area: CyberSpace / Forum: Cyberpunk ] [P]ost, [L]ist, [1-133] [Q]uit: q  -=/[ Returning to Main Menu ]/=- (10:00pm) [ Area: CyberSpace / Forum: Cyberpunk ] (? for Menu) [Main Menu]: index  /\_-\(:::::::::)/\_-\ <((_)) MindVox ((_))> \- \/(:::::::::)\- \/ -=/[ Babylon ]/=- Bandwidth Club-Chaos ThugWorld -=/[ Computers (GUIs / Networks / Operating Systems) ]/=- Advocacy Amiga Silicon-Graphics NeXTSTEP Programming Apple Sun/SPARC NT Security Mac Laptops OS/2 Windows Viruses PC Networks Unix X -=/[ Creative-Arts ]/=- -- more -- Art Books Movies Writing Writing-Workshop -=/[ CyberSpace ]/=- Cyberpolis CPSR Ethics Media Piracy Round-Table Cyberpunk Gatherings Mondo Publications VR EFF Hacking Phrack Red-Tape Wired -=/[ Drugs ]/=- Cognitive-Enhancement Discussion Psychedelic Safety Steroids -=/[ Echoes ]/=- -=]) Under Construction ([=- -=/[ Erotica ]/=- -- more -- (10:00pm) [ Area: CyberSpace / Forum: Cyberpunk ] (? for Menu) [Main Menu]: go ethics (10:00pm) [ Area: CyberSpace / Forum: Ethics ] (? for Menu) [Main Menu]: read    aby out No detailed information available about Ethics (10:00pm) [ Area: CyberSpace / Forum: Ethics ] (? for Menu) [Main Menu]: read -=/[ [447] New Messages / Begin Reading at (#1) ]/=- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 1 of 447 Subject: Hacking From: sparc@mindvox.phantom.com (John Gaelum) Date: Sat, 18 Jul 92 13:07:04 EDT This seems like the place to do it, so here goes: How would a hacker be defined in today's world? The excuses used by Richard Stallman about wanting to learn, are moot by now, because anyone with $900 can buy a machine 5 times as powerful as the best computer at MIT was when Stallman wrote those words. What does it all come down to, what >is< a hacker nowadays? Sparc [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 2 of 447 Subject: Re: Hacking From: ahawks@mindvox.phantom.com (c@:mg) Date: Sat, 18 Jul 92 17:26:55 EDT I only have one thing to say, and that is: There are so many varied definitions for hacker, cracker, cyberpunk, etc. The only way we can avoid discrepancies in the definitions is to include your own definition in the context in which you use the word. IE: "I was hacking COSMOS the other day, being careful not to destroy data as any self-respecting hacker would". (From thsi sentence, you can see that I give my own definition of a hacker in the context of the sentence. IE: a hacker could be someone who penetrates systems but is non-mailicious.) That is all that is necessary - include your definition every time you use the word. It's the only way people are going to know what you're talking about. Trying to change someons' perception of a hacker is like trying to change their religion. BTW - that quote above is just an example, not ncessarily my own definition. -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 3 of 447 Subject: Dude... From: archer@mindvox.phantom.com (Richard Newson) Date: Sun, 19 Jul 92 16:28:03 EDT You've been reading too many 5 year old text files. Who are you anyway? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 4 of 447 Subject: Hacking From: blain@mindvox.phantom.com (Blain Strickel) Date: Mon, 20 Jul 92 00:09:00 EDT I thought that was a good example, if there is something else going on under all that, I'd like to know about it. If anyone has anything they'd like to add, please post it or email me. Thanks Blain [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 5 of 447 Subject: Distortions From: terminus (Len Rose) Date: Sat, 25 Jul 92 17:44:07 EDT I found out the hard way that lies and distortions often are viewed as the absolute truth , merely because their sources were the Government, and major publications. It is a shame, but what people think of you is based on that alone. I guess it's just another vivid example that people who own the media get to define the "truth" .. I can only assume that it will always be this way until more and more of our society gets their information from a truly electronic media system in which we all have a chance to get the real facts distributed by doing so ourselves without fear of censorship, or reprisal. Mark is facing a very difficult time. He is basically against the wall, and we must all try to help him get through this. I don't care whether he is guilty or not. The real fear is that he will get destroyed in the sentencing process. Sometimes I wonder just who really runs the government. Oh well, I am no longer able to speak freely. Perhaps someone who has civil rights can carry on this discussion... -- more (97%) -- Len [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 6 of 447 Subject: Hey Len! From: digital (Patrick K. Kroupa) Date: Sun, 26 Jul 92 02:08:07 EDT Didn't they give those back to you? You must have forgot to pick up your civil rights on the way out the door in your rush to get back to freedom! (Insert an emoticon) Patrick [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 7 of 447 Subject: guilty? From: michelle (Michelle Harris) Date: Mon, 27 Jul 92 00:29:16 EDT > I don't care if he's guilty or not... Isn't the the whole question of being on trail? That's what's supposed to be the question. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 8 of 447 Subject: The "Hacker's Ethic". It is dead.. From: ahmed (Ahmed Kufuti) Date: Mon, 27 Jul 92 03:22:40 EDT Someone earlier brought up a good point regarding the state of technology and how affordable it is, and perhaps I would like to expand on it with the views of my own. People like Emmanuel Goldstien and Phiber Optik and other hackers have always stated that it is "okay to break into other peoples computers if you don't do any damage", "it's okay to explore, and learn, etc..etc..". The "hacker ethic" of the 1970's and 1980's, as stated above made sense then because really powerful computers (Unix and VAX and such) were far too expensive for the average individual to afford, so it was only "right" for hackers to break in to learn how to use such machines. I tend to agree with the hacker ethic on this. But does this make any sense in 1992? I do think not. Time changes many things, you see. If you want to learn Unix, you can build a Unix system for around $800. This would basically be a 386 with 2 or 4 megabytes RAM, -- more (41%) -- a 40-80 MB hard disk, and something like Linux, Coherent or 386BSD. And such a system would be more powerful than the 3B2 and VAX 11/750 machines that people hacked into in the 70's & 80's. Plus you would have super user access and everything would be legal and no worries. So does it really make any sense at all to keep the hacker ethic alive when such powerful hardware has become so cheap? It sounds really silly to say that it's okay to hack into some else's Unix machine today because you want to learn how to use Unix. It is too silly.. It sounds almost hypocritical and people will only think that the only reason for breaking into another machine is so you can read their private data files, and not so you can learn shell programming or whatever. I also think that another reason why hacker break into machines, which is never stated publically, is the "rush" or excitement that they feel from the danger of breaking the law. People I have spoken to say this rush can be quite addictive, almost like the heroin. Mr. Goldstien, I think it is time for you to get new slogans because repeating the "hacker ethic" in this time of cheap access to powerful technology makes you look quite foolish from my point of view, and from the point of view of others. Stop saying we are only "exploring" or "learning" by hacking when this is not the case in the 1990's. You can -- more (92%) -- pick up books on Unix and a copy of Coherent for $99 and accomplish exactly the same thing without breaking any laws. respectfully, ahmed [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 9 of 447 Subject: ahmed From: klarry (Larry Kessler) Date: Mon, 27 Jul 92 04:28:41 EDT that was one of the worst written and best thought out messages posted in a while. The people pushing that old "its ok to explore" speech were from the 70's, you cansee for yourself how fast Stallman changed his mind once hackers started dleating his work from FSF. Larry K. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 10 of 447 Subject: ethics From: phiber (Phiber Optik) Date: Mon, 27 Jul 92 04:18:48 EDT You going to give me the $800 to buy a unix box? Didn't think so. Moot point, because that isn't the issue. To explore and learn new things is. If you don't like that, fine. You can complain. But complaining isn't going to accomplish much of anything, except maybe wasting a lot of time. Humankind hasn't prospered by sitting on its behind, but by exploring new things and ideas. To stretch the limits of technology to improve our lives, and the world. The question is, do you want to be known as one of the COMPLAINERS, or one of the DO-ERS? In order to improve the technology of the world around you, you must first understand it. We all must. It's our moral obligation as human beings. The rewards of improving our lives and the lives of our fellow man/woman are much too great to yield to persecution and blatant ignorance. THAT is the Hacker Ethic. Not some self-righteous, over-simplistic clap-trap. -- more (91%) -- Here is truth. And if you can't see the truth, then there is no hope for you. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 11 of 447 Subject: And we'll all sail off into the purple horizon... From: pclip (Paper Clip) Date: Mon, 27 Jul 92 21:49:32 EDT Urrmmph....errrAgh...hah, hah....ooooooh! I'm becoming bloated with helium ideals.....uunngh...ah.....ooomf.....the lack of substance is causing me dire indigestion....wwauufg....eeeeffffth....PLEASE, JUST DON'T BREAK OUT IN THE NATIONAL ANTHEM......AAAAGH! (OOF...The Paper Clip) [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 12 of 447 Subject: Re: guilty? From: hotblack (Dana Watanabe) Date: Tue, 28 Jul 92 14:03:44 EDT michelle (Michelle Harris) writes: > > > I don't care if he's guilty or not... > > Isn't the the whole question of being on trail? That's what's supposed > to be the question. there are other things in life besides the law and the news and i dont even know what to say, its really amazing to read so many posts on here where people are shredding apart phiber and they dont know him and can just read some of his posts here, but most dont they just watch tv and read newpapers and come on here and insult him there have been some posts that looked like the person was at least responding to the phiber optik that one can see here on MindVox Mark Abene IS, a Person, you know.. that human being kind of thing -- more (34%) -- personally i cant say that i really care a lot about him i mean why should i? i've talked to him or anything much less get to know him/become friends but that doesnt mean that i would want to go insult him, especially since alot of these posts are done with phiber/mark being a third person type mention like he is not even reading the posts iean if you are going to insult someone, at least direct it to them as a human being i would hope that Mark gets a fair trial, ~~ now i also hope that he doesnt get so screwed up in the rpocess with a bunch of people who dont know him insulting him and and the media jumping down his ass and everything else that is happening just think about it, if you were on trial, for something you did or did not do, do you need all this extra shit pouring into your life?? most of this stuff has had NOTHING to do with whether or not he is guilty it has to do with this person that people do or do not like why i should have opinions about someone i dont know -- more (72%) -- boggles my mind, but posting them is even more amazing i know this has absolutely NOTHING to do with whatever forum this is in, but it seems to be the same thing in every forum all about one person, some people have been around each other for a long time and know a little bit more about the situation others are just jumping in but i just think that people need to realize that going to court isnt really a fun thing, having the media an d everyone else in public trying to crack down on you is much of a happy happy joy joy situation either dont just think about who you are talking to think about what you are saying and how they will recieve the message or whatever i dont know... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 13 of 447 Subject: Wow! From: wtap (Wire Tap!) Date: Tue, 28 Jul 92 15:49:04 EDT That last post was the biggest run-on sentence I have ever seen! Whew! Incase you have not figured it out yet, I think it is quite obvious Mark will not get a fair trial. When you are up for guilt by association, few things are fair. But with the media attention this is getting, some good will come. The public will not stand for a gross manifestation of injustice no matter what the instance. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 14 of 447 Subject: Run ons From: hotblack (Dana Watanabe) Date: Tue, 28 Jul 92 16:12:35 EDT yeah it was kinda run on ish to get the full effect you have to read it like i wasnt taking breaths all to often either :) kinda that exasperated sound and i know he wont get a fair trial, i dont think anyone in hte US really does the guilty might get punished with desrving punishments and the innocent may all go free (hahahahaha) but there still are MANY unfair things about the system especially who doesnt go to jail or to trial and things like getting more severe punishment for having a couple sugar cubes of LSD than selling heroin stuff liek that but that is another forum [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 15 of 447 Subject: wtap! From: phiber (Phiber Optik) Date: Wed, 29 Jul 92 02:37:17 EDT A "gross manifestation of injustice"... had your thesaurus out for that one, eh? Between your convoluted comment, Mr. Tap, I think more importantly is that in our society it doesn't matter to Uncle Sam WHAT "the public will stand for". If you're railroaded in a crooked trial and sent up the creek, the public may complain, but that won't do very much to get you out of jail. I have no desire to be a martyr behind bars, I just want to go on with my life. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 16 of 447 Subject: Trial From: michelle (Michelle Harris) Date: Wed, 29 Jul 92 03:16:59 EDT Mark? That's you Phiber right? If you have a lawyer which I assume you do and are going to court and you're innocent, what makes you think that you won't be found innocent and freed? Courts try to put guilty people in jail, not lock up people who haven't done anything! I don't know anyone who is in much trouble, besides the usual stuff people get in trouble for like drugs and wrecking a car or something, but doesn't the legal system work for you too? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 17 of 447 Subject: woof! From: phiber (Phiber Optik) Date: Wed, 29 Jul 92 03:26:18 EDT Whew! I'm not gonna touch that one. Anyone? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 18 of 447 Subject: Re: woof! From: hotblack (Dana Watanabe) Date: Wed, 29 Jul 92 12:47:43 EDT phiber (Phiber Optik) writes: > Whew! I'm not gonna touch that one. Anyone? umm... (im really hesitating here) i really like to be a nice guy, dont like being mean or anything like that but it does need to be pointed out that the legal system in the United States and the rest of the world does not work, why? because the people in power control the people in the legal system (or the other way around) and it becomes more of a matter of what one person wants done or a group of people think that the laws should mean rather than guilty people going to jail and innocent people going free the problem is that it is not just the trial and what goes on in the court room that counts, its whats in the news paper -- more (55%) -- can you get a jury that has no previous bias? no, so the attourneys argue and stuff adn try to get the jury that is biased in their favour that and when it is a criminal trial, the DA sets precendence on trials that will be more likely to get him a higher political position and when politics enter the court room, which they do all the time ESPECIALLY over ground breaking trials like this one then there is no justice, just politcal machines in action have you ever stopped to think that even if you are innocent its not really great to be arrested thrown in jail have to pay bail and go to court and hope and pray that your lawyer isnt really an imbecile and waste all this time just to prove you are innocent? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 19 of 447 Subject: another thing... From: phiber (Phiber Optik) Date: Wed, 29 Jul 92 18:20:27 EDT On a more personal level, have any of you ever had a gun pointed at your head? How about two guns, in the bed you sleep in, in your own home, by two complete strangers, accompanied by 10 others? No, you say? Well, believe me, it does wonders for one's faith in the justice system. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 20 of 447 Subject: Gunz... From: wtap (Wire Tap!) Date: Thu, 30 Jul 92 00:15:46 EDT I have always found that to be the most inappropriate and insane action by any law agency. I was once at a meeting of the New York Personal Computer Users Group. I believe if memory serves me, Phiber was on the panel, along with Donald Delaney, Katie Hafner, Mike Godwin, and Emmanual Goldstien. After all sorts of hissing and booing by some of the audience (which, mind you was completely uncalled for on account that it began the second Phiber began to answer a question. I think he had said "the reason tha..." when he was interrupted) one hacker in the crowd took a bold step and stood up and asked Mr. Delaney (who is member of the New York State SS or something similar): "How do you justify the use of a shotgun in apprehending a 14 year old 95 pound kid?" Delaney's response was: "I know of the case of which you speak . In the case of , the shotguns were not drawn. Only after the convolutions of the youngster's mother were they drawn in hopes they would calm her down. I do not need to justify what didnt happen." -- more (74%) -- Or something similar. The shotguns were NOT drawn according to Delaney, but WERE drawn according to the busted hacker. In fact, they were drawn on him as he was emerging from the shower, buck naked, dripping wet. I would tend to believe the hacker. Stories of shotuns drawn and Clint Eastwood look alike SS man are commonplace. Something is very wrong. That alone should eliminate all doubt that this doesn't happen. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 21 of 447 Subject: Re: Gunz... From: johnb (John Barclay) Date: Thu, 30 Jul 92 03:41:32 EDT wtap (Wire Tap!) writes: > Or something similar. The shotguns were NOT drawn according to Delaney, > but WERE drawn according to the busted hacker. In fact, they were drawn on > him as he was emerging from the shower, buck naked, dripping wet. I would > tend to believe the hacker. Stories of shotuns drawn and Clint Eastwood > look alike SS man are commonplace. Something is very wrong. That alone > should eliminate all doubt that this doesn't happen. I've seen quite a few Secret Service agents and none of them looked quite like Clint Eastwood. A closer description would be Ralph Kramden's body with Yul Brenner's head. Working for the SS isn't a glam job, and it shouldn't be a shock that they go on raids with their guns drawn. If you were assigned to keep track of crazies threatening the president and had to bust counterfeiters and smugglers you might not be so skeptical of taking precautions. We know from day to life in the Big Apple that Fourteen year old kids can be just as dangerous as Forty year old men. Zod committed some very serious felonies while infiltrating very important _military_ sites and that alone justifies _preparing_ to use force. -- more (49%) -- I don't know which NYACC meeting you were at but I've been to several. The only one I was at which sounds like the one you describe featured a panel with Mike Godwin of the EFF, Donald Delaney of the New York State Police and Bruce Fancher (dead) of hacker / MindVox fame. The draw of those three names filled the auditorium with people. Godwin and Delaney did their usual speil which is deadingly familiar by now. The only _really_ interesting speaker was Fancher, who did a better job articulating his viewpoint than the usual suspects who show up at these sort of things. If he keeps making speeches like that, then he is bound to draw a _huge_ ammount of attention to himself and MindVox. I just hope that finally having someone charismatic enough to get people to listen will wake up the public and opinion makers to whats going on. It's too late in the game for us to be trotting the same tired old brand new crop of fifteen year old felons every time a reporter come around for a "Hacker" stroy. Fancher and Kroupa are the new Voices we need -- and they may be the only ones who synthesize the seductivness of the Underground with the solid real-world accomplishments needed to be taken seriously. Whether or not this comes to pass I can't say, but if nothing else Fancher's speech was a welcome change from the usual whining Hacker monotone. -- more (97%) -- Keep the Faith. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 22 of 447 Subject: Actually... From: phiber (Phiber Optik) Date: Thu, 30 Jul 92 05:37:24 EDT ...just knowing how strange "zod's" parents were, I wouldn't be too sure who to believe. First of all, it's well known that his mom sort of thought that they were the "Manson gang", "coming to kill her and her family". A normal assumption, no? Secondly, judging by the frequency at which "zod" told the truth half the time, I wouldn't be so quick to believe. And lastly, Delaney arrested me in Jan 1991. No guns (certainly not shotguns), and I'm a bit bigger than "zod". Cuffs though, there were cuffs. And don't forget, the idea of shotguns to sustain a 14 year old naked kid sounded just scrumptious to the media. Also, the majority of individuals in my home in December were from the FBI, not the SS (only a couple SS), and if you've ever been at the Marshall's office, it appears that they ARE in it for the glamor and glitz, at least some of them from their suits and slicked hair-cuts (and attitudes). And attitude was no stranger, one December morning... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 23 of 447 Subject: COmputer Busts From: hotblack (Dana Watanabe) Date: Thu, 30 Jul 92 14:53:08 EDT just curious about this... a friend of mine was busted by a law enforcement agency (i dont know which one) but was never charged or anything they just kinda took his computer full of GIF files and probably just go into the back room and stare at naked women for awhile but anyhow... i was curious about arrests that you have been in or heard of (preferably first/second hand info, not fourth, but rumours can be funn) what time did they decide to stop by, how many people what type of guns...etc etc did they keep the equipment what charges another question, when they confiscate it, does it go up for auction or what? -- more (88%) -- cuz usually they are taking nice systems and i wouldnt mind pickone up :) [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 24 of 447 Subject: You ain't seen nothin' yet.. From: thug (Murdering Thug) Date: Thu, 30 Jul 92 17:35:16 EDT Just saw a preview ad on NBC, during the Olympics. It seems that around August 15th, a new show will hit prime time. The name of the show? "Secret Service" - Defenders of Justice Nifty eh? From the preview clip, it appears to be filmed in the style of Fox's "Cops", although maybe it's re-enactments as well. I wonder if they will show any "hacker" busts on that show. No one I know (with the exception of Hollywood Hacker, but I don't know him) who has been raided has seen any film crews coming in with the SS, so I assume that if this new show has anything about hacker busts, it will likely be either re-enactments or "fresh new busts especially for TV". Gee, I can't wait.. I'd like to see the re-enactment of Zod's raid on TV, with the kid from Dougie Howser plaing Zod, and Rosanne Barr as his mom, and Tom Arnold as his dad. -- more (82%) -- Mark, by the way, you really should trademark the name "Phiber Optik" so that if this "Secret Service" television show does a piece on you, you can at least sue for royalties. Murdering Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 25 of 447 Subject: Oh, this and that... From: wtap (Wire Tap!) Date: Thu, 30 Jul 92 23:43:52 EDT Mark, definately TM your handle. It could be worth millions. As for Zod, I don't know him too well, and surely didn't know he was a big teller of untruths. But judging the SS (or FBI or whatever) against Zod, who would you likely believe? The person you know better which in my case was Zod. But even if Zod was somewhat tailoring the truth about the shower incident, Delaney did admit there were guns involved. And they DID know what Zod looked like, because it was later revealed that he was taped at the all infamous 2600 meetings. And from that I understood, the system which Zod penetrated was an IBM PC/AT running Zenix with Wordperfect in .login to start immediately on login! Maybe the facts are incorrect, but they can't be that far off. It seems to have been FAR from a top secret missile trajectory calculation supercomputer. Cops is a damn good show. Get to see all the Police brutality right in your own home! [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 26 of 447 Subject: WELL... From: phiber (Phiber Optik) Date: Fri, 31 Jul 92 02:18:32 EDT It certainly wasn't an "IBM PC/AT" running "Zenix" (Xenix?), but on the other hand, it certainly wasn't a supercomputer used for figuring missile trajectories either. But it was a computer, and it belonged to the Air Force, and was related to that funny, zany, five-sided building. I'm sure your "facts" are nothing more than well-circulated gossip. But the bottom line is that guns are unnecessarily used way too often, as tools of fear and violence in such cases. Whether people believe it or not. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 27 of 447 Subject: Felonies? From: emmanuel (Emmanuel Goldstein) Date: Fri, 31 Jul 92 04:38:06 EDT Someone posted a while back that Zod committed some serious felonies while hacking around various systems. I find that very hard to believe unless you buy into the notion that hacking itself is a felony to be dealt with in the same manner as theft or even violent crime. We are currently engaged in a very real war of terminology; the authorities wish to make hacking synonymous with crime. Judging from what a lot of you are posting, they've made a lot of progress. I stand by what I've said in the past: hacking is healthy ansd beneficial. It also happens to be a part of human nature and I don't take kindly to any attempt to manipulate my values, particularly when the threat of force is involved. When you hold up something like credit card fraud and make it analogous to hacking, you're falling right into their trap. Raids and indictments will make all the headlines, but the most important and vulnerable part of this whole thing will always be our values. I think we'd better start doing a better job of defending them. Nobody else will. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 28 of 447 Subject: 2600 News From: emmanuel (Emmanuel Goldstein) Date: Fri, 31 Jul 92 21:35:38 EDT The summer issue of 2600 has been released. Subscribers should have it no later than the early part of next week. Included within is the latest on Bellcore's lawsuit threat against us, as well as a complete guide to the different kinds of telephone signalling systems used throughout the world (written by a real heavyweight in the phone phreak world), a review of the Dutch demon dialer, a tutorial on "portable hacking", tips on defeating call return (*69), a guide to voice mail hacking, plus letters, news updates, revelations of an interesting nature (more Bellcore stuff) plus a whole lot more. On Friday, August 7th, we'll be having meetings in six American cities. We expect all of these meetings to continue on a monthly basis. Please spread the word. NEW YORK: Citicorp Center (between Lexington and 3rd) downstairs in the lobby by the payphones. Payphone numbers: 212-223-9011, 212-223-8927, 212-308-8044, 212-308-8162. WASHINGTON DC: Pentagon City mall. -- more (43%) -- CHICAGO: Century Mall, 2828 Clark St, lower level, by the payphones. Payphone numbers: 312-929-2695, 2875, 2685, 2994, 3287. ST. LOUIS: At the Galleria, Highway 40 and Brentwood, lower level, food court area, by the theaters. LOS ANGELES: At the Union Station, corner of Macy St. and Alameda. Inside main entrance by bank of phones. Payphone numbers: 213-972-9358, 9388, 9506, 9519, 9520, 213-625-9923, 9924, 213-614-9849, 9872, 9918, 9926. SAN FRANCISCO: 4 Embarcadero Plaza (inside). Payphone numbers: 415-398-9803,4,5,6. There is no agenda at a 2600 meeting, no formalities of any kind, no dress code (except maybe in St. Louis), and no constraints other than common sense. People generally get together, trade information, meet people, look for feds, and do whatever else comes to mind (all legally, of course). Each meeting runs approximately from 5 pm to 8 pm local time on the first Friday of the month. Anyone wanting to organize a meeting in another city should contact 2600 at our office: (516) 751-2600. Our voice mail system is now a voice bulletin board system every night beginning at 11 pm Eastern time. You can reach -- more (87%) -- it at 0700-751-2600 through AT&T. If you're using another long distance carrier, preface that number with 10288. It costs 15 cents a minut and all of the money goes to AT&T. Whoopee. Permission is hereby granted to repost this message with the intention of spreading news of the above. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 29 of 447 Subject: Re: Phiber and Zod From: wtap (Wire Tap!) Date: Sat, 01 Aug 92 00:58:54 EDT Zenix, Xenix, Yoonicks, Vhee-Em-Ese, Wahful, whats the difference? But it most certainly was gossip, but the point was to prove that guns are indeed as you said used as an intimidation tactic. I don't see why they even put cuffs on you in the first place. Probably another intimidation tactic. All of this crap, mind you, I am sure is carefully thought out to make it look like a) The Feds know what they are doing b) make you sure you know that you did some serious shit, no matter how miniscule it was. I wonder if they stake out the house of a software pirate, bust in with an M-16 and bullet proof vests, and wrestle him to the floor whilest he is in his pajamas, all the while his computer is busy PKUnzipping the newest release from Epyx. Makes you wonder, eh? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 30 of 447 Subject: wtap From: cudigest (Jim Thomas) Date: Sat, 01 Aug 92 14:29:12 EDT For those who think Phiber exaggerates his description of a "hacker" bust as a dangerous para-military exercise, I have a tape of the "Hollywood hacker" invasion. The "HH" was a middle-aged guy who was alleged to use a friend's password to snoop through the computers of a competing tv-tabloid (Entertainment tonight) to be sure they weren't scooping him. The tape shows LE types busting in one morning screaming and with guns drawn on one very surprised middle-aged dude. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 31 of 447 Subject: "Hollywood Hacker" From: phiber (Phiber Optik) Date: Sat, 01 Aug 92 20:39:05 EDT I met the "Hollywood Hacker" in California last year, that same middle-aged guy, at CFP in San Francisco. The only thing that was evident to everyone was that his "raid" was a media engineered sham, in light of a feud between two tabloid TV shows, one of which he was in the employ. It's a bad example. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 32 of 447 Subject: Re: "Hollywood Hacker" From: cudigest (Jim Thomas) Date: Sun, 02 Aug 92 01:49:55 EDT Phiber notes that the "hollywood hacker" is a bad example of hacking. To elaborate just a bit, the "HH" wasn't actually a hacker, but the media snarfed it up with some major drama in the LA papers to portray the dread hacker menace, and the drama created a false reality that fed the prosecutor's frenzy. The truth is that Stu barely knows a hard drive from a 4-wheel drive, and Unix are guys lacking hard drives. But the media images shape the way LE types focus their investigations and write up indictments. Sadly, bad examples have influenced legislation and investigation. People like John Markoff of the NYT and John/Barbara McMullen of Newsbytes should be credited with their aggressively responsible and fair-minded attempts to counter distortion. -- more (79%) -- ^G Get Help ^Y Prev Pg ^K Del Line ^C Cur Pos ^X Exit ^J Justify ^W Where is ^V Next Pg ^U UnDel Lin^T To Spell SNAPSHOT 3 VT100 3 FDX 3 2400 N81 3 LOG CLOSED 3 PRINT OFF 3 ON-LINE [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 33 of 447 Subject: Follow up from trajectory From: tonyd (Anthony Desjardin) Date: Sun, 02 Aug 92 16:08:24 EDT Patrick: I respect your opinions and am not saying shit against you. I think what you and Bruce are doing is something that needed to be done and you guys are doing a bang up job. I will lay off Phiber if you want me to, but that's the only reason I'm doing it. You can make me change my opinion of him for about as long as it takes him to open his mouth again and reinforce to me why I think about him the way that I do in the first place. You can't save Phiber's rep short of gluing his mouth shut and speaking every word he says for the rest of his life. You're not going to make people like him, you might make them tolerate and put up with him, but he's the one who is going to have to do the rest. Phiber: 1000's of people doing what? Ranting on TV about how they can crack any computer system in the world? What is it that you're doing that is so invaluable to society? Don't attack me, tell me. I don't see it, please explain it to me. -- more (72%) -- All I ever hear from you is the same tired shit Stallman was saying 15 years ago. It's not valid anymore. Somewhere up there you wrote, who's gonna give me $800 for a computer? I don't know, why not get a job, the world doesn't owe you a computer. Since you seem to have a job along with more hardware than most people would know what to do with, what's your problem, or was it hypothetical? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 34 of 447 Subject: ? From: phiber (Phiber Optik) Date: Sun, 02 Aug 92 20:37:45 EDT Why not hypothetically get a clue already? I'm tired of the same old ignorance. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 35 of 447 Subject: Funny... From: czarina (Rita Rouvalis) Date: Tue, 04 Aug 92 16:59:55 EDT I find it strange for people to be comparing phiber and rms. I think of each as the templates for two different breeds of "hackers." Which isn't saying anything negative about either of 'em. But I hope you're more fun at parties than rms is, phiber. Cz. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 36 of 447 Subject: ... From: phiber (Phiber Optik) Date: Tue, 04 Aug 92 20:45:32 EDT You betcha! And, I wear SHOES. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 37 of 447 Subject: shoes? From: zachs (John Zachs) Date: Wed, 05 Aug 92 18:04:30 EDT Nobody can compare you with RMS anymore thats for sure! [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 38 of 447 Subject: Fruit & Fiber From: tonyd (Anthony Desjardin) Date: Wed, 05 Aug 92 19:31:14 EDT Yo Phiber... What the fuck is your message? You keep on talking about all this shit you do for people and how much society loves you an all, what do you have to say other then "I am ego, look at me on TV" I know a lot of dudes in college who are real quick, smart and not stupid enough to be all over TV. Mcmullen's ok, I've seen his stuff at some meets, right now he has a interesting monkey on a stick to rant about stuff, then later he'll have more stories to write when jail opens its doors, or Phiber gets lucky and walks. Phiber, lemme put it into your language, you're an asshole yourself, so stick it. with love, Tony -- more (96%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 39 of 447 Subject: i hate being hypocritical From: hotblack (Dana Watanabe) Date: Wed, 05 Aug 92 19:55:15 EDT but once in awhile you have to i dont know how to tell people to stick to the subject of the forum without leaving the subject of the forum BUT... what does Mark Abene's or Phiber's personality/ies have ANYTHING to do with the ethics of hacking and its relationship to cyberspace????????????????????? i dont care whether or not you know mark personally so that you can actually have the ability to call him an asshole but if you know what e-mail is, then feel free to use it if you dont.. then you dont even deserve to be talking about hacking im just really sick of seeing in every forum one or two people lambasting ONE person and then some other defending him, when it has nOTHING TO DO WITH ANY OF THE GODDAM SUBJECTS!!! -- more (67%) -- maybe there should be a 'Is mark an asshole?' forum but i dont think it matters any one single damn bit to society as a whole nor will it be a demonstration of the useful exchange of information this system is supposed to be built around not that i want any of these forums censored or moderated or anything like that i just want people with brains to amke posts and people without them to stay at home and watch tv [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 40 of 447 Subject: Re: i hate being hypocritical From: falconer (Steve Copold) Date: Wed, 05 Aug 92 20:59:59 EDT hotblack (Dana Watanabe) writes: > i dont care whether or not you know mark personally > so that you can actually have the ability to call him an asshole > but if you know what e-mail is, then feel free to use it > if you dont.. then you dont even deserve to be talking about hacking > > im just really sick of seeing in every forum one or two people lambasting > ONE person and then some other defending him, when it has > nOTHING TO DO WITH ANY OF THE GODDAM SUBJECTS!!! Enormous dittos!.....Censorship sucks, but this crap all belongs in a RAVE or FLAME forum. In here I'd like to read about (at least most of the time) hackers issues and not CANNIBALISM! Falconer [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 41 of 447 Subject: Re: ... From: strat (Bob Stratton) Date: Wed, 05 Aug 92 22:04:15 EDT phiber (Phiber Optik) writes: > You betcha! And, I wear SHOES. > ...and you're a hell of a lot easier to go to restaurants with... --Strat [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 42 of 447 Subject: Re: yo yo YO! From: cudigest (Jim Thomas) Date: Sun, 28 Mar 93 00:35:28 EST In-Reply-To: Judge Spark's decision in the SJG suit demolished Foley and the Govt's seizure warrants. The ruling indicated that the USSS erred grossly, and Foley was singled out for especially strong condemnation. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 43 of 447 Subject: bottom line... From: phiber (Phiber Optik) Date: Thu, 06 Aug 92 05:14:39 EDT This is an argument that will probably go on forever and no one will ever agree on, but I maintain that had it not been for certain ethical and wholly moral activities which were misconstrued and termed "illegal" in the past, I would not possess much of the knowledge I do. People who know me, know that I take great pride in educating people on the subject of "how things work", and I go great lengths in my private studies to make sure the information is technically accurate when I present it. Most often, technical information which may be publically available is simply out of the reach of most people, or the information simply isn't in a form they can understand. I enjoy explaining things, when I feel that the listener is genuinely curious and fascinated by the subject, and does not intend on milking information to use for illicit or destructive purposes. I believe that technological knowledge should be available to anyone who wants to learn about it to use it and build upon it in a positive way, to educate others, and to ultimately improve the world around us by moving onwards and upwards. In an increasingly computerized society, it becomes more and more important to the point of becoming almost mandatory that people should understand the technological world around them. And certainly, if -- more (60%) -- they really STRIVE to know, as so many people do, there should be no barriers. I got back from the "Off the Hook" radio show with Emmanuel Goldstein a few hours ago, and it's clearly evident from the callers that there is a growing concensus who have a genuine curiosity to know and understand. Punishing people's insatiable thirst for knowledge is rather backward, if not blatantly ridiculous. But as long as there exists a will to stamp out an entire subculture, a will fueled by ignorance, hate, and obvious abuses of power by certain law enforcement types and corporate entities, there will always be problems. The bottom line is that more and more, people everywhere want to know how things work. What makes things tick. To UNDERSTAND. And all too often, those who want to show the way get caught up in scandalous persecution. It's the way things are, and we need to do something about it. And people are trying. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 44 of 447 Subject: HakKing is BAD From: digital (Patrick K. Kroupa) Date: Thu, 06 Aug 92 15:16:34 EDT "Is it ethically ok to access computers that don't belong to you?" That's a very un-answerable question since it will vary greatly from one individual to the next. You'd have to define "ethical" first and then make sure that everyone involved adhered to the same interpretation of the word, and then give everyone a BIG COLORFUL BADGE that says "AUTHORIZED" and follow it all up with a firm handshake looking deeply into their eyes and saying "I love you" and . . . umm, where was I, oh yeah.... It is my personal belief that NO ONE has the RIGHT to access any computer, network, device, or place; virtual or physical, that does not belong to them, or where they have not been CLEARLY invited by the owner's or representatives of same. If EVIL SUPER-BAD MEGACORP has 24 Connection Machines accessible via local dialup, and the root password is "abcdef" you still do not have the "right" to access their machines, much less take any sort of action against them. -- more (29%) -- But ya know, there's right and wrong, good and evil, anthracite and puce, and then there's stupidity. While you have the absolute right to take a new Ferrari, leave the keys in the ignition, the window rolled down, and park it in Harlem.... there's this wonderful thing called COMMON SENSE that says, "Gee ya know... that may not be a very good idea!" Computer security is very similar to that. While I know a lot of people who, um... look at things... and very few of them have any sort of harmful intentions, much less interest in the data they gain access to... I also trust their judgement about as much as I trust the average 6th grader's. They don't mean any harm, none-the-less it certainly isn't helpful to me for anyone else to have access to MY PERSONAL JUNK. What I'm finding more and more, is people who have sensitive material on their computer, just aren't hooking them into networks. As an example there's my father, and a lotta his friends. They have contracts with the government and various military agencies, they have a lotta stuff on their machines that is considered "classified" or sensitive. Their solution to security, is purely physical in most cases. They don't know much about Unix, and they don't wanna know, they don't read news, or want to get email from people, they just don't bother to plug their personal machines into the ethernet. -- more (65%) -- The only way to get at its contents is to physically steal the thing. When you're running simulations or something that is extremely processor intensive, then obviously it has to go on other machines, or over networks, but for the most part, what's really "sensitive" is just information that isn't meant to be publicly accessible. What comprises "sensitive" material varies greatly, company X's SUPER NEW ULTRA-SECRET THREE WEEK PLAN, is probably of interest to nobody, except COMPANY Y who is in competition with 'em. All things are relative; right now the attitude is that people find this lack of "security" scary, so they run around in little circles, call up various law enforcement agencies, who in turn grab their guns and kick in doors and make a big fuss over it. When people are scared, they tend to do silly things. People ARE *VERY* afraid right now, of a lot of things in general, and this is one area in which fear can be very effectively channeled and focused on THE BAD GUY, who in most cases is represented as some teenager who is personally responsible for EVERYTHING wrong with their lives in general, and their computer's in particular. -- more (95%) -- None of it bears any relation to reality, but then again, neither does life most of the time. Patrick [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 45 of 447 Subject: Maybe... From: phiber (Phiber Optik) Date: Thu, 06 Aug 92 21:03:51 EDT Sometimes when I think about it, three words come to mind: Peter Pan syndrome. I think psychologically, some agents are living out some boyhood fantasy to become Captain Hook, and foil their own private Peter Pans. The only problem is that this fantasy is trapped in the mind of grown men, and overlapping into real life, where it's being played out at the expense of many younger people. It's kind of sad, actually. Just a thought... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 46 of 447 Subject: Re: Maybe... From: johnb (John Barclay) Date: Fri, 07 Aug 92 01:05:37 EDT >phiber (Phiber Optik) writes: > Sometimes when I think about it, three words come to mind: > Peter Pan syndrome. I think psychologically, some agents are living out > some boyhood fantasy to become Captain Hook, and foil their own private > Peter Pans. The only problem is that this fantasy is trapped in the mind > of grown men, and overlapping into real life, where it's being played out > at the expense of many younger people. > It's kind of sad, actually. > > Just a thought... Yeah and maybe it's the Hackers who never want to grow up. Seems to me Captain Hook was the Adult role in Peter Pan. And if I remember correctly he was always being thwarted by Peter's pranksterish tricks. You don't look anything like Sandy Duncan, do you Phiber? -- more (95%) -- Green Tights Anonymous [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: h? elp  MindVox [HELP] Section ___________________________________________________________ | | | Help - General Information on System Commands | |___________________________________________________________| | | | Archives - Detailed Information on Using the Archives | | Chat - Explanation of the Chat System Commands | | Forums - Complete Instructions for the Vox Forums | | FTP - How to Use Internet File Transfer Protocol | | Gateways - How to Send Mail to Various Networks | | Home - Setting up Plan, Login, and other Features | | IRC - Crash course on using Internet Relay Chat | | Jove - Documentation on Using the Jove Editor | | Mail - Using the MindVox mail system Capabilities | |___________________________________________________________| | | | QUIT - Exit Help and Return to Previous Menu | |___________________________________________________________| -- more -- [Topic]: [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 47 of 447 Subject: Pan... From: phiber (Phiber Optik) Date: Fri, 07 Aug 92 01:28:23 EDT Sandy Duncan? Not at all. Forget the whole thing, Cap'n. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 48 of 447 Subject: Uh . . . no From: dead (Bruce Fancher) Date: Fri, 07 Aug 92 02:41:04 EDT To paraphrase a Douglas Adams: Mark looks almost, but not entirely, unlike Sandy Duncan. I think you're the one trapped in adolescence johnb, Mark is a stamped, certified adult. Llamas!!!! [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 49 of 447 Subject: Hacking From: zachs (John Zachs) Date: Fri, 07 Aug 92 13:03:14 EDT Hehehehehe, Digital and Phiber posted almost the same thing to answer that question and neither one of them said yes or no. It sounded a lot like maybe but it all depends! Personally I agree that it would all depend on a lot of things, but Patrick pointed out that you never have the "right" to access systems that you don't own and Phiber pointed out that if he hadn't done things that were "ethical, moral but illegal" that he wouldn't know what he knows today. Why is that? Why couldn't you learn what you guys want to without accessing things that aren't yours? I'm surprised almost that both of you said the same thing, but what exactly does it mean when you can't get knowledge legally from school? The Zach -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 50 of 447 Subject: Hacking, Ethics 'n' Me From: chrmsync (Craig Stockwell) Date: Fri, 07 Aug 92 19:05:50 EDT Anyonee desiring privacy shouldn't open their files (via LAN or PacBel) for access. Anyone who wants to share with some people should expect curiosity from others (non-destructive hackers). Any company *dumb* enough to put 'SECRET PLANS' online should expect someone will have a look-see; therefore, sensitive material should be local to one CPU at a time (i.e.: the peron(s) working on the project). And yes, I'm all for telecommuting, but just as a Hughes Engineer would not go to lunch at McDonald's to work on 'prints, nor should teleworkers work on sensitive projects where there is open access. The govenment invades our privacy all the time (esp. the IRS - my income is my own business). I guess maybe I'm a ranting limited constitutional anarchist cross free market libertarian. "Information wants to be free." Besides, big business can benefit from hackers, working on security against other hackers [anyone else remember Bill Landreth in San Diego?] -- more (89%) -- Chrome Sync PS: How old are you, phiber? [to make it a fair 'trade of info', I was born in the 60's] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 51 of 447 Subject: Hacking is Illegal and Immoral From: hotblack (Dana Watanabe) Date: Fri, 07 Aug 92 19:23:47 EDT All people who trespass on other people's systems (explore the system w/o expressed permission, either written, spoken, or typed) should be thrown in jail and fined. simple thats it go home [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 52 of 447 Subject: Re: Hacking is Illegal and Immoral From: hotblack (Dana Watanabe) Date: Fri, 07 Aug 92 19:25:16 EDT hotblack (Dana Watanabe) writes: > All people who trespass on other people's systems > (explore the system w/o expressed permission, either written, > spoken, or typed) should be thrown in jail and fined. now... just some questions what is someone elses system and how can i really be on it? i mean.. seriously.. am i physically doing anything to their property? yes i guess i am causing motors to run and hard disk things to read nad etc but how illegal can that be? information wise, is a computer or bbs really liek someones house? it certainly isnt public property, but how private is it when someone leaves a modem attached on answer mode? -- more (49%) -- you cant get arrested for breaking and entering someones home if the door is unlocked and open but i can see how a password file would be like a door lock but should the connection really be that strong? i dont know... im jsut rambling but i would like to know what hackers or at least the hackers who read this post, would like the laws to be not what are they, but should they be? right now we have a bunch of laws made up by people who couldnt tell the difference between a sparc staion and a gas station so should the laws be different? or are the laws fine is it just the way the law enforcemnt people or the da's office crack down on hackers that is bad?// excuse this post its 4:40 on a friday afternoon and i am ready to go home but i know someone is going to call in in a few minutes and tell me that their router blew up or something like that [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 53 of 447 Subject: Re: Hacking, Ethics 'n' Me From: falconer (Steve Copold) Date: Fri, 07 Aug 92 21:34:06 EDT chrmsync (Craig Stockwell) writes: > Anyonee desiring privacy shouldn't open their files (via LAN or PacBel) > for access. Without adequate security, this is truue. > Anyone who wants to share with some people should expect curiosity from > others (non-destructive hackers). Yeah that's true, but it doesn't mean that I shouldn't ensure that my system has enough security to be sure that your curiosity will not be satisfied regardless of your savy or your hacking skills. If you get in then that means someone has failed to do their job properly. If you get caught attempting to break in and there is reasonable proof then you should be prosecuted. ># Any company *dumb* enough to u!put 'SECRET PLANS' online should expect -- more (47%) -- > someone will have a look-see; therefore, sensitive material should be > local to one CPU at a time (i.e.: the peron(s) working on the project). > And yes, I'm all for telecommuting, but just as a Hughes Engineer would > not go to lunch at McDonald's to work on 'prints, nor should teleworkers > work on sensitive projects where there is open access. This much is all true.....But if you go beyond ANY OBVIOUS SECURITY MEASURE, THEN YOU ARE WHERE YOU HAVE NO BUSINESS BEING! > The govenment invades our privac]y all the time (esp. the IRS - my income > is my own business). > I guess maybe I'm a ranting limited constitutional anarchist cross free > market libertarian. > "Information wants to be free." You're right this is Libertarian bullshit...Our machines have no DOD type security problems, but what about personnel files? What gives you the right to do what you've just condemned the govt. for doing? Hypocrisy, my friend, smells like dogshit and right now I've got a nose-full. Falconer [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 54 of 447 Subject: La Differance From: chrmsync (Craig Stockwell) Date: Fri, 07 Aug 92 23:44:32 EDT The government looks at my income . . .. something I wouldn't put online. A BBS is quite different from a wallet, my foul-smelling friend. Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 55 of 447 Subject: Re: La Differance From: falconer (Steve Copold) Date: Fri, 07 Aug 92 23:49:02 EDT chrmsync (Craig Stockwell) writes: > The government looks at my income . . .. something I wouldn't put online. It's nice that you have a choice... > A BBS is quite different from a wallet, my foul-smelling friend. And also very different from a corporate or govt. system. A BBS is private, the others are not. If you choose to allow your system to be hacked, that's your business. If you try to hack my system, that's the govt's business.... :-) Falconer [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 56 of 447 Subject: ... From: phiber (Phiber Optik) Date: Sat, 08 Aug 92 06:09:21 EDT Know what I think? I think we need more libertarians on the system. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 57 of 447 Subject: Re: ... From: falconer (Steve Copold) Date: Sat, 08 Aug 92 09:27:45 EDT phiber (Phiber Optik) writes: > Know what I think? > I think we need more libertarians on the system. Probaably more of both wouldn't hurt...I think some definitions would help. Like what exactly is non-destructive hacking when you're on someone elses system. I think if you're in public areas (usually pretty well defined) that truly is non-destructive whether invited or not. I guess it's a POV thing...Most sysadmins could care less about serious security risks because they don't really have any to worry about...protecting employee's privacy is another thing. Chrmsync doesn't like the idea of the govt. having access to information about his income. If he's self employed or out of work, student etc., he may have that option...most of us do not. I'm not just talkin' about how much someone earns...That's often public info anyway, but rather how they spend it. What kind of insurance do they have, what's their phone number, where do they live? That's the type of stuff that should be protected. Why should I like the idea of someone -- more (45%) -- hacking into that data anymore than you like the notion of the govt. having access to personal info on an individual. What Chrmsync wrote that seriously pissed me off was the hypocritical notion that it was evil for the govt. to do this, but okay for him...IMHO it's wrong in both cases. Now, the prosecution comment...to me, prosecute does not automatically equal jail or huge fines...That is the worst form of simplistic thinking. If that is truly how the SS views things, then they should stop behaving like the Waffen SS and start acting like the US SS. I hate using the term, it's so friggin' trendy, but there has to be a way of addressing computer crime (yechh!) that's fair to the folks whose lives are entwined with the computer systems hackers access, and yet not put someone in jail for the electronic equivalent of repeated jay-walking offenses. It also MUST at some point make a difference whether a profit motive was involved. If someone turns a buck in this sort of thing then jail may indeed be appropriate. If no money changes hands, and no data is altered or destroyed then at some point compassion has to enter into the equation. Phiber, not everyone that is responsible for a system is a heartless bastard, many perhaps, but not all of us. What's needed is little bit of "middle ground" and this system look like a pretty good place to begin. Very little in life is black or white...It -- more (95%) -- often takes a few years and a lot of patience to sort it out... :-) Falconer [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 58 of 447 Subject: Re: Middle ground From: cudigest (Jim Thomas) Date: Sat, 08 Aug 92 17:18:38 EDT What falconer said. Let's first sort out the issues--what counts as criminal intrusion and what's passable as mere nuisance instrusion. Then, what are appropriate responses for various kinds of "computer crime." Like F said, that's a dodgy term, especially when sending a bit of unauthorized software across state lines can make one liable for federal charges of theft, ITSP, conspiracy, and wire fraud. The US is the leading imprisoner of its population, and the mentality that "hackers" (or any criminal, for that matter) deserves jail may be popular, but it's increasingly unworkable, unjust, unethical, and costly. Why invoke criminal procedings when civil ones can be as effective? Why invoke the judicial process at all? We, as a society, should be thinking about less formal responses to offenses rather than chucking the offenders in jail as if it's some magic cure. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 59 of 447 Subject: issues and education? From: black (Ronald Blackburn) Date: Sun, 09 Aug 92 00:35:37 EDT Soemthing I'm interested in knowing is what is he educational background and political affiliated of people on this place, Kroupa, Fancher, you guys run this place, Abene, what did you guys major in? This is one of the places it could go someplace, I really like the idea of the round table area and would like to get some good stuff going and invite more people to show up. When will the conferences work on this thing? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 60 of 447 Subject: background From: klarry (Larry Kessler) Date: Sun, 09 Aug 92 01:16:06 EDT What does policitcal affiliated have to do with anything? Education is something I'm interested in. If as has been claimed, you can't gain the skills you need in school, then it might be a obvious statement that something is wrong with the educational system that needs to get looked at. I'd also be interested in knowing the formal educational backgrounds of Kroupa and Abene and Fancher as well, what did you study and why do you feel it didn't help you reach whatever knowledge or experience you needed, or did it? The discussions taking place are steps in the right direction, I would also like to see more people taking part in this from both sides. THere have to be saner laws then those presently out there, there is a dividing line between intrusion, curiosity and intent to sell or profit from what someone is doing and the courts don't seem to be recognizing this right -- more (96%) -- now. Klarry [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 61 of 447 Subject: |\/|y th0+z From: vortechs (Vor Techs) Date: Sun, 09 Aug 92 04:16:08 EDT i believe that there is nothing wrong with maliscious hacking...it would seem that if someone was caught and hadnt actually destroyed or altered anything, and there was no evidence of them turning a buck by doing it that the company would be more greatful than suspicious...after all the Hacker pointed out a security flaw which could be exploited by someone much less nice. I believe that information is power, Ialso believe it should be widely available to anyone who wants it...power to the people. I know of several friends of mine who have illegally( in the laws eyes) gained access to various systems and used it to learn...they were never caught and are now in fact writing software for some of the same places they hacked. System access is not a right, but more of a privelege or ability (depending on how access is gained). I think that those who can successfully make it into a system without permission can teach all of us something, after all they possess knowledge that the majority of the -- more (94%) -- public isnt exposed to Hacking isnt a crime [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 62 of 447 Subject: ? From: phiber (Phiber Optik) Date: Sun, 09 Aug 92 06:13:35 EDT That's a rather simple-minded attitude. Of COURSE there's something wrong with malicious hacking! I don't think you're all too clear as to what MALICIOUS means. It means evil. Destructive. Detrimental. If someone REALLY hadn't damaged anything, they're not doing anything MALICIOUS. (And I don't want to see any wise guys saying, "Well, just you BEING there is damaging!" That's nonsense.) In fact, the words 'malicious' and 'hacking' don't even belong in the same sentence. And there's a hell of a lot more to hacking than defeating security. (So you got in... THEN WHAT???) This rather juvenile notion that by entering a system, you're somehow helping the sysadmin is silly. Does he WANT to be helped? Does he even CARE? Maybe, maybe not. Maybe he hates you for being there. In that case, he certainly doesn't want your help. Do you really expect anyone to believe that you enter systems because you intend to HELP them? Come on. That's more of an excuse than anything else. If you're there to LEARN something for yourself, because you have no other way to do so, that's different. Or maybe you're just curious. Or maybe you really are an evil, malicious, destructive person. -- more (67%) -- If you're going to do something, you sure as hell should at least know WHY you're doing it, and not make up some lame excuses. Because if you do something foolish and don't know why, some very angry people are going to end up TELLING you why. And you may not like their point of view, especially if what they think aren't really your own reasons. So make a choice: You can do foolish things and give foolish reasons for doing them, or you can act responsibly and explain your reasons sensibly. It's hard to argue with someone who has common sense on their side, although people tend to do it anyway. Good nite. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 63 of 447 Subject: Re: ? From: terminus (Len Rose) Date: Sun, 09 Aug 92 13:45:06 EDT phiber (Phiber Optik) writes: > That's a rather simple-minded attitude. Of COURSE there's something wrong > with malicious hacking! I don't think you're all too clear as to what > MALICIOUS means. It means evil. Destructive. Detrimental. If someone > REALLY hadn't damaged anything, they're not doing anything MALICIOUS. > (And I don't want to see any wise guys saying, "Well, just you BEING there > is damaging!" That's nonsense.) In fact, the words 'malicious' and > 'hacking' don't even belong in the same sentence. And there's a hell of a > lot more to hacking than defeating security. (So you got in... THEN WHAT???) > > This rather juvenile notion that by entering a system, you're somehow > helping the sysadmin is silly. Does he WANT to be helped? Does he even CARE > Maybe, maybe not. Maybe he hates you for being there. In that case, he > certainly doesn't want your help. I know from experience most administrators are so busy that they do not have all the time needed to make sure their systems are secure. From what I -- more (31%) -- have seen, on mosat sites, system admin tasks are secondary, the main being software development or network support. Some people I know are working 20 hours a day just to keep even. As someone pointed out earlier, the days of breaking into a system just because you wish to learn are over. You can obtain enough experience on Unix or networks by bringing up your own equipment at home or the office. Hell, I see used Suns going for $900 with hard disks and operating systems.. Or alternately you can obtain bsd 386 and bring something up on an Intel platform. If you are just plain flat broke, you can get accounts on public access systems or a account on a local internet site.. Of course I am speaking to people who already now of all this. Perhaps my words will have some benefit on the new wave of people who are about to see Mindvox for the first time. > Do you really expect anyone to believe > that you enter systems because you intend to HELP them? Come on. That's > more of an excuse than anything else. If you're there to LEARN something > for yourself, because you have no other way to do so, that's different. That excuse went the same way that "When they catch you, they'll hire you" -- more (60%) -- did.. I always despised people who were naieve to believe that. > Or maybe you're just curious. Or maybe you really are an evil, malicious, > destructive person. Curiosity is great. That is what hopefully spurs us all on. BUT .. I maintain that there is no need of doing anything illegal nowdays to satisfy that curiosity.... There are enough friendly admins on the internet to let you have a guest account. Then, with their knowledge and cooperation, sure go ahead, try to locate security problems. You get the same rush as always, just that it's legal then.. They you have helped them,you have done what certain people say they are doing "helping" ,etc,etc. So, what can I say.. it just doesn't wash anymore.. I give away accounts on any system I run because I know I cannot locate every flaw in my security.. I don't have the time. Then, when my friends point something out to me I am usually damned glad. > If you're going to do something, you sure as hell should at least know WHY > you're doing it, and not make up some lame excuses. Because if you do > something foolish and don't know why, some very angry people are going to > end up TELLING you why. And you may not like their point of view, > especially if what they think aren't really your own reasons. -- more (92%) -- Or you may not like their point of view because they are federal and don't even understand the difference between a good act and an evil act. It is so hard to find anyone in law enforcement who does understand the difference. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 64 of 447 Subject: Introductions From: cudigest (Jim Thomas) Date: Sun, 09 Aug 92 14:15:18 EDT Topic drift (in order to avoid topic drift)--the backgrounds of users isn't a bad idea to give us a better sense of where people are coming from. Besides satisfying morbid curiousity, it helps reduce flames and keep quality of posts/responses a bit higher. Why doesn't somebody start an "introdutions" conference? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 65 of 447 Subject: intros From: michelle (Michelle Harris) Date: Sun, 09 Aug 92 16:27:49 EDT Yeah that would be fun, lets get it going. Introductions! Without knowing exactly who is doing what, reading through this reads a lot like any other listing of things that happens out in the real world. There are people who are at some level of doing something that is above-average and how they use their abilities depends a lot on how they view the world I think. I haven't found anything that different between Patrick and Mark or Chris, at least not in the way they present themselves here. I can judge what Patrick does because I can read it and see what it is. I don't know what Mark or Chris really do because I can't see it, all I can see is them talking about it so its harder to see who's right or wrong, I'd think neither on is, Chris is just better at making people think he's a good guy. I also like long hair on guys, definite plus. -- more (93%) -- Jim Thomas is cool too, what do you do? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 66 of 447 Subject: INTroz From: doug (Douglas Luce) Date: Sun, 09 Aug 92 22:34:56 EDT I think the plan file is an appropriate place to put "intro" information. Patrick, bruce, phiber have theirs.... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 67 of 447 Subject: To hell with intros, let's philosophize. From: chrmsync (Craig Stockwell) Date: Sun, 09 Aug 92 22:58:44 EDT Consider the word philosophy: Greek from lover of\knowledge. Personally, I like having a buttload of data to view. And no, seeing people's bank balances doesn't send shivers of excitement to my extremities. Rather, I prefer having a large knowledge base. If I had unlimited funds, I might be happy going to college an awful long time. Hell, I've had three or four majors in my time at college (which is soon to conclude, one way or another). So, yeah, I'm curious. If I opted to hack these days, and I came across an unfamiliar system, I'd try to go in, and see what it is. I cannot seriously imagine myself deleting or altering data, however. I'll leave that to other, previous co-workers (journalists, to be precise) who used to hop into each other's files on our LAN (which I administered for a short while) and mess around to be 'cute'. [And yes, I wanted tighter security, but bosses will be bosses]. When it comes to privacy, which I view as a right [foremost: "Life, Liberty, and Property], consider this: Someone is sitting at home, curtains open, transparent windows, packaging coke. The police drive by. While they are in the privacy of their own -- more (54%) -- home, they are willfully leaving a venue through which to be freely observed. Now, how about if they have sheer curtains, that some people can see through? (I think you can draw the hacking analogy through). Then again, I *do* support the decriminalization of drugs [it's a property right: the right to depose of your own property in any way you see fit, provided it does not infringe upon another's right to Life, Liberty or Property]. Consider this: drugs were legal, and few problems existed with them. They were made illegal and ... [prohibition revisited]. And heck, let's flame (such peachy-keen jargon). I've often maintained, "I prefer someone with a brain and an opposite opinion to a no-brained, apathetic twit." I never take myself or anyone else too seriously (when it comes to arguments or debates). As far as intros: Yeah, I'm still a college student, I work part-time (and often for myself), was born in da sixties, like to drink, don't smoke or 'do' illegal drugs, and don't support cross-burning or flag-burning [but, again, that's Property rights for ya.] -- more (97%) -- Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 68 of 447 Subject: Argh From: cudigest (Jim Thomas) Date: Sun, 09 Aug 92 23:37:21 EDT Jeez, between you and bandwith, Michelle, I'm really sorry I cut my past-shoulder length ponytail. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 69 of 447 Subject: yeh yeh From: vortechs (Vor Techs) Date: Mon, 10 Aug 92 00:27:40 EDT I understand the meaning of maliscious just fine, but thanks for a definition. Ack, tho in glancing over that post i believe i should have separated first line and lines following...i would support any form of hacking...but i dont think that non-maliscious hackers should be punished if you are caught destroying data then sure you are guilty of a crime , but if you havent destroyed/altered(and other such words) anything then you shouldnt be prosecuted...if there are known security holes and they havent been fixed even after the sysadmin knows about them, then it is more the SysAdmin's fault for whatever happens than the hackers...tho im not saying if a system is wiped out because someone snuck in and wiped it clean that the Administrators are to blame. How can you blame someone for curiosity...there is a reason that someone doesnt want you looking at special papers-why? I didnt mean to make it sound as an excuse for getting caught but i do believe that if there is a way for SysAdmins to watch and see how others gain access to their systems then they should at least take notice and try to correct the problem...i would never think a hacker would get a job -- more (87%) -- because he hacked into a system and was caught , im sure the SysAdmin hates you for being there if he didnt willingly grant you access. -Vort -he who is bored most often [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 70 of 447 Subject: ... From: phiber (Phiber Optik) Date: Mon, 10 Aug 92 00:44:13 EDT I never cease to be surprised when people smugly state "you don't have to hack into something, why, you can BUY your own unix box for 'x' hundred dollars." I had no idea that unix is all there ever was. There really isn't anything else out there? Just unix??? Wow. Wait, isn't this Earth in the 20th century? Whoops! Silly me! Back into the TARDIS! That's like saying "Columbus didn't have to discover the New World and annoy the natives, he had plenty of land in Europe to play with!" [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 71 of 447 Subject: Re: ... From: thug (Murdering Thug) Date: Mon, 10 Aug 92 01:06:30 EDT phiber (Phiber Optik) writes: > > That's like saying "Columbus didn't have to discover the New World and > annoy the natives, he had plenty of land in Europe to play with!" > That's a strange analogy, but let me take a stab at it anyway. You see the natives only had bows and arrows, Columbus had guns. In the case of hackers, if you consider yourself to be an explorer (ie: Columbus), you're going to be dealing with natives (corporations) which are much larger than you, and have the government on their side as well. If Columbus had bows and arrows and the natives had machine guns, then things would have turned out to be different. Now personally, I would love to go exploring and digging through the juicy files of but unfortunately, it's called tresspassing, and unless I have more weapons -- more (48%) -- than they do, I am not going to run in there screaming something Emmanuel-Goldstien-ish like "Information yearns to be free!" only to have my head blown off by a squad of goons with machine guns. Corporations don't have Uzi-carrying goon squads (then again, maybe they do) but they do have lawyers and are in bed with the government (SS,FBI,Justice Dept), so it's basically the same thing. Mark, whether you like it or not, in the real world "Might makes right." The justice system is just a puppet of the corporations. The justice system enforces laws passed by Congress and the President. The Congress is owned by special interest groups (corporations), and the President is owned and payed for by political action committees (corporations). If you ask me who is running this country, I would say IBM, AT&T, GM, and Exxon, and the rest of the Fortune 100. Yeah, I know it sucks, but there is no reason to put yourself up as a sacrificial lamb just to point this out. People much more powerful and influential than you have already tried (ie: Abbie Hoffman) and were destroyed in the process. Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 72 of 447 Subject: thug From: zachs (John Zachs) Date: Mon, 10 Aug 92 01:45:48 EDT That was a great message. That is what it all comes down to isn't it. Columbus could do what he wanted because nobody could stop him, people can stop hackers pretty easy with the legal system and all their money. You'll notice that a lot of what columbus did was morally questionable, he didn't bring peace and happiness to the natives, he brought them a lot of death. That was a strange analogy to make Phiber. The high of exploration might be a driving force, but when your exploration becoming tresspassing, and those being tresspassed against don't like you there. Then you're in deep shit and I can't say I see where those being tresspassed against are morally wrong to want you out of their systems and information. Thug that was a really good message. :) Makes you think. I vote yes for intros, Patrick Bruce and Phiber have theirs, but they dont say anything anyway. It would be a fun board. -- more (97%) -- Zach [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 73 of 447 Subject: . . . From: chrmsync (Craig Stockwell) Date: Mon, 10 Aug 92 01:47:39 EDT Re: Weaponry - Naturally, we'd like to think major corps. don't have goons with guns. I've done security before (along with a zillion other jobs) for a major pharmaceutical corp., and I've done security for Lt. Col. Oliver North. It's very easy to carry guns as a 'goon'. California Penal Code Section 12026 allows for individuals to carry firearms openly or concealed "in their legal place of residence or business." So do they have bigger guns? Consider: could you seriously damage an energy company? Could they damage you? If you wanted to could you (physically, not morally) destroy a power plant or hydroelectric dam? I think it's a matter of 'guts & glory'; Columbus wasn't sure what he'd encounter, but he chanced it, with very little armament (most considered -- more (54%) -- 'heathens' dumb animals ... you didn't *have* to kill them if you couldn' t reson with them ... you could leave; only if they were persistant would you exterminate.) I have no doubt I could easily cripple a corp.; but hey, I have had some special instruction in weapons and tactics. This training could easily be passed along. Heck, I've taught liberal feminists to shoot. In a similar vein, a hacker can create havoc for a major corp. IF SO INCLINED. Heck, , I phiger phiber could show me around the Underground, if I wanted to acquire than kind of skill. I'd go on to say something about self-empowerment, and quote Tim Leary (fun guy in person), but that's too weird for now. "blank is beautiful" Chrome Sync [who prefers a mostly-low profile] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 74 of 447 Subject: ... From: phiber (Phiber Optik) Date: Mon, 10 Aug 92 02:49:06 EDT thug: I ignore points made by people who accept defeat so easily, without challenging wrong doing. There's a place for people who allow the world around them to go to shit without a peep, just going about their own business. This place is called a commune, and you would be a communist. A bee in a hive. Communist eastern bloc countries were tormented for years by evil bodies of government with unknown amounts of power over their lives, and no one did anything. Then, finally, miraculously, the people banded together and kicked ass. Some even killed the rulers. Then they formed democracy from the ashes. If that kind of fed-up, pissed-off, I'm-not-going-to-take-it-anymore attitude existed to a larger degree in this country amongst common people, there'd be a lot less bullshit that rich, abusive, power-mongers would get away with. But alas, there's people like 'thug', and people who think like him, who couldn't care less, who may complain every so often, but just say "eh, what can ya do. I'll just watch some more TV." -- more (60%) -- You said "might makes right"? I'm damn AMAZED that you would be completely ignorant of the power of raw knowledge that can be turned into action through machines, and compare this to the simple crude barbary of "goons with guns". Spoken with true bluntness. Intimidation by bullying muscle heads with guns is one thing. Murder is another. What are you, afraid of being killed for hacking or something? Get real. I'm glad some of you people weren't around in colonial times. We'd all be speaking British and paying tea tax today, and harboring the king's militia whenever they felt like entering our houses. Maybe John Hancock should've written the Declaration of Independence and the Constitution. Maybe then, you'd SEE THE WORDS. Long live the king. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 75 of 447 Subject: Re: Argh From: bwp (Jane Doe) Date: Mon, 10 Aug 92 09:48:17 EDT cudigest (Jim Thomas) writes: > Jeez, between you and bandwith, Michelle, I'm really sorry I cut my > past-shoulder length ponytail. Yarp...off topic...see the reply in Women-Online. -bwp [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 76 of 447 Subject: yeah right like i know what im tlaking about From: hotblack (Dana Watanabe) Date: Mon, 10 Aug 92 14:50:21 EDT i was just about to make this brilliant post responding to every single post i just read in a single sentence when i got paged and started talking to someone so i will probably just ramble and hope i hit that sentence but seriously... i think that some of what chrmsync is saying is being missed.. he is not saying that people have the right to go through all your personel records, and neither does the government people and the government have the right to go through any files that you leave on a computer hooked up to the internet or a modem or anything where someone can gain access to the system now, is it okay to compare a computer to a house? or what? if it is a privately owned computer that -- more (49%) -- just happens to have an internet connection, is that not like aprivately owned house that just happends to have a public street run by it? (well neither of them just happen to be that way, but i dont think it matters) if someones door is left open or maybe at least unlocked is that not like a computer that has no password to get in or has a guest account? so maybe security would be something like a lock on the door or maybe it is infrared beams going across the doorway.. all can bne related to different levels of security a comptuer can have now what is the difference between a hacker hacking security and getting into a system and a lockpick picking his way into a house or safe or whatever lock? lets say neither do anythign when they get inside except look around whats the difference? -- more (92%) -- (except that chances are the lockpick would get charged with less than the hacker?) [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 77 of 447 Subject: Lockpick From: mcmullen (John F. McMullen) Date: Mon, 10 Aug 92 15:11:52 EDT The lockpick would be charged with trespassing and/or breaking & entering and/or bugulary (if he took anything) -- all appropriate charges; he/she would also be held responsible for the amount it cost to fix/replace the picked lock if it were damaged -- once again, appropriate in this case and, one could say, also appropriate in computer-cracking cases. The lockpick would, however, not be held liable for the installation of a multiple-thousand dollar burglar alarm system if the house owner decided that such protection be required to insure that such intrusion not happen again. Such action would be up to the house-owner who would have to decide what prudent action is required to protect her/his property from intrusion or bugulary. This type of liability is, however, charged by the government against alleged or convicted computer intruders -- see the $230,000 restitution responsibility contained in the sentencing of Riggs, Darden & Grant and the $360,000 damages to Southwestern Bell contained in the indictments against Phiber, Corrupt & Outlaw. If this type of liability stands up, the motto of corporate America could turn out to be: "Let a hacker intrude and fix your security holes." -- why bother -- more (93%) -- tightening security? Catch the first guy and make him pay for it. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 78 of 447 Subject: Luddites and apathy From: cudigest (Jim Thomas) Date: Mon, 10 Aug 92 16:19:16 EDT Phiber writes: >thug: I ignore points made by people who accept defeat so easily, without >challenging wrong doing. Sadly, we can't ignore their points. I find those who sit back in apathy and grouse about conditions to be far more dangerous than those who abuse their power. The mass of inertia of the apathetic folk is much more difficult to overcome. They tend to grouse about conditions, gripe about those who try to change them, and murk about in self-pity for their plight. Attacking abuse of power is fairly easy. Mobilizing the coconut throwers is not. Self-styled luddites rarely have any real understanding of what Luddism was or what it entailed. Sad, ain't it? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 79 of 447 Subject: Re: Lockpick From: falconer (Steve Copold) Date: Mon, 10 Aug 92 16:54:43 EDT mcmullen (John F. McMullen) writes: > The lockpick would, however, not be held liable for the installation of a > multiple-thousand dollar burglar alarm system if the house owner decided > that such protection be required to insure that such intrusion not happen > again. John...This is true, but hacker is in no danger of being shot dead as is the lockpick...at least in my home anyway. Falconer [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 80 of 447 Subject: minor points From: doug (Douglas Luce) Date: Mon, 10 Aug 92 20:01:56 EDT i think phiber confuses a commune with a dictatorship. 'n chrmsync has gotta be a mondo subscriber. (ya, lots of us were in th' audience when timothy leary came ta speak, or at th' party afterwards, watching undergrad girls offer him acid or sex) [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 81 of 447 Subject: Explorers From: king (Randy King) Date: Mon, 10 Aug 92 20:38:17 EDT This is sort of a tangent but gets back to the Columbus analogy. Hackers are explorers entering a foreign land just as Columbus was an explorer entering this (then-)foreign land. But, let's say that the Indians had machine guns, anti-matter rays, and localized nuclear weaponry... And lets again say that Columbus was a fungus (poor analogy from a hacker's point of view, but bear with me). The Indians see this fungus growing a bit but they do nothing about it because they figure no big deal. This fungus then eats all their food or eats the Indians or whatever because of their inaction. What am I getting at? I don't know...maybe if the Indians had inspected the fungus closer than they did, they could have realized it was a problem and could have done something to prevent its spread to the point of damage to them (in this case death). System administrators *KNOW* that there are holes in operating systems, ***SPECIFICALLY*** Unix, yet many of them do little to nothing to take care of them. I don't know about you guys, but I got my vaccinations when I was too young to realize what good it was... -- more (97%) -- TK [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 82 of 447 Subject: Burglars and Hackers From: cudigest (Jim Thomas) Date: Tue, 11 Aug 92 01:15:29 EDT I think John M. was referring to the practice of alleged victims of intrusions to jack up the value of "loss" by calculating subsequent costs, such as added security, investigation, costs of program development, and anything else they can tack on, to magnify the danger of those "hacker terrorists." Some of the indictments from the past two years shows a pattern especially of the Bell crowd of claiming costs of developing programs as part of their loss. If I pick you pocket for a buck-fifty, that's a misdemeanor. Following the logic of BellSouth (as an example), I would add the cost of the pocket, the cost of a new suit, and the cost of body guards to prevent you from doing it again to jack the $1.50 loss into a major expense. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 83 of 447 Subject: Hand Holding From: doug (Douglas Luce) Date: Tue, 11 Aug 92 01:43:42 EDT TK sez that he was too young to understand what good immunization shots would do him. To extend the analogy a bit, do System Admins need a "mother" (c.f. _Alien_ or perhaps _1984_) to lead them to the CERT-sponsored electro-clinics? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 84 of 447 Subject: Okay.. From: chrmsync (Craig Stockwell) Date: Tue, 11 Aug 92 11:52:26 EDT In-Reply-To: Let's kill the Colombus analogy. I think the hacker/home trespasser analogy as a bit screwed. A hacker can't wake the SysAdmin's sleeping kid and shoot the entire family dead. (unless he's a REAL PROGRAMMER that doesn't eat quiche). Chrome Sync (Mondo reader) [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 85 of 447 Subject: Re: Okay.. From: hotblack (Dana Watanabe) Date: Tue, 11 Aug 92 13:08:06 EDT chrmsync (Craig Stockwell) writes: > I think the hacker/home trespasser analogy as a bit screwed. i agree, but is there a better legal one? > A hacker can't wake the SysAdmin's sleeping kid and shoot the entire > family dead. (unless he's a REAL PROGRAMMER that doesn't eat quiche). you _really_ underestimate the true power of the computer no, but seriously... this is a GREAT point why should the person who can do the least harm get the worst punishment? i think it might be stupid to argue allthis because im assuming we all agree? (that a robber is worse than a hacker) -- more (54%) -- maybe? maybe not? so... what about software piracy? how much is microsoft really hurt by the fact that a large part of the public that owns Windows or DOS, dont own it legally? (this number is probably dropping relative to the amount of people who dont know any better than to apy for the software adn who dont know other computer users well enoguh to trade stuff... but that doesnt mean that i would EVER reccomend copying software that isnt supposed to be distributed as such :-P ) but how bad of a crime is it? what type of punishment should there be for owning pirated software or distributing pirated software? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 86 of 447 Subject: The evil that corporations do From: klarry (Larry Kessler) Date: Wed, 12 Aug 92 00:34:59 EDT In-Reply-To: <8RqcPB3w165w@mindvox.phantom.com> In messages here I am always struck by this picture that is made of corporations being these evil things that should be stopped. Where is that coming from? What right does anyone have to a businesses data? It's none of your business! I don't understand what the point of all this is, is business bad now? That is the attitude that hackers seem to adopt, this would mean that hackers want the return of communism where "everyone is equally opressed" except those in power, who in this case would be the hackers. Same old story, new regime, nothing new, nothing different. -- more (95%) -- -Klarry> [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 87 of 447 Subject: Hackers From: butler (Tom Butler) Date: Wed, 12 Aug 92 10:54:52 EDT In-Reply-To: <1kmDPB4w165w@mindvox.phantom.com> Most of the hackers I know are quite ethical. Their only quest is for access to resources and information. Occasionally they might cross the line and abuse their privledges, but for the most part they harm noone. When I am in the position to hire computer professionals, I am going to look at "hackers" first and foremost, regardless of what they have done in the way of hacking. If you give someone the responsibility of supporting a system, they can hack all they want while doing something good for their company. The Butler... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 88 of 447 Subject: Re: Hackers From: dead (Bruce Fancher) Date: Wed, 12 Aug 92 14:37:23 EDT In-Reply-To: <60eePB1w165w@mindvox.phantom.com> That all depends on what you mean when you refer to "hacking." Not every hacker (or "cracker" as they're called by the super-anal people) is necessarily a talented programmer. Social engineering isn't really a very useful talent if you're looking for a system operator. On the other hand there is one alledged hacker in particuliar I know of who can program :-) Phiber knows a hell of a lot more about programming then any of the students I met in the Computer Science department at my University. Computer Science classes in school involve esoteric theories and analyzing data types on *paper*. Hacking is about as hand on as it gets . . . Bruce Fancher -+- dead@phantom.com [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 89 of 447 Subject: Re: Hackers From: czarina (Rita Rouvalis) Date: Wed, 12 Aug 92 14:55:09 EDT In-Reply-To: <1kPePB1w165w@mindvox.phantom.com> Maybe at Tufts, Bruce, but I did a shitload of programming at ULowell -- and I was only doing my minor. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 90 of 447 Subject: Re: The evil that corporations do From: hotblack (Dana Watanabe) Date: Mon, 17 Aug 92 14:17:43 EDT klarry (Larry Kessler) writes: > In messages here I am always struck by this picture that is > made of corporations being these evil things that should be > stopped. well they are > I don't understand what the point of all this is, is business > bad now? no it always has been > That is the attitude that hackers seem to adopt, this > would mean that hackers want the return of communism where > "everyone is equally opressed" except those in power, who in > this case would be the hackers. -- more (33%) -- capitalism and communism really arent what anyone makes them out to be and i really thought that the big commie scare was long over before the fall of the SOCIALIST republic (and the DEMOCRATIC republic of East Germany) stop calling me a commie just because i want to share information that rich people what to keep secret so that they can stay rich have you ever thought that the only reason rich people stay rich is because they have enough money to bribe, oh im sorry lobby, politicians into getting what they want done? politics should have nothing to do with business and then maybe capitalism would work, but politicians invest in the stock market too and i dont know of many people who would pass legislation that would be disadvantageous for a company they were part owners in now as to why hackers might not like big business (mind you small businesses are fine, its the monopolies that pretend they are not, but really are that are the problem) when a phone company gets to charge whatever it feels like and give you whatever service it feels like and you dont get a good choice is this capitalism? -- more (83%) -- no, so when hackers try to bring down the phone company it is in favor of a freer market, so why complain? big business is against capitalism, it is for republican ism though ie keeping rich people rich and poor people poor > Same old story, new regime, nothing new, nothing different. only the names change [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 91 of 447 Subject: Stagnation From: chrmsync (Chrome Sync) Date: Thu, 20 Aug 92 20:55:51 EDT In-Reply-To: <9ZXNPB3w165w@mindvox.phantom.com> Three days and not a new word posted. B-o-r-i-n-g!! So, how can hackers affect social change ETHICALLY? Is it reasonable to hack into a Senator's account somewhere and leave a note, say on his TRW report indicating his 'account' at "U.S. Congress, Inc." has been closed due to "unpaid / outstanding balance"? okay, so it's a mildly humorous example. But how can hackers kindly suggest to government (and monopolized big business) that they're screwed and have their heads up the same collective ass? Let's face it, Second amendment supporters can't just go and shoot their opponents to get their point across. [actually, when one civic leader suggested that gun control was necessary after a family was stabbed to death was grimly humorous ... after all, if they'd been armed, they wouldn't likely 've been stabbed to death). -- more (70%) -- So how can hackers send a clear message that (as a whole) they are not rogues and rapscallions (i love alliteration), but rather just the curious in the new age of information, and the big evil is big government protecting big business, while ignoring the needs of 'the masses'? Just thought I'd try to encourage some conversation. It's soo boring seeing 'No new messages' on this forum. Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 92 of 447 Subject: Re: Stagnation From: cudigest (Jim Thomas) Date: Thu, 20 Aug 92 23:57:30 EDT In-Reply-To: Perhaps hackers shape culture by challenging the dominance of those who would otherwise be the sole controllers of information and technological expertise. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 93 of 447 Subject: Re: Stagnation From: ahmed (Ahmed Kufuti) Date: Sat, 22 Aug 92 02:49:23 EDT chrmsync (Chrome Sync) writes: > Three days and not a new word posted. B-o-r-i-n-g!! For a system that is not yet even open to the general public, I think the posting and conversations have been quite excellent. Imagine what this place will look like when people actually find out that it exists. I hope that day comes soon. Ahmed [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 94 of 447 Subject: Hacking From: davel (Dave Lowens) Date: Thu, 03 Sep 92 17:38:18 EDT In-Reply-To: <1gBwPB3w165w@mindvox.phantom.com> I still don't see what the point of all this was. You can't justify entering computer systems that dont belong to you just because you want to or you think it would be a educational experience. They aren't yours in the first place, there isn't anything giving youthe right to be on them if you weren't invited. If you want to learn, then there's nothing wrong with taking a class in my opinion, there aren't many places that are interested in hiring people who don't have at least a 4 year degree. If you don't have the basics, all you're ever going to end up doing is grunt work. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 95 of 447 Subject: Re: Hacking/4-year degrees From: paulk (Paul Kerrios) Date: Sun, 06 Sep 92 00:46:06 EDT In-Reply-To: That would depend on where you want to get a job. I know of many hackers who only have 4 year degrees and are doing R&D work, somebody just had to give them a chance to get a start. The problem is that most firms don't have the time or interest in dicking around with people who might have what it takes and then again might not. Dedicated hackers in the classical sense have my highest admiration, but there aren't as many of them around as there used to be, I don't know what "today's" hackers end up doing, I guess it's not different then what yesterday's hackers did, except more of them are having a much harder time finding jobs without at least 4-year degrees because there is such a glut of CS grads in the 90's. //=======================================\\ Paul Kerrios /=/ Society has made me what I am today. \=\ \=\ Ok so maybe I just watch too much TV! /=/ \\=======paulk@mindvox.phantom.com=======// -- more (98%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 96 of 447 Subject: Re: Hacking From: toxic (Toxic Avenger) Date: Sun, 06 Sep 92 13:04:28 EDT In-Reply-To: davel-> I am a comp. engineering major at UCSC, and I am a hacker (although not as much now as I used to be) I think that hacking truely helped me become what I am now, I walked into the first year of school knowing as much about UNIX as most of the Seniors (well, almost) This was all from hacking, pure and simple. I learned a lot, and it WILL help me with my future career. I am a hacker who believes in exploring, fucking around and not destroying. In the 7 years that I have hacked, I have NEVER deleted a fiule that I didn't create. period. I think if more people believed in that, hacking would have a better name. Ill stop prying into your privacy when you stop being so fucking secretive. -- more (96%) -- -Tox [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 97 of 447 Subject: Re: Hacking From: davel (Dave Lowens) Date: Mon, 07 Sep 92 00:34:22 EDT In-Reply-To: <6XVoqB1w165w@mindvox.phantom.com> Toxic, I agree with everything up to the last sentence, people have curtains because they want privacy, they have locks, they have barriers they put between themselves and other people. That's their right, whether its because they want it just because they do, or because they're hiding something. If it isn't illegal, it's nobody's business what's going on in databases or records that don't belong to you. You have all the right to request what records say about you, but you don't have the right to see what they say about other people, their business, or whatever else they're doing. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 98 of 447 Subject: Re: Hacking From: davel (Dave Lowens) Date: Mon, 07 Sep 92 00:39:00 EDT In-Reply-To: Another thing I forgot to mention in the previous message, I agree with what you said about hacking helping you in school, but if you didn't go to school and get the degree, then you'd have a hard time finding a job where you could apply your skills to anything more complicated then maintenance. With so many computer literate grads coming out o schools, being a CS major is becoming like being a lawyer, there are too many of them for too few jobs and a big percentage of them aren't that great. The industry is going to have massive changes when Cyberspace becomes more real for more people, then people in China and Asia are going to be getting jobs and american CS grads will be working at McDonalds. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 99 of 447 Subject: Re: Hacking From: toxic (Toxic Avenger) Date: Mon, 07 Sep 92 01:10:48 EDT In-Reply-To: Yes, people have the right to lock their belongings, and the better right lock that they put on, the less likely something is going to be stolen. However hacking is different, When I wander through a system, I don't take things away, I just look at them, occasionally make a copy and the like. Nothing like stealing. I have a lock on my apartment, but I make it a point to leave my UNIX account ungarded. Yep, no password (it isn't true with this system, don't even try it) I keep duplicates of anything important, and if someone logs in as me and plays around, more power to them. Lock your belongings, but you dont _OWN_ the series of 0 and 1's that make up a file. -Tox [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 100 of 447 Subject: Re: The evil that corporations do From: heretic (The Heretic) Date: Mon, 07 Sep 92 03:35:05 EDT klarry (Larry Kessler) writes: > > In messages here I am always struck by this picture that is > made of corporations being these evil things that should be > stopped. Personally, I really do believe that large corporations have truly evil tendencies which must be actively held in check. Big Business was invented so that individuals could avoid personal responsibility. In today's interconnected world, we can't have massively powerful corporations mucking about irresponsibly. > Where is that coming from? What right does anyone have to > a businesses data? It's none of your business! > > I don't understand what the point of all this is, is business > bad now? That is the attitude that hackers seem to adopt, this -- more (51%) -- > would mean that hackers want the return of communism where > "everyone is equally opressed" except those in power, who in > this case would be the hackers. So now hackers are commies? This is empty rhetoric, IMHO. I don't think "hackers have a right to businesses' data," but I'm also not convinced that the metaphor of physical entry works with respect to accessing computers. Nor am I convinced that the metaphor of physical ownership can be applied to intellectual property. If hackers can do any good, I suspect that it will not be through helping administrators tighten security but through bringing attention to the above issues. We need to rethink "ownership" or else much of the potential of the "cyberpunk" (I hate the term) potential movement will be lost. > Same old story, new regime, nothing new, nothing different. > > -Klarry> --Heretic -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 101 of 447 Subject: The role of Today's Hacker From: lex (Lex) Date: Wed, 09 Sep 92 00:28:10 EDT In-Reply-To: <79ZPqB2w165w@mindvox.phantom.com> I think the role of today's hacker is not to test system security for the owners good, but rather to expose those things that threaten the majority. For example, I do not think TRW would have as easily decided to give out free credit reports and make it easier to correct mistakes if it weren't for hackers helping to bring attention to them through the various breakins and articles (such as those in 2600 not to mention the "popular" media). It may still be illegal for them to prove that people's conversations are not safe from eavesdropping but there is a service to the public that is done in the process. I am not encouraging today's hackers to go out and break the law if it is in the public interest but if they are going to hack let it be for those reasons as opposed to "helping" a system admin to fix their security problems which they probably know about anyways but don't have the funds and/or the time to do anything about. By the way, how many "reporters/journalists" have broken the law to break a big story? Most people don't seem to have a problem with it as long as its for the public good. And don't misunderstand me, as some will probably do anyways, I am just -- more (74%) -- trying to encourage a debate. Just remember every day you wake up you now have less privacy than the previous day. Perhaps hackers should devote more time to bringing attention to "big brother-ish" systems which can threaten everyone, rather than helping rich companies get richer by shoring up their security weaknesses. Or worse yet, by trying to gain personally from their hacking exploits (although few may actually do it, many probably try it). Lex [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 102 of 447 Subject: Re: The role of Today's Hacker From: dead (Bruce Fancher) Date: Wed, 09 Sep 92 03:46:31 EDT In-Reply-To: Lex, you brought up the subject of journalists breaking the law for a story. I don't know if you quite consider Geraldo a journalist, but he and his staff "research" for the trash TV show on Hackers wasn't exactly conducted ethically. I spoke with some of his producers for about an hour on various technical matters and details of the how and why of hacking. And just as I was begining to truly believe they would do a semi-acurate piece, they started in with the tabloid stuff. First they asked me if I could pull Geraldo's credit rating for them so that a hacker could present it to him on the show (shocking!). They then asked me if I or someone I knew could hack into the secret Deptartment of Education computer which held a record of Jesse Jackson's unpaid student loans. They've got great imaginations but criminal minds. It's unbelievable that a major TV personality would commit a crime in the course of portraying innocent parties as criminals. Ah well... The show got 16 share anyway so what does it matter? -- more (95%) -- Bruce Fancher -+- dead@phantom.com [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: ?  MindVox [FORUMS] Syntax About - Summary of Each Forum Join - Add this Forum to JOIN Again - Re-Read CURRENT Message List - Display Message Subjects Back - Back up to Previous msg Load - Post text from Home Dir Cancel - Delete a msg YOU posted Mail - Send Prv Mail to Author Catch - Mark ALL Messages READ New - Scan for New Messages Configure - ReCreate your JOIN file Post - Post a Message to Forum Download - Download Current Message Quit - Exit and Return to Main Follow - Post, Including Quotes Search - By Subject or Author Forward - Mail a Copy of Message UnJoin - Remove from JOIN list Go - Move to a new Forum Upload - Upload text to a Forum Index - Complete List of Forums Write - Save Message to a File [ "+" to the next Forum / "-" to the previous Forum ] [ ">" to the next Area / "<" to the previous Area ] You may also type a Message's number to read it, or press [RETURN] for Next [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 103 of 447 Subject: Re: The role of Today's Hacker From: chrmsync (Chrome Sync) Date: Wed, 09 Sep 92 12:15:54 EDT In-Reply-To: <94PTqB1w165w@mindvox.phantom.com> Having never been more than a one-bit hacker [two-bit joke], and only a small-time journalist, I'll throw in my two cents: Many journalists heavily bend the law (and yes, even break it) for a story. Even though interns and writers are preached to about ethics, editors often encourage you to 'shake somehting loose' or 'check new sources'. Talk of trashing is not unheard of at all. While I've yet to hear of phone taps (though it wouldn't surprise me to much), there's scanners for cellular phones and parabolic mikes. And although listening in on cell stuff is illegal, parabolic mikes can be, if the people are in 'public, with no reasonable expectation of privacy' ... so if they're at a park bench, it's obvious that they're in public, and anyone can jog by. Or in a restaurant ... anyone might overhear them. There's a large grey area abused often. Confidential police reports come the way of some well-connected journalists. We had a rape/assault story, and I managed to find the -- more (57%) -- victim's name. My personal ethics were to keep it to myself, and have the data, so I could confirm or deny rumor or conjecture about the victim's identity. I suppose if I had undergone a similar trauma, I might have approached the victim to comfort her, and later suggest she talk with a 'friend of mine' who was a reporter. The government (esp. law enforcement) can no longer get journalists to roll over on their sources, with the First Amendment so respected. Yet hackers are squashed whenever possible, because they're the new RED MENACE of the 80/90's. Frankly, I have no problem with people looking [and not taking/destroying] files/data -- it's like me watching someone's house with binoculars ... if they close the curtains and lock the front door [use good security, and/or don't put data online], I won't be peepin' in. BTW, what happened to Phiber? Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 104 of 447 Subject: Re: The role of Today's Hacker From: dead (Bruce Fancher) Date: Wed, 09 Sep 92 18:06:16 EDT In-Reply-To: <8oDuqB1w165w@mindvox.phantom.com> Mark Abene (aka Phiber Optik) is no longer with Phantom Access Technologies. Various legal agreements and prohibt me from saying anything further. Bruce Fancher -+- dead@phantom.com [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 105 of 447 Subject: Re: The role of Today's Hacker From: heretic (The Heretic) Date: Thu, 17 Sep 92 00:21:17 EDT lex (Lex) writes: > I think the role of today's hacker is not to test system security for the > owners good, but rather to expose those things that threaten the majority. Yes, but not because we're Robin Hoods --heroic tweakers of the system who are defined as inversions of the system. I think the difference between Robin Hood and Sheriff Whoeverthefuck is primarily one of style. If we want to really do any good we have to think about developing and spreading some kind of hacker perspective. There's something enlightened in the traditional hacker approach to ideas and technology. Whatever it is, it makes trying to own algorithims look sick and damaging. At least that;s the way I see it. Anyway, the ultimate goal of a hacker should be to preserve an environment in which the positive aspects of hacking are emphasized and can be freely pursued. We need to think about what this environment would be like. We need to hack and social engineer a hacker's future, -- more (43%) -- and that's a lot more demanding and active than fighting the control freak corporations in a piecemeal fashion. > For example, I do not think TRW would have as easily decided to give out free > credit reports and make it easier to correct mistakes if it weren't for > hackers helping to bring attention to them through the various breakins > and articles (such as those in 2600 not to mention the "popular" media). > It may still be illegal for them to prove that people's conversations are > not safe from eavesdropping but there is a service to the public that is > done in the process. I am not encouraging today's hackers to go out and It's a small service to the public unless it pushes communications towards the use of good cryptography. If such eavesdropping merely makes the public wiser, the laws harsher, and the law enforcement worse, then there's no cause for celebration. > Just remember every day you wake up you now have less privacy than the > previous day. Perhaps hackers should devote more time to bringing > attention to "big brother-ish" systems which can threaten everyone, rather > than helping rich companies get richer by shoring up their security > weaknesses. Or worse yet, by trying to gain personally from their hacking > exploits (although few may actually do it, many probably try it). -- more (91%) -- Amen. And we should all vote for Clinton if our principles permit us to vote. We need someone like Larry Tribe filling the next vacancy in the Supreme Court. > > Lex > --Heretic [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 106 of 447 Subject: Re: The role of Today's Hacker From: chrmsync (Chrome Sync) Date: Thu, 17 Sep 92 02:45:49 EDT In-Reply-To: <7X08qB4w165w@mindvox.phantom.com> > Amen. And we should all vote for Clinton if our principles permit > us to vote. We need someone like Larry Tribe filling the next > vacancy in the Supreme Court. I don't think we should vote for a big-brother governmentalist, or a former CIA Chief .... Maybe Howard Phillips, who wants an end to the Federal Reserve and the IRS. I'd rather thumb my nose at the proverbial executioner (or my freedoms) than vote for one of two who will send the executioner to me (I don't give a frick whether it's a President with an '-R' or '-D'; either way, I'll bet we're gonna get screwed. Anybody have comments on _Sneakers_ as a hacking rolemodel? -- more (95%) -- Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 107 of 447 Subject: Sneakers as role model From: davel (Dave Lowens) Date: Thu, 17 Sep 92 13:48:49 EDT In-Reply-To: <3mg9qB2w165w@mindvox.phantom.com> > Anybody have comments on _Sneakers_ as a hacking rolemodel? My favorite part of Sneakers is where the black box decodes the ASCII text and turns it into VGA full color maps accessible without a password. I don't know what to make of Sneakers, those that liked it are mostly Robert Redford fans, it didn't seem to have any big message except as you aquire power you become more like that which you despise or are trying to change, ultimately replacing the old system with a new one, the only difference being who's on top. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 108 of 447 Subject: Re: Sneakers as role model From: chrmsync (Chrome Sync) Date: Thu, 17 Sep 92 16:56:14 EDT In-Reply-To: <3BB0qB2w165w@mindvox.phantom.com> Gosh, a Beowulf-ish interpretation ... As a Libertarian and Capitalist, I have some conflicts in ethics .. "information wants to be free" versus "right to privacy". Then again, I doubt anyone but big-government liberals (yes, I know, not all liberals are big government) liked the idea of the government spying on everybody WITHIN the country. Personally, I think nothing critical should be on open access lines in the first place. But that's just me and my plot problem with _Wargames_. Oh, yeah, aand who the hell uses the old Atari acoustic modem anymore (I got rid of mine in '83 or so ...) -- more (95%) -- Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 109 of 447 Subject: Sneakers; pros + cons From: tmh (The Mad Hatter) Date: Thu, 17 Sep 92 17:37:04 EDT In-Reply-To: Asside from the several technical flaws in the movie (knocking the phone off of the acoustic coupler to avoid a trace wouldn't disconnect the line, walking two inches per second in a room won't set off the motion detector; yet neither will the fish swimming full speed in the fishtank behind, and the fact that in 1959 there weren't too many VGA monitors :)) it was a pretty good movie. Coupled with alot of decent humor sure kept the audience captive, not to mention making it very easy to understand, even for the non computer-literate. A few things they conjured up were quite nice. For instance, their little TRW term program with fancy coloring and text seperation was hot. We could use one of those :). But as for happening to have the sound of road, railroad tracks, and the tire size already preprogrammeed into a nice synthesizer is highly unlikely, but they were sneakers. -- more (85%) -- I'd give it 3.5 stars. tmh:speakeasy (it would be pretty impossible to come up with a 'good' hacker movie) Someone should invite Dan Aykroyd to HohoCon! [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 110 of 447 Subject: Re: Sneakers; pros + cons From: wtap (Wire Tap!) Date: Fri, 18 Sep 92 00:03:49 EDT In-Reply-To: On purely entertainment merit, it was great. 5 stars. Loved it. If I think about technical flaws in movies, I would never enjoy anything. Just think about it. Who besides hackers would like a real hacker movie? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 111 of 447 Subject: Re: Sneakers; pros + cons From: tmh (The Mad Hatter) Date: Fri, 18 Sep 92 00:22:03 EDT In-Reply-To: <3s40qB2w165w@mindvox.phantom.com> That's why there will never be a 'real hacker movie' because nobody but computer hackers and an ocassional fed and lunatic would go see it. But other than that, it'd be a great movie. Becides, you'd have sold x amounts of tickets pretty much guarenteed. tmh And hackers will act for CHEAP! [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 112 of 447 Subject: Re: another thing... From: delafe (Alfredo De La Fe) Date: Sun, 27 Sep 92 14:26:23 EDT phiber (Phiber Optik) writes: > On a more personal level, have any of you ever had a gun pointed at your > head? How about two guns, in the bed you sleep in, in your own home, by > two complete strangers, accompanied by 10 others? No, you say? > Well, believe me, it does wonders for one's faith in the justice system. > You only had two guns pointed to your head? But seriously, it is not a fun experience. Nor is getting hand cuffed, having a guy watch you take a piss, or being forced to stand in profile for a picture. And I used to think that crap like this only happened in the movies. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 113 of 447 Subject: Re: Guns at your head ... From: chrmsync (Chrome Sync) Date: Sun, 27 Sep 92 16:02:37 EDT Actually, I often sleep with a loaded gun within reach of my bed. Given the often loud entry of law enforcement serving a "high risk" warrant (read: supposedly dangerous criminal), I have a feeling the ensuing firefight would likely take several lives. Anyone entering my house by force is likely to become dead very quickly (esp. since they don't always announce who they are, and certainly don't do so loud enough to reach my room on the second floor of the place). Better to die free than live enslaved (or terminally oppressed) ... Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 114 of 447 Subject: Re: Guns at your head ... From: falconer (Steve Copold) Date: Sun, 27 Sep 92 21:20:42 EDT chrmsync (Chrome Sync) writes: > Actually, I often sleep with a loaded gun within reach of my bed. > Given the often loud entry of law enforcement serving a "high risk" > warrant (read: supposedly dangerous criminal), I have a feeling the > ensuing firefight would likely take several lives. It's certainly your business if you want to post stuff like the above in a public forum, but I really feel compelled to tell you that law enforcement types take this sort of thing VERY seriously. In a recent incident involving the SS, the central reason behind one individual being approached as though he were armed and dangerous was a string of public pronouncements very similar to the one you've made in your posting. This is not idle gossip.....It is the simple truth. Whether you're noticed or not, I suppose you ought to know that there is a very mixed bag of users on MindVOX. It is almost a certainty that at least one of them is an employee of the Treasury Department, and quite possibly, -- more (82%) -- an SS agent. If the above was intended as a joke, I urge you, in the friendliest possible terms, to retract it very quickly. It's not a loss of face, or a big deal...It's just common sense. Regards, Steve Copold [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 115 of 447 Subject: Re: Guns at your head ... From: chrmsync (Chrome Sync) Date: Sun, 27 Sep 92 22:30:36 EDT In-Reply-To: <8wesRB1w165w@mindvox.phantom.com> Well, acutally, part of the impetus for my well-armed nature stems from GOOD contact with law enforcement. I'll explain: My first contacts with LE (law enforcement) were good, in my youth ... friends of the family, etc. So, it's not at all like I have a disrespect for law enforcement officers themselves. When I started writing for a newspaper, I soon volunteered to be the one to do the police beat. I spoke with the chief and a few of the sergeants (supervisors) ... the chief happened to be interested in sailing, as did my father (who sold boats at the time) ... needless to say, it was a good relationship. My marked interest in guns (from father's previous military service, interest in maintaining freedom, etc) did not go unnnoticed by the chief, who suggested I get in touch with the firearms sergeant. We talked a couple times before meeting, and hit it off very well. When we finally met, at a public event, he largely ignored his compatriots and I mine, and -- more (27%) -- we blabbed on and on about different firearms, opinions on stopping power, current legislation, etc. etc. He offered to let me shoot the next time the departmental quarterly qualifications came up ... at this point, it was obvious I was beyond being a journalist digging for secrets of the local police,and was more interested in firearms skill and responsible use. As it happened, I shot better than all but three members of the department .. As our conversations went on, it became obvious that my interest in law enforcement as a career far overshadowed that of journalism. So, we talked about topics involving officer gun safety, shoot/don't shoot, concealed carry (when and when not to). When we happened acrss the issue of the old 'gun in the night stand', he offered that he keeps his close to, but not in immediate reach when he sleeps. The purpose is this: given an intruder presence that awakens oneself, moving,say, three of four feet, OUT OF BED, to a firearms is not likely to forfeit the element of surprise ... alternately, a spouse coming home late, sneaking in, or a kid up for milk and cookies would be recognized ass such *because* the getting out of bed and getting a firearm ready gives the mind enough time to 'wake up' and identify the target (as friend or foe). -- more (57%) -- When I lived in east San Diego, our house was broken into three times. On one occassion, cthe intruders were caught about 80 meters down the street, armed. We had just got home. Had we arrived ten minutes earlier ... I might not be here. My point is this: I honestly believe that citizens should be armed. Criminals have weapons, and will use them offensively. I have arms, and will use them defensively. Should someone enter my house, unannounced (let's be euphemistic here), I have no compunctions about firing upon them if I do not recognize them as friends. And, my friends do not break in my door (at least not unannounced) ... if that happens, I figure it's serious gang crime, and I'll be 'lazin' & blaz'n' A word on currrent legislation: sucks. However, I will attempt to change laws that I deem unreasonable through legal channels. Only when the government falls completely into a fascist/socialist/oppressive state (that tries to confiscate my firears) will I act very illegally, ,and (instead) will act morally, on the behalf of freedom. Like Nathan Hale, I would regret having only one life to give for the -- more (82%) -- country AS IT WAS STARTED by our Founding Fathers ... And if I do go into law enforcement (and I have been invited by a couple Chiefs-of-Police to join their departments), I would enforce most laws that I am opposed to (like those involving adult use of drugs safely in the provacy of their own homes). But, if asked to confiscate the arms of honest citizens, I'm afraid I'd have to decline or refuse that assignment. BTW, the SS already has me on file for protesting Bush ... guess it must've been the 'radical' group I was with. It's exciting seeing a sniper team 'scoped in' on you ... they just wouldn't wave back ... The Ever-Libertarian Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 116 of 447 Subject: Re: Guns at your head ... From: chrmsync (Chrome Sync) Date: Tue, 29 Sep 92 02:58:47 EDT In-Reply-To: What, no response?? Going on two days (y'know, like nearly 48 hours), and no ratrional or irrational reaction to a libertarian gunner ? (who's also pro law enforcement). Or is that too unusual for this forum?? Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 117 of 447 Subject: Re: Guns at your head ... From: paulk (Paul Kerrios) Date: Wed, 30 Sep 92 00:03:28 EDT chrmsync (Chrome Sync) writes: > What, no response?? > > Going on two days (y'know, like nearly 48 hours), and no ratrional or > irrational reaction to a libertarian gunner ? > (who's also pro law enforcement). > > Or is that too unusual for this forum?? > I only call every 2 days, but your message didn't seem all that unusual. I know quite a few libertarians who would love their country if the country they lived in had anything to do with the country our founding fathers envisioned. I was born here, educated in England and came back to live here and I love America. Taking a look around, it makes me embarassed to call myself an American when I'm abroad. -- more (76%) -- //=======================================\\ Paul Kerrios /=/ Society has made me what I am today. \=\ \=\ Ok so maybe I just watch too much TV! /=/ \\=======paulk@mindvox.phantom.com=======// [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 118 of 447 Subject: Re: Guns at your head ... From: chemist (The Chemist) Date: Wed, 30 Sep 92 17:38:32 EDT paulk (Paul Kerrios) writes: > chrmsync (Chrome Sync) writes: > > > What, no response?? > > > > Going on two days (y'know, like nearly 48 hours), and no ratrional or > > irrational reaction to a libertarian gunner ? > > (who's also pro law enforcement). > > > > Or is that too unusual for this forum?? > > > > I only call every 2 days, but your message didn't seem all that > unusual. I know quite a few libertarians who would love their country if > the country they lived in had anything to do with the country our founding > fathers envisioned. I was born here, educated in England and came back to > live here and I love America. Taking a look around, it makes me -- more (51%) -- > embarassed to call myself an American when I'm abroad. > > > //=======================================\\ > Paul Kerrios /=/ Society has made me what I am today. \=\ > \=\ Ok so maybe I just watch too much TV! /=/ > \\=======paulk@mindvox.phantom.com=======// Hate to say it, or not, come to think of it I don't hate to say it... I just don't give a shit, at all. There isn't anything in this country that I've found worth following. It's like to be a politician, you have to be so corrupt to even get near that, forget it, I don't know what I'm saying, I know what I feel and what I feel is if some dumb motherfucker wants to go kick some third world country's ass in, he can go get himself a gun and drag his ass over there and shoot people, count me out. -tC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 119 of 447 Subject: Re: Guns at your head ... From: chrmsync (Chrome Sync) Date: Wed, 30 Sep 92 20:56:07 EDT In-Reply-To: > Hate to say it, or not, come to think of it I don't hate to say it... I > just don't give a shit, at all. There isn't anything in this country that > I've found worth following. Then, pardon my French, but the fuck are you here? If everything is so bad and you're so apathetic, go the hell somewhere else. It's probably because I'm younger (born in the sixties) that I'm not completely cynical that I still care about my country. I imagined the reason we all gather here to post messages is that we have interest in what goes on in our lives, and those things that might change them for the better or worse should be discussed, or at least taken notice of. The tone of this is meant to be inquisitive and forceful, but not too insulting. Just thought I'd set that straight. (You'll know when I'm rattling sabres ..) -- more (92%) -- Trying to feed those hungry for thought, Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 120 of 447 Subject: Re: Guns at your head ... From: doug (Douglas Luce) Date: Wed, 30 Sep 92 23:16:30 EDT chrmsync (Chrome Sync) writes: > > Hate to say it, or not, come to think of it I don't hate to say it... I > > just don't give a shit, at all. There isn't anything in this country that > > I've found worth following. > > Then, pardon my French, but the fuck are you here? If everything is so bad > and you're so apathetic, go the hell somewhere else. Got a better place? Moving is a hassle. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 121 of 447 Subject: Re: Guns at your head ... From: delafe (Alfredo De La Fe) Date: Thu, 01 Oct 92 02:25:51 EDT In-Reply-To: <804XRB2w165w@mindvox.phantom.com> Yeah.. Right. They call this a free country, but the only thing that is free is the air, and that's dirty. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 122 of 447 Subject: Re: Guns at your head ... From: chrmsync (Chrome Sync) Date: Thu, 01 Oct 92 19:44:02 EDT In-Reply-To: > Got a better place? Moving is a hassle. Hell, I've found 'shit worth following' ... maybe someone should look harder or llok elsewhere, 'coz I'm moderately content with where I am. We still have free speech (except on some school campi), we can own guns (just not ones that work to defend ourselves with) and we're free to have our wealth arbitrarily redistributed (taxation). Still, it's a decent place. Where else can you die for you country at age 17 or 18 in a war, but not drink in a pub until you're 21. There are problems that politicans have introduced altering the way our founding fathers set up the country. Changes that have fucked it up a bit 1. The Federal Reserve 2. Income Taxes -- more (48%) -- 3. Public Education At least now there is a way to have some personal power -- hacking. Unfortunately, it seems too many people would use this for their own monetary gains, sadistic delight, or to an ends that hurts another individual ... rather than screwing with an unfair government. The beauty is that, in many cases, the machinery to enforce the laws of the land are hampered by their own laws and lack of knowledge of the current technology. As long as a person is aware of the state of legislation and state of technology, there's no reason he should seriously fear the government. Don't get me wrong, I'm not a let's-riot-in-the-streets anarchist (or any type of anarchist, for that matter), but a libertarian who thinks that this is one of the best nations around CURRENTLY. It just needs some help, and that's what we're here for ... Trying to be only mildly pugnacious, So as not to be renamed "Chrome Nova", -- more (96%) -- Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 123 of 447 Subject: Re: Guns at your head ... From: chemist (The Chemist) Date: Sat, 03 Oct 92 00:44:15 EDT In-Reply-To: <44oZRB1w165w@mindvox.phantom.com> I was going to post but then moved it to the thread in social politics, if you guys don't read that area, I'm not apathetic, I am tired of people selling me shit that isn't true. There are things I care about, this place is one of them, but this is a unique situation where a lot of people who wouldn't ever get together are in one spot, having this conversation with people who live around me would be a waste of my time. -tC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 124 of 447 Subject: Too many guns in america... From: hotblack (Dana Watanabe) Date: Tue, 06 Oct 92 18:22:46 EDT In-Reply-To: Although i think that a society should be able to set its own rules as long as the mojarity agrees and the society is small enough (im talking about a city, not a country, and a mid-sized city not a metropolis) ya know, something like blacks have to go aroud with collars on and if you dont like the rules that any particular society has, then you dont live there, but it doesnt really work because what if people decide to move in all around you adn change the majority opinion why should you have to leave? or what if you were just born into the society but dont like it and cant afford to move, personally i would rather live somewhere else than america but its not really economical for me to leave and the longer i stay here the harder it would be for me to leave but dont ask me what im really alking about -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 125 of 447 Subject: Gun shtuff From: hotblack (Dana Watanabe) Date: Tue, 06 Oct 92 18:30:35 EDT the one question i have for you is: are guns really the most important thing wrong inthe US? you said that you would be willing to support laws that you disagree with (which i respect and know a few cops who bust guys for selling pot just before they go out and smoke some, but they are just doing their job and thats cool) but the one law you couldnt do that for is gun control? arent there more serious things? [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 126 of 447 Subject: Re: Gun shtuff From: chrmsync (Chrome Sync) Date: Wed, 07 Oct 92 15:20:08 EDT In-Reply-To: Well, hotblack, first & foremost, I think we've moved this discussion, per se, to the social: politics forum. But as long as we're here (as opposed to the lobby, third floor or loading dock or somewhere else ...) Really, the second amendment can protect all the others, since it is a call for people to arm themselves against any oppressive government, even their own. The biggest thing wrong with the U.S. right now is the size and scope of the government. They tax us unfairly, try to set up socialist programs that serve themselves best, and spend more than they make. They regulate and make laws to no end, and no longer hold personal freedom above "society". My personal 'dig' with guns happens to be one discussion/argument that I feel pretty well qualified to engage in, compared to, say, abortion. -- more (61%) -- Right now, if you were to rape someone, the min. prison sentence you'll get if convicted is 36 months. You've hurt someone, destroyed their life potentially, and broken the moral standard of society. If, alternately, you own a banned assault rifle (in Cal.), an act which has no identifiable victim, and breaks no moral rules or standards, just legislative ones, you'll go for a min. of 4 years. Obviously, to our current regime, I mean government, upholding a right guanteed in the Second Amendment is more heinous a crime than violating someone's person sanctity. And some people think I'm whacked ... Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 127 of 447 Subject: Re: Gun shtuff From: cudigest (Jim Thomas) Date: Thu, 08 Oct 92 00:56:00 EDT In-Reply-To: <0VgasB1w165w@mindvox.phantom.com> Chrome Sync writes: >Right now, if you were to rape someone, the min. prison sentence you'll >get if convicted is 36 months. You've hurt someone, destroyed their life >potentially, and broken the moral standard of society. >If, alternately, you own a banned assault rifle (in Cal.), an act which >has no identifiable victim, and breaks no moral rules or standards, just >legislative ones, you'll go for a min. of 4 years. >Obviously, to our current regime, I mean government, upholding a right >guanteed in the Second Amendment is more heinous a crime than violating >someone's person sanctity. Sentencing varies dramatically by state, and the identify the minimum sentence is misleading, especially when failing to distinguish between determinate and indeterminate sentencing. -- more (74%) -- The avergage sentence imposed in Illinois for prisoners convicted of violent sexual assault was, from 1984-1990, about 12 years. Perhaps Chrom Synch could present some figures to justify his claim that possessing an unauthorized firearm is a "more heinous crime" than rape (or another crime that violates one's "sanctity." [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 128 of 447 Subject: CSOOCD From: universe (Universe) Date: Fri, 16 Oct 92 19:45:33 EDT In-Reply-To: <2J8asB2w165w@mindvox.phantom.com> Greetings. I thought I was on Ethics:Hacking, but instead I have found myself on a strange new system named CSOOCD, that is, Centralized Ssystem for Out Of Context Discussion. Most interesting, the menu allows me to choose discussions about guns and other things, but not much hacking stuff. Personally I'd be interested hearing any who feel that new mthods must be continually expolored and who have done so. I have little experience in this, but it is interesting. I'm not just referring to comoputers , phones, sat dises, but living itself, like in hacking life. This may sounds flaky, but I don't mind because I think that other realms of existance and alternative ways of being and creating your own reality are the most imoportant type of "hacking" that there is. Universe, from somewhere in Andromeda... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 129 of 447 Subject: Hacking Life From: king (Randy King) Date: Fri, 16 Oct 92 21:36:46 EDT In-Reply-To: While I think Universe is a TOTAL flake 8-), I think that there's something to what he has to say... I couldn't hack my way into a Unix box much less out of one, but I think hacking involves an understanding of the grand scheme of things. I try to do this with everything I get involved in in life, or at least to the point where it seems to be leading to an end. Like with the nets, I like to know where all of the net resources are or at least know that I have a place that I can put my finger on to find out. I like to know all of the little interesting utilities like whois and nslookup, etc. At work, I like to know the reason I'm doing what I'm doing, what happens after I do it, and why. Dealing with people, I like to know why they react one way to something I say or another because of a tone in my voice. Maybe I'm a flake too... TK -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 130 of 447 Subject: Re: Hacking Life From: redeye (Sigmund Obispo) Date: Sun, 18 Oct 92 07:26:14 EDT In-Reply-To: You're a flake Randy. I learned alot about the 'grand scheme of things' and found its amazing how much you can accomplish if you put your mind to it. Flexibility, adaptation and vision are all traits of success, be it hacking or elsewhere. RE [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 131 of 447 Subject: Re: Hacking Life From: ozone (Al Macey) Date: Mon, 19 Oct 92 19:04:26 EDT In-Reply-To: The whole attitude and curiosity that surrounds hacking is really the result of an already inherent mentality, I believe. Hackers are by nature curious people, who crave to know how things work. The hackers that I know (and this is admission that I am no hacker...just a wannabe) are the kind of people that need to understand everything around them. At the same time, because they generally succeed in knowing how most things around them work, they develop (sometimes well deserved) egos. The mindset that prevails amongst hackers is not something that develop after they start. However, there is a difference that is hard to put a finger on. There are many "UNix Wizards" and high level programmers out there with the same curiosity and craving for knowledge that hackers have. Yet many of them don't spend any time at all attempting to gain illegal access to various machines. Hackers tend to have a daring attitude, I think, and their daring attitude is also a part of their ego. I'm not busting on hackers as egomaniacs, by the way. LIke a good athlete, if you can walk the walk, then by all means talk the talk. -- more (96%) -- Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 132 of 447 Subject: Re: Hacking Life From: alibaba (Nick Mordanzo) Date: Tue, 20 Oct 92 00:43:57 EDT In-Reply-To: <40ywsB2w165w@mindvox.phantom.com> Out of all the hackers and crackers I know, I don't know any who don't take their egos with them all over the place when they are around in cyberspace, generally act like dicks. Most of the reason why they are different from the Unix Expert who doesn't break the law, is because the Unix Expert has a life, however small it is, in the real world. The hacker is usually a total Melvin and his life is his identity in cyberspace. $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 133 of 447 Subject: Re: Hacking Life From: tmh (The Mad Hatter) Date: Wed, 21 Oct 92 02:27:24 EDT In-Reply-To: Alibaba: phft TK: :) Redeye: You seem to have said it best. The reason that you guys left off, on why *I* hack, along with the various other legitimate reasons supplied by TK, and others, is that so I know, that if it comes down to it, and my life is on the ropes, that I could still illegally make a very nice living, without a college degree know substantially more than someone who social engineered (or even actually did the blasted work) through school, just knowing that I am capabile of raising hair-kari over the rest of the world, all by my lonesome. Now, how close it that to the psychological profile of a criminal? -- more (96%) -- tmh [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 134 of 447 Subject: Re: Hacking Life From: ozone (Al Macey) Date: Wed, 21 Oct 92 21:59:58 EDT In-Reply-To: That is precisely why I own a gun. Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 135 of 447 Subject: Re: Hacking Life From: toxic (Toxic Avenger) Date: Thu, 22 Oct 92 15:21:48 EDT alibaba (Nick Mordanzo) writes: > Out of all the hackers and crackers I know, I don't know any who don't > take their egos with them all over the place when they are around in > cyberspace, generally act like dicks. Most of the reason why they are > different from the Unix Expert who doesn't break the law, is because the > Unix Expert has a life, however small it is, in the real world. The hacker > is usually a total Melvin and his life is his identity in cyberspace. > Bullshit. Not all hackers are 'dicks' who have egos, its only the ones you hear about. Most hacking is done and then not talked about, so HOW can an ego be built. I agree sometime s egos do get the better of hackers (and especially crackers, software pirates) but that is rare. Dont take hackers on the basis of what you hear on #hack or in alt.hacking.kool.kool.kool -- more (85%) -- Many of us DO have lives outside of the scene. I for one am a student and a UNIX expert (and a COmp. Engineering major) and hacking got me there. -Tox [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 136 of 447 Subject: Re: Hacking Life From: alibaba (Nick Mordanzo) Date: Fri, 23 Oct 92 10:24:24 EDT toxic (Toxic Avenger) writes: > alibaba (Nick Mordanzo) writes: > > > Out of all the hackers and crackers I know, I don't know any who don't > > take their egos with them all over the place when they are around in > > cyberspace, generally act like dicks. Most of the reason why they are > > different from the Unix Expert who doesn't break the law, is because the > > Unix Expert has a life, however small it is, in the real world. The hacker > > is usually a total Melvin and his life is his identity in cyberspace. > > > > > Bullshit. Not all hackers are 'dicks' who have egos, its only the ones > you hear about. Most hacking is done and then not talked about, so HOW > can an ego be built. I agree sometime s egos do get the better of > hackers (and especially crackers, software pirates) but that is rare. > Dont take hackers on the basis of what you hear on #hack or in -- more (64%) -- > alt.hacking.kool.kool.kool > > Many of us DO have lives outside of the scene. I for one am a student and > a UNIX expert (and a COmp. Engineering major) and hacking got me there. > -Tox Not arguing with you dude, you yourself said it "its only the ones you hear about" who else am I supposed tobe talking about? half the userlist on this thing are "the ones you hear about" and most of them seem calm and ok but then again their grown-up and not what they used to be like. Even the response you gave me was one of "how dare you" $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 137 of 447 Subject: Re: Hacking Life From: delafe (Alfredo De La Fe) Date: Sat, 24 Oct 92 09:32:19 EDT In-Reply-To: Well, it is quite obvious that there are very few REAL hackers posting in this message base. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 138 of 447 Subject: Re: Hacking Life From: chemist (The Chemist) Date: Sat, 24 Oct 92 14:51:53 EDT delafe (Alfredo De La Fe) writes: > Well, it is quite obvious that there are very few REAL hackers posting in > this message base. No shit, especially lately when we have born again christians who used to steal credit cards and sell them posting what REAL hackers are about. I'd say there's a real communication problem. -tC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 139 of 447 Subject: Re: Hacking Life From: lgas (Laughing Gas) Date: Sat, 24 Oct 92 17:28:36 EDT In-Reply-To: <7ww6sB2w165w@mindvox.phantom.com> first of all, hi tox, hi tmh. Anyway... Maybe you guys should try to describe who you are talking about when you say "hackers". From my experience in cyberspace, most everyone who is a sysadmin (a good one), a programmer, or whathaveyou, is a hazcker in some way or another. Mostof the people who hang around in #hack and so on are generally school kids or people who have just graduated and gotten their diplomas, and don't know what to do, and don't have any goal in their hacking, and so one. There should be a distinction made between the malevolent hacker and the benign hacker, as well as the deviant hacker, the social hacker, the computer freak, and the legit hacker. Most of the people who I've talked to who ppear to be good hackers do not hang out on irc, bbses, or the nets at all. Alot of people I know who don't go around bragging about things or showing off their egos are much better hackers than the best from #Hack. Oh well, my terminal is really slowing down, so I'm going to cut this short.. but you guys get the idea. -- more (97%) -- Laughing Gas [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 140 of 447 Subject: Re: Hacking Life From: ozone (Al Macey) Date: Sun, 25 Oct 92 16:52:48 EST In-Reply-To: The best hacker I ever knew in person had a simple alias, a simple personality, and was very, very quiet. He stayed away from the Underground Scene (per se) completely, because he didn't NEED to be involved with it. The only thing I ever saw him use - as far as private BBSes went - was the AE system he ran to exchange software with people. But he had integrity and poise, and he avoided the whole attitude thing. So much of the BBS scene is based upon how you write and how you present yourself, and a LOT of people think that BBSes are a good way for them to come out of their shell. I'm not talking hackers in particular, but BBS users in GENERAL. Especially the younger crowd. Anyone who has ever been in a NOTES conference on a small college VAX knows that most people who spend their time writing a lot of posts on BBSes and message bases are either escaping or hiding from SOMEthing; many of them are social morons. And no, I'm not saying that the people on this board are like that or that hackers are like that, but i am saying that a good deal of computer users use computers as their only means for social interaction, and that is BAD. I mean, look at MUDs and the whole tinysex thing. That's pretty damn -- more (87%) -- lame. But being GOOD at something - hacking or otherwise - means being able to lead by EXAMPLE, and the people that do can achieve this status are the true elite. Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 141 of 447 Subject: Re: Hacking Life From: doug (Douglas Luce) Date: Sun, 25 Oct 92 20:59:17 EST ozone (Al Macey) writes: > I mean, look at MUDs and the whole tinysex thing. That's pretty damn > lame. But being GOOD at something - hacking or otherwise - means being > able to lead by EXAMPLE, and the people that do can achieve this status > are the true elite. I agree. What "hackers" should want to be are the leaders, and what "hackers" tend to be are the sheep. This phenomenom of "the obnoxious are the evident" is not particular to hacking, lots of other realms revolve around a similar social structure. With just about every "scene," there are the poseurs. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 142 of 447 Subject: Re: Hacking Life From: tmh (The Mad Hatter) Date: Sun, 25 Oct 92 21:44:30 EST In-Reply-To: Lgas: 'lo delafe: Forthe most part, when *I* say 'hack' and 'hacker' I'm talking about real hard-core hacking, not just doorknobbing system, andd credit card fraud, but to being creative, and more importantly effective, and non-advertising. I think you know what I'm saying. Ali: Using someone's past against their point of view, is pretty sad. For the most part, whenever I see people bitching at each other on such a stupidly blunt point of view, they are usually the exact type their steroing. Chemist: IRC/MUDs, is just pathetic. #hack: Plain sucks. Although it does have it's purpose, provdes free contact with people when you want to meet them, by way of the blithering -- more (79%) -- idiot who has no idea what he's talking about, which coincidentally takes about 95% of the IRC #hack/phreak population with it.. tmh (still awaiting the actual technical, yet funky discussion on #hack) [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 143 of 447 Subject: Re: Hacking Life From: alibaba (Nick Mordanzo) Date: Tue, 27 Oct 92 13:48:18 EST doug (Douglas Luce) writes: > This phenomenom of "the obnoxious are the evident" is not particular to > hacking, lots of other realms revolve around a similar social structure. > With just about every "scene," there are the poseurs. Look at the whole world for a great example of that. People with the biggest profiles and loudest mouths, always get the attention and spotlight no matter if they're the best or not. $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 144 of 447 Subject: Blah From: terminus (Len Rose) Date: Wed, 28 Oct 92 14:52:53 EST In-Reply-To: <8qgBTB6w165w@mindvox.phantom.com> Blah , blah, blah.. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 145 of 447 Subject: Re: Blah From: paulk (Paul Kerrios) Date: Wed, 28 Oct 92 19:10:59 EST terminus (Len Rose) writes: > > Blah , blah, blah.. That was simply fascinating! Thanks for sharing. //=======================================\\ Paul Kerrios /=/ Society has made me what I am today. \=\ \=\ Ok so maybe I just watch too much TV! /=/ \\=======paulk@mindvox.phantom.com=======// [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 146 of 447 Subject: Re: Blah From: chrmsync (Chrome Sync) Date: Wed, 28 Oct 92 21:08:57 EST In-Reply-To: <1cqDTB6w165w@mindvox.phantom.com> So, obviously, we're all dying for a new post. Any idea for a new 'thread'? Chrome Sync [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 147 of 447 Subject: Book Signing From: falconer (Steve Copold) Date: Sat, 31 Oct 92 13:12:46 EST Thursday night, the 29th, the Austin chapter of the EFF hosted a book signing and speaking opportunity for Bruce Sterling on the UT Austin campus. The room used for the event has a capacity of 135 and there was standing room only...A very good turnout indeed! The attendees were a mixed bag of university staff and faculty, students, attorneys, cops, and testosterone fueled hacker wannabes. Bruces' talk was very entertaining and even Larry Coutorie (law enforcement type) was laughing pretty hard through most of it. During the Q & A session, I asked Bruce if he thought MindVOX (which he affectionately refers to as "Hacker Hell") was providing a useful platform for all the denizens of cyberspace to air their opinions and, while hosing down the opposition, also enlighten them as to why things often work the way they do? He immediately laughed out loud for a few seconds and then proceeded to give Pat Kroupa a glowing plug as the ultimate "80's style hacker d00d." He also pointed out that, "Yes it's (VOX) providing a forum for discussion, but that the usual amount of cannabalism among hackers is still present." He then quickly added that he believes that to be the norm -- more (77%) -- and that it is simply (as he also so eloquently points out in Hacker Crackdown) part of the way in which the power structure in cyberspace is sorted out. All in all a very good evening...I dished out $25.00 for an autographed copy of the book, but it must be noted that all of the profits for the evening were being donated to the EFF Austin chapter. Falconer [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 148 of 447 Subject: Re: Hacking Life From: delafe (Alfredo De La Fe) Date: Fri, 06 Nov 92 14:56:52 EST chemist (The Chemist) writes: > delafe (Alfredo De La Fe) writes: > > > Well, it is quite obvious that there are very few REAL hackers posting in > > this message base. > > No shit, especially lately when we have born again christians who used to > steal credit cards and sell them posting what REAL hackers are about. I'd > say there's a real communication problem. > > -tC > Well, considering that I am not a born again christian... Anyway, I was making a remark about the inteligence of certian individuals. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 149 of 447 Subject: Re: ? From: madpoet (John Davidson, Jr.) Date: Sun, 15 Nov 92 23:01:48 EST In-Reply-To: If you do know a friendly admin willing to give out a guest acct send me e-mail... I have not been able to find 'nary a one... --- John [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 150 of 447 Subject: Hacking for Profit? From: forbes (Forbes Reporter) Date: Tue, 17 Nov 92 13:17:34 EST Hacking for Profit? Has anyone ever offered to pay you (or a friend) to get into a certain system and alter, destroy or retrieve information? Can you earn money hacking credit card numbers, access codes or other information? Do you know where to sell it? Then I'd like to hear from you. I'm doing research for a magazine article. We don't need you name. But I do want to hear your story. Please contact me. Forbes@mindvox.phantom.com. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 151 of 447 Subject: Re: Hacking for Profit? From: falconer (Steve Copold) Date: Tue, 17 Nov 92 14:25:17 EST forbes (Forbes Reporter) writes: > Hacking for Profit? Has anyone ever offered to pay you (or a friend) to get > into a certain system and alter, destroy or retrieve information? Can you > earn money hacking credit card numbers, access codes or other information? Do > you know where to sell it? Then I'd like to hear from you. I'm doing > research for a magazine article. We don't need you name. But I do want > to hear your story. Please contact me. Forbes@mindvox.phantom.com. No offense Senor Forbes Reporter, but give me a break here! Is this some form of "lameness" quiz?...I mean can you spell G-E-R-A-L-D-O? Falconer [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 152 of 447 Subject: Re: Hacking for Profit? From: bwp (Jane Doe) Date: Tue, 17 Nov 92 15:01:17 EST forbes (Forbes Reporter) writes: > Hacking for Profit? Has anyone ever offered to pay you (or a friend) to get > into a certain system and alter, destroy or retrieve information? Can you Pardon me, but I just gotta say: LAMER ALERT! Who let the pimps in here! What is this, a hacker whorehouse? Yo, forbes, catch a ride on the clue bus and read Sterling's book. -3j [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 153 of 447 Subject: Bend-over Alert From: falconer (Steve Copold) Date: Tue, 17 Nov 92 16:55:20 EST Attention all Lamerz! Okay, we're gonna make it easy for you. I mean why mess around with these media guys when you can do it all by yourself? Now on-line for your archived convenience is everything you'll need to have your-bad-self put away. It's under the directory incriminate.self.forms ...Yes, that's right easy to fill out, do it yourself, search warrants and indictments. Just remember on the warrants to give your correct name and address, the exact location of your system and all of your peripherals. You may even want to include Mom & Dad's stuff as well! The indictments, well, they're even easier. All you'll need are the dates, times, exact offenses committed, and the net addresses of the systems you've broken into. After you've filled them out all you have to do is e-mail them to one of the many on-line law enforcement types...They'll be happy to process them for you as soon as possible! Why bother with middle-man-media folks when you can put the noose around your own neck twice as quick. Falconer -- more (92%) -- "Research is never done by getting on your back like a two dollar whore." [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 154 of 447 Subject: Re: Bend-over Alert From: chemist (The Chemist) Date: Wed, 18 Nov 92 21:02:51 EST In-Reply-To: Man that was >cold< Better hope neither one of you subscribes to Forbes magazine ;) -tC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 155 of 447 Subject: Re: Bend-over Alert From: obscure (Paul Leonard) Date: Fri, 04 Dec 92 02:13:03 EST In-Reply-To: HeHeHe. You have to admit that it was a really fucking stupid question to ask. paul [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 156 of 447 Subject: Hackers From: lotus (Matthew Naparty) Date: Sat, 12 Dec 92 20:14:39 EST In-Reply-To: What are hackers? They are overhormoned asolescents who get a great thrill out of breaking into the cyberspace. This thrill lessens (usually) as they got older and eventually turns into a productive activity of some sort. get Ususally these people do have enough sense to control themselves, or are smart enough to remain undetected or untrackable for a long period of time. Of course there are great execeptions, like we have already seen in the news already, these exceptions are paying the price for going to far and basis stupidity. Hacking is basically done for fun, and is a healthy sign of adolescent rebellion. Hackers usually end up being "productive" computer people as they get older. Older people hack mainly because of profit. A few years ago it was very profitable to be an employee of the KGB, CIA, or even the FBI, when it came to hacking. Today, it's hard to say that the KGB hires anyone, as ofr the FBI and CIA, well, there is no enemy to steal secrets from anymore. One tidbit, in the Gulf War, the american sercet something or other people managed to cripple Iraq's radar's and anything computerish -- more (76%) -- connectd to them through a virus which was implanted in a chip. The chip was connected to a printer, which somehow landed in the radar installation thingie somewhwere in their command center. Geez, I wonder how the stealth bombers got through the radar defenses sooo easily. I guess this was one PRODUCTIVE hacking effort. mudsling your responses at the author.................... l8r [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 157 of 447 Subject: Re: Hackers From: simonm (Simon Moon) Date: Sun, 13 Dec 92 02:05:10 EST In-Reply-To: <5a6oVB1w165w@mindvox.phantom.com> lotus (Matthew Naparty) writes: > One tidbit, in the Gulf War, the american sercet something or other > people managed to cripple Iraq's radar's and anything computerish > connectd to them through a virus which was implanted in a chip. The chip > was connected to a printer, which somehow landed in the radar > installation thingie somewhwere in their command center. Geez, I wonder > how the stealth bombers got through the radar defenses sooo easily. I > guess this was one PRODUCTIVE hacking effort. OK, where's the source? I've yet to hear this story, and I read the media pretty closely during Operation Desert Bloodbath (doesn't mean its not true, maybe you have inside contacts in the CIA, I don't know). If its true, I'd like to know who did it. (I've yet to hear of a virus going from a printer to a puter, but 'hey, you never know'.) - Simon -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 158 of 447 Subject: Re: Hackers From: obscure (Paul Leonard) Date: Sun, 13 Dec 92 06:06:12 EST In-Reply-To: Simon: I read something about that being a rumor in Time Magazine a short time after the war. I don't know if it exists, but it WAS rumored... Personally, I'd like to know how they pulled it off. oi [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 159 of 447 Subject: Re: Hackers From: siva (The Destroyer) Date: Sun, 13 Dec 92 12:22:00 EST In-Reply-To: <2owPVB1w165w@mindvox.phantom.com> They didn't pull it off. It was total bullshit. You'll occasionally hear about "viruses" in printers and modem NRAM, but the vast majority of thesre are totally bullshit. Every one of these occurances that I have been able to verify have been either 1) something entirely unrelated, or 2) yeah, something in the software actualy did write junk to the NRAM. If there's a mechanism for NRAM settings or softfont technology to write out a virus, "i'm all ears!" To tel the truth, with the complexity of true type and postscript increasing, and with the ability to call DLL's from within some software, I think it's theoretical7y possible to do, but i think I'll will continue in my tradition of letting other people get all the glory. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 160 of 447 Subject: Re: Hackers From: carlos (Carlos dominguez) Date: Sun, 13 Dec 92 13:57:38 EST siva (The Destroyer) writes: > To tel the truth, with the complexity of true type and postscript > increasing, and with the ability to call DLL's from within some software, > I think it's theoretical7y possible to do, but i think I'll will continue > in my tradition of letting other people get all the glory. ..imagine, all those ftp sites with TrueType hiding shitloads of viruses... rather sad and funny at the same time, maybe Bitstream got pissed off and planted some out tthere.. ___ ___ __ . ___ __ // Carlos Dominguez, MS-DOS Enthusiast ! / /__/ /_ ) / / / /_ // | carlos@infoserv.com carlos@dorsai.com (__ ( / / \ (__ (__/ __/ .. | carlos@phantom.com FIDONET 1:278/706 [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 161 of 447 Subject: Printer Virus From: king (Randy King) Date: Sun, 13 Dec 92 14:30:38 EST In-Reply-To: FYI, my understanding of the Iraqi printer virus story is that there was an April 1 article concerning this thing that went out over the newswire or something and it got picked up by a number of news agencies. As you will note if you look at your calendars, April 1 is also known as April Fool's Day... TK [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 162 of 447 Subject: Re: Printer Virus From: simonm (Simon Moon) Date: Mon, 14 Dec 92 00:05:19 EST In-Reply-To: Well, concerning _actual_ printer related viruses, this is loosly related... The only documented story I've ever heard is that there was a Mac virus (or was it a trojan horse "SuperPS" type?) that would set the password on typesetters to a random string. [Note: some very-high-end typesetters have a password function, for what, I don't know.] So someone would take their file into a service bureau, it would print, and then the next print job would fail. The printer EPROMs had to be removed and zapped to get it going again... - Simon [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 163 of 447 Subject: Re: Printer Virus From: doug (Douglas Luce) Date: Tue, 15 Dec 92 17:03:22 EST simonm (Simon Moon) writes: > The only documented story I've ever heard is that there was a Mac virus > (or was it a trojan horse "SuperPS" type?) that would set the password on > typesetters to a random string. [Note: some very-high-end typesetters have > a password function, for what, I don't know.] So someone would take their > file into a service bureau, it would print, and then the next print job > would fail. The printer EPROMs had to be removed and zapped to get it > going again... Even Apple LaserWriters have passwords. Since noone ever bothers to set the passwords on their laserwriter, a virus could throw postscript code into laserprep or random postscripted files. Change the password, then change the printer name to something unreachable. Or down the thing permanently. Then you're screwed. (Although I believe the repasswording scheme is probably simpler than rezapping the EEPROM that holds the password; but I could be wrong). I'll bet this is an urban myth, there's nothing "well known" that does this. -- more (97%) -- dug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 164 of 447 Subject: Re: Printer Virus From: simonm (Simon Moon) Date: Wed, 16 Dec 92 05:48:18 EST In-Reply-To: doug (Douglas Luce) writes: > [Regarding printer viruses] I'll bet this is an urban myth, there's > nothing "well known" that does this. No, but there _were_ a few outbreaks... I read an article by some guy whose printer froze up, and how he fixxed it, only to have it taken down again... The second time, he got a copy of the virus responsible... I could probably find the documentation around if someone really wanted it. - Simon [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 165 of 447 Subject: Crackdown progress? From: simonm (Simon Moon) Date: Fri, 18 Dec 92 17:23:50 EST I've not seen any news related to the various hacker trials lately.... How are they going? What's up with Steve Jackson Games, did they ever get their stuff back? How's Phiber doing? Has it been a slow month, am I really out of the news loop, or is the "Criminal Justice" system in the US just painfully slow? Enquiring minds want to know. - Simon [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 166 of 447 Subject: Re: Crackdown progress? From: chemist (The Chemist) Date: Fri, 18 Dec 92 17:54:00 EST simonm (Simon Moon) writes: > I've not seen any news related to the various hacker trials lately.... > How are they going? What's up with Steve Jackson Games, did they ever get > their stuff back? How's Phiber doing? Has it been a slow month, am I > really out of the news loop, or is the "Criminal Justice" system in the US > just painfully slow? Enquiring minds want to know. Read the rest of the system, both of those were talked about within the last week dude! Rita said SJG is still in 'discovery' and going to stay there a little longer or just exiting that stage, so the whole thing can finally get going. From the dudes in MOD everyone has now plead except for abene, stira and one other guy (phiber, scorpion and elias who I think is Acid Phreak but I don't remember). What this usually means according to people I've asked, is that the MOD guys who recently copped a plea have agreed to testify against Abene and Stira. From what has been written about it and from the -- more (82%) -- way its talked about by legal people and security people like Donn Parker, the government will trade everyone in MOD to nail Abene and make sure he does some jail time this time around (#2 for him within the last 2 years). -tC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 167 of 447 Subject: Re: Crackdown progress? From: sn (SN/DPAK) Date: Fri, 18 Dec 92 18:25:22 EST In-Reply-To: It's bad when the government starts to have personal vendettas. It cheapens the system of justice when they start to go more for the person than for the ALLEGED crime. And that's what it is, you know... A Vendetta. -/- Supernigger -/- DPAK -/- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 168 of 447 Subject: Re: Crackdown progress? From: hotblack (Dana Watanabe) Date: Sat, 19 Dec 92 14:54:50 EST In-Reply-To: hte problem here is that its not necesarily a real crime that they are using cuz they have a personal grudge against this type of computer crime so they have two grudges here and its strectching the law pretty thin as far as i can tell but hell dragging someone into court and getting everyone he knows and has wroked with to turn against him isnt exactly a nice sentence either but i dont think we need to be covering how messed up our govt is esop the justic system [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 169 of 447 Subject: Re: Hackers From: lotus (Matthew Naparty) Date: Sat, 19 Dec 92 20:23:45 EST In-Reply-To: SIMON: The story about the printer virus was presented on NIGHTLINE, on the ABC network. I have only herad this story once, mabye the govt dosen't like things like this getting out or somethin. I think the show aired a week or so after the war ended, u can call up ABC and ask them about it. l8r................. Lotus [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 170 of 447 Subject: Re: Hackers From: lotus (Matthew Naparty) Date: Sat, 19 Dec 92 20:28:54 EST In-Reply-To: SIVA: They could have pulled it off, it was *said* that it was a printer, but it could have been any electronic component. They could have altered the device and implanted a chip with the code, which would cause some type of delay, error, or some other unwanted problem. It may be a rumor, but I think it's possible, ABC reported it so i guess it's valid. (but who the hell knows) (: Lotus......... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 171 of 447 Subject: Re: Crackdown progress? From: lotus (Matthew Naparty) Date: Sat, 19 Dec 92 20:33:51 EST In-Reply-To: I think they're all over... at least the ones i heard about. If u like hacker stuff, pick up the book: CYBERPUNK outlawas and hackers on the computer frontier by Katie Hafner & John Markoff simon & schuster I think it was a great view of hacker's lives and their eminent downfall. One of the hackers presented is Robert Morris who killed the internet or one of the other related networks. Remember him? (: Lotus............ [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 172 of 447 Subject: Article in Texas Monthly From: falconer (Steve Copold) Date: Sun, 20 Dec 92 01:31:57 EST (cross-posted from Convergence) I urge you all to run down to the local newstand and pick up the Jan.93 issue of Texas Monthly magazine. There is a lengthy article in it titled _The Clash of the Cyberpunks_ by Gary Cartwright. The entire piece focuses on the feud between Mark Abene (Phiber Optik) and Chris Goggans (Erik Bloodaxe). I cannot comment on its accuracy, but it is a superb read and seems to be fundamentally unbiased in its commentary. Included with the text is a quarter-page portrait of Mark Abene, and a full-page, color toned professional portrait of Chris Goggans. The story is literate, well organized, very detailed, and very long. Cartwright did a review of _The Hacker Crackdown_ last month and had less than a page. This story covers 6 to 7 pages of text in fairly fine print. I am genuinely anxious to hear comments from the folks actually involved in this episode...Particularly in reference to the article's accuracy. A great deal of the history of LOD and MOD is covered from the perspectives -- more (84%) -- of both groups. After the Geraldo Show and the crap that Forbes published under the guise of journalism, this article provided a much needed breath of fresh air. Read it soon! -Falconer [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 173 of 447 Subject: Re: Crackdown progress? From: alibaba (Nick Mordanzo) Date: Sun, 20 Dec 92 03:21:00 EST lotus (Matthew Naparty) writes: > I think it was a great view of hacker's lives and their eminent downfall. > One of the hackers presented is Robert Morris who killed the internet or > one of the other related networks. Remember him? (: > Lotus............ Lotus you're an idiot. Don't take that the wrong way but you know 0 about hacking that you haven't read from the media magazines and seen on TV. Everything you say is like lip-synching NITELINE or something. $%$%$%$%$%$%$% ($) Ali Baba ($) %$%$%$%$%$%$%$ [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 174 of 447 Subject: Re: Crackdown progress? From: simonm (Simon Moon) Date: Sun, 20 Dec 92 08:57:53 EST In-Reply-To: chemist (The Chemist) writes: > From the dudes in MOD everyone has now plead except for abene, stira and > one other guy (phiber, scorpion and elias who I think is Acid Phreak but I > don't remember). What this usually means according to people I've asked, > is that the MOD guys who recently copped a plea have agreed to testify > against Abene and Stira. From what has been written about it and from the > way its talked about by legal people and security people like Donn Parker, > the government will trade everyone in MOD to nail Abene and make sure he > does some jail time this time around (#2 for him within the last 2 years). What seems really crazy anout this is that (correct me if I'm wrong) the evidence against the other MODers was much stronger than against Phiber. So the Feds are throwing away a bunch of cases they could almost definitely have won in order to get the guy who has the highest media profile. While it might make sense from their poing of view (ie "everyone will hear about it and it'll scare some potential hackers off") it sure -- more (91%) -- doesn't sound like pursuit of _justice_ to me. Oh, well, no big surprise... - Simon [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 175 of 447 Subject: alibaba From: rebelion (Chris Jones) Date: Sun, 20 Dec 92 14:23:40 EST In-Reply-To: <7a43VB1w165w@mindvox.phantom.com> your 100% correct, for lotus to say Cyberpunk was a good outlook on hackers is pathetic. Cyberpunk was incredibly slanted against hackers. It was a fun book to read, but not good towards hackers at all. .rl [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 176 of 447 Subject: Re: alibaba From: ahawks (Andy Hawks) Date: Sun, 20 Dec 92 18:50:46 EST In-Reply-To: <6Di4VB2w165w@mindvox.phantom.com> I think it was just slanted towards pofit and fitting CP SF fodder into a reality mold.... I liked the part about Pengo, but he has some prob's with the book, I guess....He's still on the net.... As far as that "eminent downfall" comment by lotus: my ass.... ahawks@nyx.cs.du.edu FutureCulture E-List: [future-request@nyx.cs.du.edu] andy (hawkeye)(dali) new edge, technoculture, cyberpunk, virtual reality, (freshjive) raves, etc. Home of the famous =) FutureCulture FAQ! [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 177 of 447 Subject: Re: alibaba From: chemist (The Chemist) Date: Mon, 21 Dec 92 05:28:38 EST In-Reply-To: Ali that was harsh but true, Lotus, pull your head out and make comments based on something else besides watching the TV. From what I've gathered talking to people who know abene, some of them who don't like him, ok mostof them who don't like him. "Mark has never been arrested for anything he did, then again he has never been charged with all the things he did do that could get him in a lot of trouble" Works both ways, the general attitude that I got was that Abene has done a lot of shit that could easily land him in jail, what they happened toget him for is almost besides the point. The point I think was that he's a pain in the ass and annoys all the wrong people, I think the quote that comes up most in IRC is erikb's: "Mark just doesn't play well with the other children" -tC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 178 of 447 Subject: Re: alibaba From: chrmsync (Chrome Sync) Date: Mon, 21 Dec 92 13:02:20 EST In-Reply-To: I don't give a tinker's dink if someone doesn't want to play well with the other children. Free to do so. 'Course, I don't know I'd hire someone like that to be a 'team player'. Maybe an outside consultant, though. Phiber once compared himself to Batman: "Either you like me/him, or or you don't." [paraphrased, don't have the transcript]. While a bit egoistic, it seems true enough. Many people seem polarized about Abene. I like him for good rhetoric and argument. Then again, maybe I'll meet him FTF one day and decide his a pansy-ass kid. Who can say? While I'm not happy that he's helped to stir the hornet's nest labeled 'THE MEDIA", it was bound to happen. So 99% of journalists have their -- more (69%) -- collective heads up their collective butts. People like Sterling are trying to rectum-fy the situation. (Sorry, couldn't resist the pun, forgive me!). Our concern should be on de-stigmatizing hacking. ... or am I just rambling incoherently ... ??? [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 179 of 447 Subject: KILL ME WHO DON'T U! From: lotus (Matthew Naparty) Date: Mon, 21 Dec 92 16:54:17 EST In-Reply-To: Gosh, u people r real vicious on here. U love *CRITICIZM* but I like it, it's not dead and all the mudslinging is interesting. I have not been in what u define as "hacker culture" for long, heck maby I have not been in it at all, but I think that by the time u get to 30 or so years old it's time to retire and get on with real stuff (?) ! Pirate boards are pretty lame - that's what I mostly saw, maby I can get a taste of real hacking on here? SLING THE MUD!! (: here refers to the internet, telnet and all that stuff, don't get me wrong.......... oh by the way, did u see The New Hackers Dictionary? (__) oo ) |_/\ Lotus.............. -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 180 of 447 Subject: Re: KILL ME WHO DON'T U! From: critic (Terry Palfrey) Date: Tue, 22 Dec 92 02:30:53 EST In-Reply-To: <71J6VB1w165w@mindvox.phantom.com> o o o> /|\ <|\ /|/ / \ / > > The first part of "hacking" is to prepare the body for the odessy of the mind . From there it is all easy. CritiC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 181 of 447 Subject: Re: Crackdown progress? From: sleuth (Reuben Radding) Date: Tue, 22 Dec 92 11:17:17 EST alibaba (Nick Mordanzo) writes: > lotus (Matthew Naparty) writes: > > > I think it was a great view of hacker's lives and their eminent downfall. > > One of the hackers presented is Robert Morris who killed the internet or > > one of the other related networks. Remember him? (: > > Lotus............ > > Lotus you're an idiot. Don't take that the wrong way but you know 0 about > hacking that you haven't read from the media magazines and seen on TV. > Everything you say is like lip-synching NITELINE or something. > Hmmmmm. . . if someone killed the Internet then how am I getting all this net news? Is it magic? YOU make the call. -- more (75%) -- =============================================================== | Reuben Radding sleuth@mindvox.phantom.com | | po box 1270 NYC 10276 rdr@panix.com | =============================================================== [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 182 of 447 Subject: Re: Crackdown progress? From: lotus (Matthew Naparty) Date: Tue, 29 Dec 92 22:34:34 EST In-Reply-To: Alibaba: Well yeah, Robert Morris didn't kill the Internet. He sorta locked it up OK, then it was fixed.................. I made the call! l8r Lotus......... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 183 of 447 Subject: CellularModem From: dexter (M. Lawrence Lopp) Date: Thu, 31 Dec 92 17:06:48 EST In-Reply-To: Question: How useful is a laptap computer w/ modem w/ cellular connection? Is this a decent way to m0dem? I've never used a cellular phone, so I don't know anything about the quality of the line and how happy it would be to interface w/ a modem. dex.research("on") [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 184 of 447 Cc: alexz@well.sf.ca.us Subject: Re: CellularModem From: alex (Alex Zelchenko) Date: Thu, 31 Dec 92 21:31:49 EST dexter (M. Lawrence Lopp) writes: > Question: > > How useful is a laptap computer w/ modem w/ cellular connection? > Is this a decent way to m0dem? I've never used a cellular phone, so > I don't know anything about the quality of the line and how happy > it would be to interface w/ a modem. > > dex.research("on") What would be the purpose in modeming via cellular? When you receive your first bill after one month of use you will dial 611 (on cellular) and scream for cancellation of your account. If you are locked into a minimum duration of contract...you will probably still owe them tons of money. OTOH, if you are a millionaire I can think of all kinds of things -- more (84%) -- you can do -- give it all to phantom.com to expand services, including free access for everybody via 800 lines from anywhere in CyberUniverse. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 185 of 447 Subject: Re: CellularModem From: wheez (Hal Weiner) Date: Fri, 01 Jan 93 10:48:04 EST In-Reply-To: I second the above. cellular service costs are astronomical. Use only in an absolute emergency. just connect up to any phone and login to MindVox! carry a short(10ft) length of modular hookup cable with your laptop. I am waiting for the new modem creditcards later this year as opposed to a permanent on board modem. If it has room for that the laptop will probably have room for something even better than a faxmodem. (like...?) [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 186 of 447 Subject: Re: CellularModem From: chrmsync (Chrome Sync) Date: Fri, 01 Jan 93 15:29:16 EST In-Reply-To: Well, then again, if you're travelling, and need to check e-mail (say, from your boss or re:the conference you're going to (includes data)), a 5-10 minute call isn't too bad. But I couldn't see doing it often. Too expensive (for now) ... aiting to afford a PowerBook 180 to hook to his Motorola Flip, [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 187 of 447 Subject: Re: CellularModem From: dexter (M. Lawrence Lopp) Date: Fri, 01 Jan 93 16:44:15 EST In-Reply-To: While I agree that m0deming a la cellular phone would be costly, it is not the original question I asked. Is is feasible? I mean, is the quality of the connection clean enough to keep your modem happy? With a lot of folks cloning the MIN and ESN codes for cellular phones -- I'd think it'd be fairly easy to make the cost of cellular calls negligible -- no? I have a picture of a laptap with a 9600 baud modem and a cellular connection. This could be a fairly kickin' setup. dex. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 188 of 447 Subject: Re: CellularModem From: chrmsync (Chrome Sync) Date: Sat, 02 Jan 93 00:43:28 EST In-Reply-To: MIN and ESN codes are *much* harder to *safely* use for 'unauthorized' calls, so let's skip that idea (for now). MNP-10 protocol was written specifically for cellular use (BTW, my Supra 14.4 fax/modem has MNP-10, and it's not too uncommon). So, yeah, it's do-able. For a price ... [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 189 of 447 Subject: Re: CellularModem From: dexter (M. Lawrence Lopp) Date: Sat, 02 Jan 93 00:59:24 EST In-Reply-To: <63iqwB1w165w@mindvox.phantom.com> Why are MIN and ESN codes harder to "safely" use? -- the metaphor I've been using in that they're similar to ATM cards... if you have a card and the number... *BINGO* you're in business. Is this true? dex- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 190 of 447 Subject: Re: CellularModem From: thug (Murdering Thug) Date: Sat, 02 Jan 93 12:55:45 EST In-Reply-To: Abusing any single ESN/MIN pair for any significant period of time, or doing so from the same location will get you in big trouble. To be safe, move around and switch ESN/MIN pairs as often as possible, preferably use a new one for each new call. There is something called the Cache Box which will allow you to accomplish this fairly easily. Basically, what it does, is snatch ESN/MIN pairs right off the air using an automated scanner / FSK decoder, and stores them in memory. After each call is finished, the Cache Box replaces the the ESN/MIN pair in the cellular phone (into a SRAM chip which replaces the (E)PROM) with a fresh one from it's cache. This allows you to spread out your damage among thousands of accounts, where a single call (especially a local call to a Telenet/Tymnet/Internet POP) will never even be noticed. The chances of getting caught using the Cache Box are basically nil, since you're not abusing a particular ESN/MIN pair more than once. And you never have to worry about manually obtaining ESN/MIN pairs since the box does it for you. I believe the going street price for a device such is this is -- more (63%) -- somewhere in the range of $50,000. Usually only mafia types and drug dealers can afford to buy them. On the other hand, they are not that hard to build for anyone with knowledge of scanners, FSK decoder chips, and cellular phone programming/eprom-blasting. I would think that a mafioso's idea of heaven is a cellular phone with a cache box and full end-to-end digital voice encryption using Enhanced DES, LOKI, IDEA or Lucifer encryption. I guess it must make the feds shit in their pants when they think of what's in store for them in the next 5-10 years. BTW, the Columbian drug trafficer's already use quite sophisticated encryption & e-mail to administer their world wide drug networks. I heard they might even be using PGP, heh heh. Life is funny... [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 191 of 447 Subject: Perot BUSTED! for hacking Equifax From: thug (Murdering Thug) Date: Sat, 02 Jan 93 13:22:35 EST In-Reply-To: Just heard on CNN.. It seems that H. Ross Perot and his henchmen used stolen passwords to check the credit records of several of his campaign volunteer leaders. The FBI is investigating. I guess the H in H. Ross Perot stands for "hacker". No doubt he'll buy his way out of jail/conviction, where as certain persons who _allegedly_ sold Equifax/TRW codes might be going to jail for a long time. That's the Amerikan justice system, if you have money then you can buy your way out of anything, including prison. I hope they put Perot in the electric chair, and they wouldn't even have to shave his head since he's bald enough already.. I hope that paranoid weasel gets put away for a long time... Die you weasel!! Die!!! ...oops.. sorry, got carried away a little. Whatever, I think it's funny that Perot gets busted for hacking.. -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 192 of 447 Subject: Re: CellularModem From: chrmsync (Chrome Sync) Date: Sat, 02 Jan 93 14:32:27 EST In-Reply-To: Okay, I'll admit, Thug's on the right track. Some big companies check records and such ... basically, changing after every call/every cell seems to do it. (I had an old roomie of mine start to show me how to change the ID# ... he explained the L.A. Cellular wouldn't charge on the first call ... something about roam and other service companies ... not sure all the details .... but it is simple (using the PROG key !!) ... he advised that if I changed it every call, I could effectively make free calls all the time ... and he's a damn LA Cellular Tech!!) If I drum up more details (more tech-like), who knows, maybe it's time for a 2600 article ... [ Cyber-Renaissance Man ] || || -- more (90%) -- || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 193 of 447 Subject: Re: CellularModem From: inhuman (Inhuman) Date: Sat, 02 Jan 93 17:44:19 EST In-Reply-To: Well, there is also the fact that any invalid ESN/MIN pair that has never been tried in that cellular area before will be assumed to be a "roaming" (i.e., not in the billing area of the owner) call and it will go through without verification. After I think three calls (it depends on the area) with the same ESN/MIN that is roaming, it will be put on a "blacklist". There are some mods to cell phones that simply try random ESN/MINs every call. It usually works. Bootleg has an article about it in the next 2600, I believe. Michael | "I tell you one must still have (inhuman@mindvox.phantom.com) | chaos in one to give birth to | a dancing star!" -Nietzsche [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 194 of 447 Subject: Re: CellularModem From: thug (Murdering Thug) Date: Sat, 02 Jan 93 23:23:57 EST In-Reply-To: The "roaming" trick works because real-time ESN/MIN verification is not yet in place among the nations cell carriers. It's hard for them to work out such agreements since some of them are in competition with one another. Basically, let's say I live in California and I fly into NYC and make a call from my cell phone, the first call will go through no matter what, like the previous posts describe. It will take the NYC carrier somewhere in the range of 10-15 minutes to verify the ESN/MIN pair with the cellular company in California. They don't want people to wait 10-15 minutes to place their call, so they let the first call through, and verify the code pair later. It kind of reminds me of how old/dead AT&T calling card codes used to work for several months after dying through various smaller equal access carriers (ITI,Integratel,Telesphere,etc..). Of course the bigger companies like NYNEX,SW BELL,BELL ATLANTIC, PACBELL always had real-time access to AT&T's calling card verification database, where as the smaller companies mentioned -- more (49%) -- above updated their databases via magnetic tapes quarterly from third-party clearing houses. The "roaming" trick WILL stop working soon. All the cell carriers have basically agreed to have a centralized real-time ESN/MIN verification computer set up and working by mid 1993. Right now, it's basically a mess of many wierd roaming agreements among the dozens of cell companies and several technical standards for inter-company ESN/MIN verification, most of which is not in real-time. The Cache Box is the way to go if you want long term free access to the cell network which can never be taken away, unless they suddenly decide to open up and modify about 25 million cell phones out there and every single cell switch in existance. This will never happen. The best they can hope for is to build better security into the new digital (TDMA & CDMA) cellular standard and then paying everyone in the country to trade-in/trade-up their cellular phone so that they could eliminate the current cellular system. BTW, channel 83 UHF (on pre-1986 TV sets with more than 69 channels) is always good to listen to if you're in the Wall Street area. I get excellent stock tips and insider info this way.. Better than reading WSJ I think.. -- more (97%) -- Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 195 of 447 Subject: Re: CellularModem From: chrmsync (Chrome Sync) Date: Sun, 03 Jan 93 03:41:40 EST In-Reply-To: Say, Inhuman, wasn't there a phreak (&tc.) 'publication' called BOOTLEG[GER] ?? ... wishing he were just another two steps ahead ... [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 196 of 447 Subject: Re: CellularModem From: surfer (Hewlett Cray) Date: Sun, 03 Jan 93 12:02:49 EST chrmsync (Chrome Sync) writes: > Say, Inhuman, wasn't there a phreak (&tc.) 'publication' called > BOOTLEG[GER] ?? Bootleg put out Bootlegger in the early-mid 80's. There was also Countlegger, The Hacker Magazine and one or two other Apple 5.25" disk format mags out there for a few years. To my recollection a few of the LOD members on here including Digital, Lex, Erikb and some others, all had material in one or more of them, without their permission, which was one of the things that inspired the formation of LOD Tech Journals, in the first place (people ripping off material that was written by others and then selling it. Something Bootleg is famous for and apparently about to do again with his CD-ROM). Bootleg had a very shaky rep for a long time, he was originally some biker dude who would be in his late 40's or early 50's by now, who was one of the petty-criminal profiteering class. -- more (92%) -- Surf's Up |echosurfer::1:2:surfer:/:/bin/sh\>\>/etc/passwd [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 197 of 447 Subject: Re: CellularModem From: chrmsync (Chrome Sync) Date: Sun, 03 Jan 93 13:29:32 EST In-Reply-To: Well, is it 'fair' to 'rip-off' (i.e.: copy) other's work ... if it's information, doesn't it "want to be free" ... or is it only a faux pas if someone takes 'credit' for another's work ... ? [Just trying to have a conversation match the name of the forum ... ] (Good too see some people have knowledge that stretches further back than mine!) [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 198 of 447 Subject: Re: CellularModem From: inhuman (Inhuman) Date: Sun, 03 Jan 93 14:19:07 EST In-Reply-To: God, we had a two month long discussion on my board about whether Bootleg was doing a good or a selfish deed with his latest CD-ROM project (he was involved in the discussion). I guess it's open to debate still. Personally, I am of the mind "the more information dissemination, the better". And it'd be nice to have all those P/H text files on one little disc than filling up my HD. I don't think he's going to make enough money off of it to qualify for "raping the scene". But I guess it remains to be seen... Michael | "I tell you one must still have (inhuman@mindvox.phantom.com) | chaos in one to give birth to | a dancing star!" -Nietzsche [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 199 of 447 Subject: Re: CellularModem From: thug (Murdering Thug) Date: Sun, 03 Jan 93 14:52:17 EST inhuman (Inhuman) writes: > God, we had a two month long discussion on my board about whether > Bootleg was doing a good or a selfish deed with his latest CD-ROM project > (he was involved in the discussion). I guess it's open to debate still. > Personally, I am of the mind "the more information dissemination, the > better". And it'd be nice to have all those P/H text files on one little > disc than filling up my HD. I don't think he's going to make enough > money off of it to qualify for "raping the scene". But I guess it > remains to be seen... I wish the best of luck to Bootleg. I just hope he prices his CD in the range where it is affordable to everyone; a good price would be something like $19.95, $29.95, or $39.95, or $49.95 at the maximum. If he ends up charging anything above $49.95 for it, then he would be perceived as raping the scene. I often fantasize of what it would be like to see a CD such as that being -- more (53%) -- advertised in the back of PC Magazine or Byte. It would mean that the average public could get instant and cheap access to all of Phrack,ATI,LOD/TJ,Syndicate Reports, CUD, DFP, and the dozen or so other electronic mag archives. I think it would make people like John Dvorak, Jim Seymour, Jerry Pournelle, etc.. shit in their pants when they see the ad and review the CD. I think Jack Rickard would have a heart attack once he realized that 12 and 13 year old kids could get instant and cheap access to the accumulated wealth of knowledge of the computer underground, especially if Bootleg puts a heaping dose of anarchy files on the CD as well. One thing I really hope for is that the CD-ROM has a good text/search engine and an extensive index. The other thing I want is for it to be ISO-9660 and not use any proprietary formats to store the text. Thus it would be possible to put up his CD-ROM disk on a BBS, just like many sysops put up PC-SIG or Nightowl or whatever.. Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 200 of 447 Subject: Re: CellularModem From: lgas (Laughing Gas) Date: Sun, 03 Jan 93 20:20:03 EST In-Reply-To: How about $99.95? That's what he is purposing I believe. Of course, what he is doing is selling it to certain "distributors" and allowing them to price it themselves. He offered to allow me to be a distributor, and I fully intend to take him up on that offer. I fhe does, regardless of what price he charges me, I will pass them on for cost.. which I assume will be closer to $29.95-$49.95. Laughing Gas [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 201 of 447 Subject: Re: CellularModem From: obscure (Paul Leonard) Date: Sun, 03 Jan 93 20:20:21 EST In-Reply-To: And if he put on even half of the cDc files he'd probably have some legal problems if the kiddies got hold of it. I think it'd be GREAT! 600 megs of the archives of our childhood. paul [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 202 of 447 Subject: Bootleg on CD rom From: deadboy (The Dead) Date: Sun, 03 Jan 93 23:05:58 EST In-Reply-To: From what I remember of those wars way back then which isn't much, everyone was always angry with Bootleg because he was a lowlife. It's not that information "wants to be free" which is a great attitude to take if its not your information, but its taking information that is free in the first place and doesn't belong to you, wasn't written by you and then selling it to people at outrageous prices. Which is exactly what Bootleg always did with the Bootlegger magazine that managed to make so many people mad. Text files were always passed around for free, when someone takes something that is free and starts charging a price that is obviously way over the cost needed to duplicate the materials, pay for postage and make a little money on the side, then what you have is a thief who is ripping people off, which is what Bootleg always was. The Dead Shall Rise [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 203 of 447 Subject: Re: CellularModem From: thug (Murdering Thug) Date: Sun, 03 Jan 93 23:25:55 EST obscure (Paul Leonard) writes: > And if he put on even half of the cDc files he'd probably have some legal > problems if the kiddies got hold of it. I think it'd be GREAT! 600 megs > of the archives of our childhood. Yeah, I wonder if the parents of a 13 year old who lights up a pound of thermite and melts a giant hole through three floors of a family house would sue Bootleg. Hmm, maybe not.. Deadboy: I agree that Bootleg should not rip people off by charging more than $49.95 retail. After all, CD-ROMS cost only $3/disk when duplicated at 1000 piece quantities, he can charge $29.95 and still make 1000% profit and not rip anyone off. However, just because he may be scum of the earth in your eyes, does not give you the right to criticize him for making a living. I mean MindVox charges for access, and yet 95% of the files in the archives were not written/created by the P.A.T. crew. Everyone has the right to make money if they are providing a value added service like -- more (47%) -- putting up an online system or putting out a CD-ROM that is indexed and organized so that people w/o net access can read the p/h history. The only time I criticize people who try to earn money is when they are doing it in a manner that is either dishonest or exploits the phreak/hack community. I DO think $99.95 is too much, but I don't know how much effort Bootleg has put into his work, maybe he's been indexing and re-formatting these files by hand for the past 2 years and has created a truly valuable product. If on the other hand he has merely ftp'd down some files, stored them on tape and sent the tape off to a CD-ROM mastering plant, then he has no right charging $99.95 for the product. The one thing I can say for sure is that Bootleg is not hurting the phreak/hack community, only making it thrive more by giving the masses to read our story from our philes, and not getting their info from FILTHY ROTTING SCUM RAT BASTARDS like the Forbes writers. I wish Bootleg the best of luck, and unless he proves to me otherwise, I am considering him an honest and decent businessman. His history may be shaky from people who talk about him, but how do I know they are not merely slandering him because he wrote in uppercase and 40 columns and that pissed people off too much? Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 204 of 447 Subject: Re: CellularModem From: terminus (Len Rose) Date: Mon, 04 Jan 93 01:40:04 EST In-Reply-To: Explain this comment: "The one thing I can say for sure is that Bootleg is not hurting the phreak/hack community, only making it thrive more by giving the masses to read our story from our philes, and not getting their info from FILTHY ROTTING SCUM RAT BASTARDS like the Forbes writers. " Len -- more (87%) -- Len Rose len@netsys.com "So mote it be..." [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 205 of 447 Subject: Re: CellularModem From: chrmsync (Chrome Sync) Date: Mon, 04 Jan 93 02:46:57 EST In-Reply-To: (just when I feared I was losing my touch at starting a good talk ... (after social:politics slowed down)) Personally, I'd like to see it low cost -- I think we all support open-access to data, even (in some cases) "proprietary data" (but that's another argument, perhaps) And let's face it, a high-cost nostalgia trip (for some)(others: a wonderous journey through the history of some underground) isn't *it*. I wouldn't mind a higher price *IF* the profits went to a free systems where users could d/l stuff (much like EFF with ftp.eff.org)(which is where I went recently and found old BOOTLEGGER issues)(my opinion of their data is: copiously copied (perhaps contemptuously)). Sharing information, with credit where it's due, seems ideal. Well, it's the end of my shift here at work (network/computer operator)(easy way to get root access!!) -- more (84%) -- I'm tired, hungry, and sleepy. Type to ya later ... [ Cyber-Renaissance Man ] || || || Chrome Sync || || || [and non-eeleete MacGuru] [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 206 of 447 Subject: Bootleg's CD From: redeye (Sigmund Obispo) Date: Mon, 04 Jan 93 04:38:07 EST In-Reply-To: If people think its a ripoff, they won't buy it. If its overpriced, then sell it for less. Its not like BL has a chance of actually copyrighting any of the material on this vapor-CD. Or does he? -redeye [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 207 of 447 Subject: Re: Bootleg's CD From: thug (Murdering Thug) Date: Mon, 04 Jan 93 09:42:13 EST redeye (Sigmund Obispo) writes: > If people think its a ripoff, they won't buy it. If its overpriced, > then sell it for less. Its not like BL has a chance of actually > copyrighting any of the material on this vapor-CD. That's right, market forces will decide. After all, if Bootleg fucks it up, the material is assumed to be P.D. (no one has ever claimed otherwise) and someone else can easily make a competing phreak/hack CD-ROM with basically the same material, better formatting and indexing, and a lower price. The one sticky point is that the material is usually "copyrighted" by the creators, such as Phrack being copyrighted by Phrack Inc. (a non-existant corporation). Even so, it is copyrighted and that will stand up in court. It might be a good way for KL to make some money and pay his legal debts at the same time, by requesting that people who SELL issues of Phrack in any way (this would exclude eff.org, but may include Bootleg and perhaps pay-for-use systems like MindVox, Compuserve, Exec-PC, and others which charge for access to read Phrack) to pay him and TK royalties or -- more (51%) -- else be sued for copyright infringement. Perhaps Craig should start calling 1-800-LAWYERS right now.. I may be mistaken in that Compuserve has Phrack, but they do stock CUD and other files. I know Exec-PC has Phrack online and does charge for access and is a for-profit 300 line system. I would assume that Emmanuel Goldstien would do something similar if someone scanned in all the issues of 2600 and put them up online without his permission and without paying him a single red cent. Why should 2600 have more copyright protection because it's hardcopy and Phrack have no copyright protection because it's software (electronic text)? Bootleg and others who wish to make a profit off the scene better think about these questions carefully or they may stumble into a rat's nest of legal liability. It's not the same as people who re-sell "shareware" on disks because shareware is clearly marked in a way that allows such activity within limits. None of these text files are marked in this "shareware" manner, and may of the text philes are copyrighted, even if they are under crazy names like Swamp Ratte. Speaking of which, the cDc files are also copyrighted. Welcome to the real world d00dz.. Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 208 of 447 Subject: Re: Perot BUSTED! for hacking Equifax From: carlos (Carlos dominguez) Date: Mon, 04 Jan 93 13:59:49 EST thug (Murdering Thug) writes: > since he's bald enough already.. I hope that paranoid weasel gets put away > for a long time... Die you weasel!! Die!!! ...oops.. sorry, got carried > away a little. Whatever, I think it's funny that Perot gets busted for > hacking.. > I can just see it.. Perot's big ears flapping like Dumbo's as the juice goes through his skull..... PHPTTH! (sick mode off) ___ ___ __ . ___ __ // Carlos Dominguez, MS-DOS Enthusiast ! / /__/ /_ ) / / / /_ // | carlos@infoserv.com carlos@dorsai.com (__ ( / / \ (__ (__/ __/ .. | carlos@phantom.com FIDONET 1:278/706 [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 209 of 447 Subject: Simple Tracing From: dexter (M. Lawrence Lopp) Date: Mon, 04 Jan 93 16:11:20 EST Ok. Time for another question. What is the simplist way to track down where a telephone number is located? I realize that through the use of the Area Code and Prefix you can narrow down the general area with a little help of your local phone book, but WHAT is the next step? -dex [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 210 of 447 Subject: Re: Simple Tracing From: kieran (Aaron Dickey) Date: Mon, 04 Jan 93 16:43:25 EST dexter (M. Lawrence Lopp) writes: > What is the simplist way to track down where a telephone number is > located? I realize that through the use of the Area Code and Prefix > you can narrow down the general area with a little help of your > local phone book, but WHAT is the next step? a) Go to the library and look up the phone number in a reverse directory. It's basically a phone book in reverse: all the numbers are listed in order, with names and addresses next to them. b) Use Phone*File on CompuServe. Punch in the number, it'll spit out the owner. c) Hack it out, d00d. --Aaron -- more (96%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 211 of 447 Subject: Re: Simple Tracing From: thug (Murdering Thug) Date: Mon, 04 Jan 93 17:15:12 EST kieran (Aaron Dickey) writes: > dexter (M. Lawrence Lopp) writes: > > > What is the simplist way to track down where a telephone number is > > located? I realize that through the use of the Area Code and Prefix > > you can narrow down the general area with a little help of your > > local phone book, but WHAT is the next step? > > a) Go to the library and look up the phone number in a reverse directory. > It's basically a phone book in reverse: all the numbers are listed in > order, with names and addresses next to them. Ditto, remember to ask for the "Cole's Address Telephone Directory". There are other companies as well, besides for Cole's. However, the directory will not, obviously let you track down unlisted numbers. > b) Use Phone*File on CompuServe. Punch in the number, it'll spit out the -- more (71%) -- > owner. Phone*File pretty much sucks, it is out of date by about two years, and only about 50% accurate. Phone*File is assembled from mailing list information, not White Page directories, basically very lame. > c) Hack it out d00d. Agreed, but not needed since most info can be social engineered out of the local business office. Even unpublished numbers, if you're good enough. Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 212 of 447 Subject: Re: Simple Tracing From: nihilis (Joel Boutros) Date: Mon, 04 Jan 93 18:19:36 EST dexter (M. Lawrence Lopp) writes: > Ok. Time for another question. > > What is the simplist way to track down where a telephone number is > located? I realize that through the use of the Area Code and Prefix > you can narrow down the general area with a little help of your > local phone book, but WHAT is the next step? Welp, there shoud be a book called POLK'S at your local library. It's a list of everyone by phone number, as long they're not unlisted numbers. COLT'S is another one. Most of the people who use it are like business mailing list people.. It'll say a name, an address, some other info, methinks. ALso lists by address in another section.. ame, too. (err name) |:- Wanna fight about it?! (grin) -:| |:- nihilis@phantom.com -:| -- more (91%) -- |:- Joel Boutros -:| [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 213 of 447 Subject: Re: Simple Tracing From: redeye (Sigmund Obispo) Date: Mon, 04 Jan 93 19:32:33 EST In-Reply-To: I think the _simplest_ way is to call and ask. Sorry, couldn't resist. -red [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 214 of 447 Subject: Re: Simple Tracing From: thug (Murdering Thug) Date: Mon, 04 Jan 93 20:13:49 EST Well first let me say that the topic for this thread is completely wrong in the first place. _Tracing_ is something completely different from what we are discussing. What we are discussing is usually refered to as "backing out a number" in the private investigator profession. redeye (Sigmund Obispo) writes: > I think the _simplest_ way is to call and ask. Sorry, couldn't resist. Well yes, that would work for the majority of the public. If I call up let's say xxx-yyyy and ask "Excuse me, I'm wondering if I reached the correct number, who am I speaking to please?", most non-paranoid Joe Average types will give you their first and last name, then it's merely a step away to look them up via the White Pages and directory assistance and get their address and the rest of their info if need be. However, this WILL NOT WORK if you are dealing with either the number to a -- more (89%) -- computer, fax machine, or most hacker/phreak types who are extremely paranoid and suspicious. Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 215 of 447 Subject: Re: Crackdown progress? From: doug (Douglas Luce) Date: Tue, 05 Jan 93 12:02:33 EST alibaba (Nick Mordanzo) writes: > Lotus you're an idiot. Don't take that the wrong way but you know 0 about > hacking that you haven't read from the media magazines and seen on TV. > Everything you say is like lip-synching NITELINE or something. lotus represents probably 99.9% of the "computer underground." 99.9% cuz after all, the media has ta have SOMEONE to point it's fantasy finger at. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 216 of 447 Subject: Re: Simple Tracing From: dexter (M. Lawrence Lopp) Date: Tue, 05 Jan 93 13:48:55 EST thug (Murdering Thug) writes: > redeye (Sigmund Obispo) writes: > > > I think the _simplest_ way is to call and ask. Sorry, couldn't resist. > > However, this will not work if you are dealing with either the number to > computer, fax machine, or most hacker/phreak types who are extremely > paranoid and suspicious. > > Thug > Calling the number will also not work for the case in question -- when the phone line in the house in question is being used to forward calls to another location. -- more (65%) -- Which brings me to my NEXT question -- Ok, you have a suspect house which has phones connected to it -- what is the simplist way, short of going in the house and picking the phone up, to determine whether the line is active or not? I'm assuming that I'm unable to call the number in question and be able to hear if the phone in the house will ring. dex- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 217 of 447 Subject: Re: Simple Tracing From: thug (Murdering Thug) Date: Tue, 05 Jan 93 17:07:36 EST dexter (M. Lawrence Lopp) writes: > Calling the number will also not work for the case in question -- > when the phone line in the house in question is being used to forward > calls to another location. > > Which brings me to my NEXT question -- Ok, you have a suspect house > which has phones connected to it -- what is the simplist way, short > of going in the house and picking the phone up, to determine whether > the line is active or not? > > I'm assuming that I'm unable to call the number in question and be > able to hear if the phone in the house will ring. > > dex- I don't know what you're trying to do or trying to find out about whoever, but maybe you should just either (a) get a life! -- more (47%) -- (b) just hire a P.I. or whatever. If you have a legitimate reason for obtaining such information, a P.I. will be glad to oblige. Even if you don't, most P.I.'s are scummy characters and will oblige as well. If you are trying to obtain information on someone who you wish harm upon, and who hasn't done anything to you, I hope you drop dead. Or better yet, I hope someone decides to stalk you and make your life a miserable hell. I am NOT giving you the information directly about tracking down people/information, because, for all I know, you could be a crazed psychopath or a stalker of some kind. In which case, get a life, or better yet, just go get laid you geek. However, if you have legitimate reasons for knowing this stuff, such information is easily found in books available from Loompanics, Paladin Press, and other outfits. Also, you might want to read various P.I. industry mags and order various P.I. training manuals and books. Thug -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 218 of 447 Subject: Re: Simple Tracing From: dexter (M. Lawrence Lopp) Date: Tue, 05 Jan 93 18:14:00 EST In-Reply-To: Was wondering when I was going to touch a nerve -- took roughly 30+ messages before someone questioned my motivation. I'm a detective novelist based in the Silicon Valley -- been writing and researching a new novel I've been working on for the past couple of months and while the bulk of the novel is done, I'm making another pass through to verify "technical accuracy". Judging from the questions I've posed, you'll realize that much of the novel concerns "hacking" -- if you've read my introduction, you'll realize that I've been a part of CyberSpace for 10 years now and since "The Hacker Crackdown" has explored the nonfictional of "hacking" -- I chose to explore the "hacking" world as part of a fictional scenario, probably because it makes it easier to make much of the technical information more palatable for the computerIlliterate. So, -- more (88%) -- a) I appreciate y'all answering my questions b) I intend no ill will to anyone c) I have a life, barely... -dex [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 219 of 447 Subject: Re: Simple Tracing From: nihilis (Joel Boutros) Date: Tue, 05 Jan 93 19:06:13 EST dexter (M. Lawrence Lopp) writes: > Was wondering when I was going to touch a nerve -- took roughly > 30+ messages before someone questioned my motivation. > > I'm a detective novelist based in the Silicon Valley -- been writing > and researching a new novel I've been working on for the past couple > of months and while the bulk of the novel is done, I'm making another > pass through to verify "technical accuracy". Oh, well.. since you're only half a sicko, have Mr. Character check the impedence on the line. Depending, this might lower the impedence anyways and trip the "Someone's On The Phone Light" on recent phones. Or, check the voltage going through the wire. 48 volts if NO ONE is on the line, 6 if someone is. |:- Wanna fight about it?! (grin) -:| -- more (86%) -- |:- nihilis@phantom.com -:| |:- Joel Boutros -:| [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 220 of 447 Subject: Hacking in Fiction. From: ozone (Al Macey) Date: Tue, 05 Jan 93 19:23:58 EST In-Reply-To: <35HXwB4w165w@mindvox.phantom.com> This kind of brings up an interesting point. Awhile ago I began writing a "hacker" story and I had this problem, because I wasn't sure if I should include certain "how to" comments, such as effective beige boxing, and whatnot. As a result, the story seemed really wishy washy. When I began writing the story, in 1987, I hadn't explored any of the legal problems with including such "how-to" comments in fictional works. I have since stopped working on the story because I lost interest (read: I have been too lazy), but I'm curious if anyone would know what sort of a liability it might be to a writer if he included a "how-to" statement in a novel which was used by some punk? Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 221 of 447 Subject: Re: Hacking in Fiction. From: thug (Murdering Thug) Date: Tue, 05 Jan 93 21:25:13 EST ozone (Al Macey) writes: > too lazy), but I'm curious if anyone would know what sort of a liability > it might be to a writer if he included a "how-to" statement in a novel > which was used by some punk? I was just discussing a similar problem with a friend who recently sold a "hacker movie" script to a big studio in Hollywood. When he was working on the script, I gave him any technical help he needed, but he was not sure whether to put detailed instructions into the script for fear of legal liability. In the end, he pretty much glossed over the intense sort of stuff (ie: reprogramming your local 5ESS switch), but decided to take a chance at showing on screen how a red box tape is made using two payphones, an inductive coupler, and a mini tape recorder. Hopefully it will make it to film. The only time I know of when a book had serious legal problems was when Radio Shack / Tandy published their first "red book" (Understanding -- more (54%) -- Telephone Electronics). The first printing had detailed information about various switching equipment, trunks, and MF frequencies. This was a bad choice of writing for them, especially during the blue box mania of the mid-1980's. Bell Labs and AT&T threatened them with legal actions, and subsequent printings had the detailed stuff replaced by useless block diagrams. If you look on the inside cover of a current version of the book, you will see a detailed liability disclaimer which wasn't there in the first printing. This is in case, Joe Shmuck of Generic Cellular Telephone Corp decides to sue Tandy because they explain the concept of "cells" or even mention (gasp!!) what an ESN or MIN is. Smells a bit like censorship, don't it? All of this info is available in the Bell Technical Journals at any library, but I guess the general public doesn't go to the libraries, while Rat Shack's books are read by many more people. Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 222 of 447 Subject: Re: Simple Tracing From: enzyme (David Pincus) Date: Tue, 05 Jan 93 23:27:03 EST nihilis (Joel Boutros) writes: > Oh, well.. since you're only half a sicko, have Mr. Character check the > impedence on the line. Depending, this might lower the impedence anyways > and trip the "Someone's On The Phone Light" on recent phones. Or, check > the voltage going through the wire. 48 volts if NO ONE is on the line, 6 > if someone is. But a good line tap will compensate for the drop in impedance. A better way is to monitor the line with an oscilloscpe and log the impedance change when you pick up the phone. Most line taps remain off until you pick up the phone, and then turn on to start recording/logging. Blue shirts in the city. Run! [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 223 of 447 Subject: Re: Simple Tracing From: thug (Murdering Thug) Date: Tue, 05 Jan 93 23:47:58 EST enzyme (David Pincus) writes: > nihilis (Joel Boutros) writes: > > > Oh, well.. since you're only half a sicko, have Mr. Character check the > > impedence on the line. Depending, this might lower the impedence anyways > > and trip the "Someone's On The Phone Light" on recent phones. Or, check > > the voltage going through the wire. 48 volts if NO ONE is on the line, 6 > > if someone is. > > But a good line tap will compensate for the drop in impedance. A better > way is to monitor the line with an oscilloscpe and log the impedance > change when you pick up the phone. Most line taps remain off until you > pick up the phone, and then turn on to start recording/logging. Actually, an inductive tap can do pretty much the same thing, without having to even cut into the wires, and without depleting any voltage that would be noticed by a cheap inline tap detector. -- more (97%) -- [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 224 of 447 Subject: Re: Simple Tracing From: critic (Terry Palfrey) Date: Wed, 06 Jan 93 02:40:22 EST In-Reply-To: <2PFXwB1w165w@mindvox.phantom.com> You could post a/the contextual paragraph and see what happens. CritiC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 225 of 447 Subject: Fictional Hacking From: dexter (M. Lawrence Lopp) Date: Wed, 06 Jan 93 13:40:40 EST In-Reply-To: From a fictional writers standPoint, 95% of everything I've read on this board would be MUCH too techincal for the average detective novel enthusiast -- this means that when it comes time to write about such things as cellular phones, "backing out of a number", etc... I have to gloss over the details for fear of losing the reader who drops a load when they read the word impendence. I'm not saying that they're aren't the folks out there who would be more than comfortable wandering through technoJargon concerning cellular phones and what not, but for a novel to be successful -- it must appeal to widest range of people. This fact protects much of my novel from legal problems. And, when I do get technical, I use the basic ideas of whatever technique I'm explaing and the hardCore specifics -- I've found that most people find that much more intriguing, anyway. -- more (78%) -- Anyway -- I also have another question concerning the location of files involving interstate drug trafficking. If someone is convicted of such a thing (and they cross state lines), these "records of conviction" will become a part of the FBI files? Is this true? -dex. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 226 of 447 Subject: Re: Simple Tracing From: nihilis (Joel Boutros) Date: Wed, 06 Jan 93 18:17:07 EST enzyme (David Pincus) writes: > nihilis (Joel Boutros) writes: > > > Oh, well.. since you're only half a sicko, have Mr. Character check the > > impedence on the line. Depending, this might lower the impedence anyways > > and trip the "Someone's On The Phone Light" on recent phones. Or, check > > the voltage going through the wire. 48 volts if NO ONE is on the line, 6 > > if someone is. > > But a good line tap will compensate for the drop in impedance. A better > way is to monitor the line with an oscilloscpe and log the impedance > change when you pick up the phone. Most line taps remain off until you > pick up the phone, and then turn on to start recording/logging. > Well, I thought question was if someone was using the phone. This would work in this case.. the voltage idea should always work, except unless you're planning on not using resisters.. you'll probably end up frying -- more (64%) -- something. A few logic gates would do it. (oh, BTW: Chances are, I'm dangerously out of place, I've never tried any of it, but I know what the 48 volts is, I know one can design hardware, and if they're REALLY bored/rich, software that can do this..) I might try it one day just to see if it'll owrk, tag it on my phone box outside and hope the phone company doesn't come often. |:- Wanna fight about it?! (grin) -:| |:- nihilis@phantom.com -:| |:- Joel Boutros -:| [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 227 of 447 Subject: Technical Fiction. From: ozone (Al Macey) Date: Wed, 06 Jan 93 18:29:14 EST In-Reply-To: <9iaZwB1w165w@mindvox.phantom.com> I'd have to agree with Dex about the ability of a readership to grasp (or even care about) most of the technical conversation regarding Ma Bell on this or any other such database. Then again, insulting your readership by not including at least rudimentary facts is never a good idea. When I postedmy story on the local VAX here, in order to weed out some of the problems with the plot, et al., I posted two versions: one with tech, one without. Many of the readers complained that they didn't care about the finer points of an MP-5 or the relative spead of a Seagate hardrive, and said that it was more a distraction than a focal point. I guess it might really depend on the story. Then again, this topic is not really condusive to the "thread" of this particular forum, now is it? I'd still like to hear more about the liability of including such info in a fictional story, if there are any actual lawyers out there. I mean, if they can confiscate GURPs Cyberpunk (or whatever) from Steve Jackson because it is a "tutorial on hacking," who is to say that your average work of fiction can't be considered the same thing? -- more (96%) -- Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 228 of 447 Subject: Re: Fictional Hacking From: thug (Murdering Thug) Date: Wed, 06 Jan 93 18:34:37 EST dexter (M. Lawrence Lopp) writes: > Anyway -- I also have another question concerning the location of > files involving interstate drug trafficking. If someone is convicted > of such a thing (and they cross state lines), these "records of > conviction" will become a part of the FBI files? Is this true? > > -dex. Yeah, it's all put into NCIC (National Crime Information Center), the FBI's computer center, even non-interstate crimes, especially any felonies. NCIC _is_ Big Brother. It's not just one computer, it's an entire center of computers. Basically if you're a fugitive and you're arrested for jay walking, when the cop runs you through NCIC, you're toast buddy.. Here's some advice for fugitives out there: don't carry any ID, erase your fingerprints with acid, and if you are ever hassled/questioned for anything minor, don't tell the cops anything, not even your name, just keep your mouth shut, pretend like you don't understand anything. If they -- more (60%) -- can't identify you, they HAVE to release you within 48 hours or charge you with a crime. And they cannot charge you with a crime if they do not know your identity. Neither can they fill out any search or arrest warrants if they cannot identify you by any name. If they try to take your photograph, make sure to smile widely or at least have a different expression on your face than the expression you had on your face when they took the photo that's inside the NCIC computers. This way, if they run your newest photo through NCIC for a pattern match, the chances are very small that the neural net / expert system at NCIC will match up the two photos and pop up your real identity. New facial hair is highly recommended if you're on the run. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 229 of 447 Subject: Re: Fictional Hacking From: ozone (Al Macey) Date: Wed, 06 Jan 93 22:07:33 EST In-Reply-To: Thug, it scares me that you know all this stuff. (Erasing for finger prints with acid?> Man, that doesn't sound pleasant.) Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 230 of 447 Subject: Re: Fictional Hacking From: siva (The Destroyer) Date: Thu, 07 Jan 93 01:05:14 EST In-Reply-To: Oh, man, don't tell me you're falling for it too!. Listen, Thug is a 41 year old woman in Water Pass, Missouri who's husband used to work for data general. He talked about work incessantly, she listened and remembered. He died in 1983 of a heart attack, she's been living through this persona ever since. I met her once at a Denny's. We both got drunk, we went back to her place, but I was too wasted... We parted amiably. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 231 of 447 Subject: Re: Fictional Hacking From: drow (Doug Rau) Date: Thu, 07 Jan 93 04:15:34 EST siva (The Destroyer) writes: > Oh, man, don't tell me you're falling for it too!. Listen, Thug is a 41 > year old woman in Water Pass, Missouri who's husband used to work for data > general. He talked about work incessantly, she listened and remembered. > He died in 1983 of a heart attack, she's been living through this persona > ever since. > > I met her once at a Denny's. We both got drunk, we went back to her > place, but I was too wasted... > > We parted amiably. > > Gosh who would have thought it? It almost reminds me of these people that I used to know in Buford CO who knew Farmer before he got big in snowboarding and decided to try to capitalize on their exquisite knowledge of the industry by designing a truly -- more (71%) -- rad board. Except they got confused and put trucks on it. So Martin was running the gauntlet in Tahoe when a truck (i don't know why he didn't take them off) caught on a rock and he fell about a hundred feet into powder. He submarined four feet and died before anyone could get to him. He went to Denny's, too. : drow : [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 232 of 447 Subject: Re: Fictional Hacking From: critic (Terry Palfrey) Date: Thu, 07 Jan 93 14:54:49 EST In-Reply-To: There is a phile on redspread.css.itd.umich.edu in the Illuminatus section about the Lenny.Consp in files/hidden/orders/lodges/Illumina tus/current/ CritiC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 233 of 447 Subject: Garbage. From: ozone (Al Macey) Date: Thu, 07 Jan 93 19:14:58 EST In-Reply-To: <3TV1wB1w165w@mindvox.phantom.com> When you throw something away, who owns it? Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 234 of 447 Subject: Re: Fictional Hacking From: thug (Murdering Thug) Date: Thu, 07 Jan 93 20:17:35 EST siva (The Destroyer) writes: > Oh, man, don't tell me you're falling for it too!. Listen, Thug is a 41 > year old woman in Water Pass, Missouri who's husband used to work for data > general. He talked about work incessantly, she listened and remembered. > He died in 1983 of a heart attack, she's been living through this persona > ever since. > > I met her once at a Denny's. We both got drunk, we went back to her > place, but I was too wasted... > > We parted amiably. It's a lie! A lie I tell you! I am not a 41 year old woman.. Damn you.. I am actually a Nazi war criminal who is hiding out in a small log cabin somewhere in the thick forests of Saskatchawan. During the day I hunt small rodents with my Luger pistol, and at night I log into the Vox -- more (55%) -- through the use of a mind modem that was implanted into my head by Dr. Mengele in 1941. Right now it goes at only 50 baud, which was considered top speed and a mark of true eliteness 52 years ago. I will soon be doing a self-upgrade to v.32bis/16.8k/fax by adding a DSP chip and a pirated copy of the Zyxel eproms which I ftp'd down from the net. When this occurs, I will be able to set up a SLIP feed from phantom.com straight into my mind. I venture into town to purchase supplies once every 6 months, and I do happen to dress like a 41 year old woman as my disguise, but ONLY to get supplies. I AM NOT SOME KIND OF PERVERT/SICKO, YOU KNOW? Damn, I wish people would just stop spreading these insane rumors.. tm Murdering Thug [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 235 of 447 Subject: Re: Garbage. From: nihilis (Joel Boutros) Date: Fri, 08 Jan 93 07:47:03 EST ozone (Al Macey) writes: > When you throw something away, who owns it? The person who finds it next. ... Finder's Keepers, Loser's Weepers. |:- Wanna fight about it?! (grin) -:| |:- nihilis@phantom.com -:| |:- Joel Boutros -:| [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 236 of 447 Subject: Re: Fictional Hacking From: dexter (M. Lawrence Lopp) Date: Fri, 08 Jan 93 13:21:53 EST In-Reply-To: Does the Freedom of Information Act apply to the files located in the NCIC? I was under the impression that it applied to all government files... -dex [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 237 of 447 Subject: Re: Fictional Hacking From: awright (Andrew) Date: Fri, 08 Jan 93 13:33:18 EST Howdy, I'm not a lawyer, but I play one on TV ... Actually, although I'm not a lawyer, I did just take a Constitutional Law class. It's my understanding that, in the current legal climate, anything you publish is o.k. as long as it is not directly a call to action. That means that information about illegal activities is perfectly legal as long as it is just information and not action. Companies may not like this, as when BellSouth threatened 2600 magazine, but they don't actually have any legal standing. Fiction, even with real information, should certainly be fine. You could try asdking one of the EFF peiople for more information (I think Rita Rouvalis is on Vox), the general address is eff@eff.com. Andrew [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 238 of 447 Subject: Re: Fictional Hacking From: ozone (Al Macey) Date: Fri, 08 Jan 93 14:18:31 EST In-Reply-To: <7Pm3wB1w165w@mindvox.phantom.com> Man, I'm getting a lot of line noise. Anyway, I hadn't even thought to ask an EFF person about this stuff....heh. I sure look the lamer now, don't I? Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 239 of 447 Subject: Re: Fictional Hacking From: inhuman (Inhuman) Date: Fri, 08 Jan 93 15:34:14 EST In-Reply-To: Andrew is mostly right. It's not illegal to talk about or even write instructions for doing illegal things. Thus, you would have nothing to fear from the government. But, conceivably you could be sued by a corperation that asserts that you have published "trade secrets" that have hurt its profits or allowed their competitors access to information they shouldn't have had access to. I don't think there are any successful cases of such lawsuits involving computer crime. Bellcore tried threatening 2600 magazine with this type of lawsuit, but they don't have a foot to stand on since THEY HAVE NO COMPETITORS. So, I wouldn't worry too much about the legality of publishing specifics. The most you'll get is a harassing phone call from Bellcore or someone. Michael | "I tell you one must still have (inhuman@mindvox.phantom.com) | chaos in one to give birth to | a dancing star!" -Nietzsche [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 240 of 447 Subject: Re: Fictional Hacking From: drow (Doug Rau) Date: Fri, 08 Jan 93 21:56:49 EST ozone (Al Macey) writes: > Man, I'm getting a lot of line noise. Anyway, I hadn't even thought to > ask an EFF person about this stuff....heh. I sure look the lamer now, > don't I? [>ood, i was looking the lamer back when i was 13. Hope that isn't condescending or anything... :) : drow : [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 241 of 447 Subject: Re: Fictional Hacking From: ozone (Al Macey) Date: Fri, 08 Jan 93 22:11:19 EST In-Reply-To: Heh heh heh. Cute. Ozone - Surreal McCoy [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 242 of 447 Subject: Tymnet From: lotus (Matthew Naparty) Date: Sat, 09 Jan 93 20:31:44 EST In-Reply-To: Does anyone know a tymnet # for New York City? Or maby u know where I can get the # or #s for tymnet......... I believe it's a network which serves banks, companies n such........ thanx Lotus....... (__) oo ) |_/\ CuLt Of ThE dEaD cOw (: [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 243 of 447 Cc: ÿ Subject: Re: Fictional Hacking From: dream11 (Eric L. Tompkins) Date: Sat, 09 Jan 93 20:53:41 EST dexter (M. Lawrence Lopp) writes: > Does the Freedom of Information Act apply to the files located in > the NCIC? I was under the impression that it applied to all > government files... > > -dex It applies to all federal information, however each request is reviewed by the originator to determine if it can be released. Many unclassified docs are not releasable because they would reveal personal information or could compromise a government acquisition. Eric [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 244 of 447 Subject: Re: Tymnet From: carlos (Carlos dominguez) Date: Sun, 10 Jan 93 12:18:20 EST lotus (Matthew Naparty) writes: > Does anyone know a tymnet # for New York City? Or maby u know where I > can get the # or #s for tymnet......... I believe it's a network which > serves banks, companies n such........ > thanx Call the compuserve 800#, 1-800-go-phones (I think?) I think they use telenet/tymnet too.. ___ ___ __ . ___ __ // Carlos Dominguez, MS-DOS Enthusiast ! / /__/ /_ ) / / / /_ // | carlos@infoserv.com carlos@dorsai.com (__ ( / / \ (__ (__/ __/ .. | carlos@phantom.com FIDONET 1:278/706 [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 245 of 447 Subject: Hacker Beginings From: asa (Matthew Bell) Date: Sun, 10 Jan 93 14:08:13 EST In-Reply-To: <0k96wB3w165w@mindvox.phantom.com> I personally am still in school and extremly interested in the world of the Matrix and such, it intrigues me as well as does the hacking sides of it. I as most people have done before getting on networks rana a small BBS for a short time in a local limeted area that may get a total of 100 users if your lucky. Even at that level the curiosity of hacking is there. Thouhg as a system operator it is your duty to keep them out I suppose, I was always hoping that someone would try that I might see how they went about it. Perhaps this is the way some people got hooked on hacking or maybe they just said I need some info on oh say military outposts, and then called one up and hacked it. I don't know how many people on here have actually gone hacking or just know about it, I persoannly have no Idea where to start if I were to hack, (might be a nice Idea for a book from someone) but calling here recently and finding such emense amounts of information on subjects that interest me and also world known persona like Bruce Sterling, phiber Optic and Emmanule Goldstien, just adds to my curiosity. Perhaps the main deterant of hacking for me was the ethics behind it, the fear of the Feds or whatever -- more (85%) -- protection is out there. but here is my question (finnaly) For those of you who have hacked, did the ethics actually come into question? or rather did the Curiosity far outway the downb sides? A A S [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 246 of 447 Subject: Re: Hacker Beginings From: chemist (The Chemist) Date: Sun, 10 Jan 93 16:28:13 EST asa (Matthew Bell) writes: > For those of you who have hacked, did the ethics actually come into > question? or rather did the Curiosity far outway the downb sides? > > A A > S It was exploration and didn't have anything to do with the good and bad bullshit that is being sold today. It had nothing to do with names or issues and right vs. wrong vs. whatever, it was interesting and fun. In the near past its stopped being that way. -tC [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 247 of 447 Subject: Re: Hacker Beginings From: toxic (Toxic Avenger) Date: Sun, 10 Jan 93 16:16:52 EST In-Reply-To: >Perhaps the main deterant of hacking for me was the ethics behind it, >the fear of the Feds or Whatever protection is out there. Ummm, I don't see the threat of a bust as being an ethical question, I mean it is highly impractical to get busted, but is it unethical? I do not have a FEAR of feds, but I do keep a watchful eye and ear out for things going on, and can disappear when the heat gets turned up. I don't want to get nailed any more than you do but it doesn't slow me down too much. The ethics of hacking are much more complex than the average day-to-day ethics. First off, a hacker does something that everyone else thinks is TERRABLY WRONG. However it isn't (at least in my mind) One of the most amusing statements I have heard is something alung the lines of 'Hackers complain about their freedom of privacy being breached, but isn't that what the do to us???' My answer is NO! A hacker respects privacy, more than the average person, especially in cyberspace, because he knows that -- more (40%) -- security here and privacy here are minimal if they are nt protected. Hackers don't get their legit accounts hacked. period. They know how to create a very difficult to hack password, essentially defeating re-crypt/compare password hackers (ie KC) We find security holes. And the more ethical of us report them. See, i know that if I break into a system, that I will not destroy it or damage it in any way. However, there seem to me more and more of the malicious type of hacker around (especially in the Mondo 2000 crowd) and I think that if one of these folks found himself with free reign on a UNIX, they would probably take it down. This is unethical. So more often than not, I report to the root account (often mailed from the root account) how I got in, and (if I know) how to fix that hole. I also give them a fidonet address that they can mail to to reach me (it often changes) More often than not, I get 'thank you' letters in the box (this is for the letters I get, most systems don't respond) from sysadmins, and occasionally an offer of an account on the system. So what are the hacker's ethics? Ill give you a list of mine... 1. Information should be shared 2. Don't destroy anything, except possibly to cover your tracks 3. If a security hole is being exploited in a bad manner (used to crash -- more (83%) -- a system or to FSP wares) then close the hole. 4. Wares are not important, and do not belong on the net, get them from a local BBS 5. If someone makes a great effort to hide something, its probably worth looking at. 6. When you get busted, don't squeal on your friends. 7. "Ill respect your privacy when you stop trying to hide things from the public" 8. If you find the slolution to World Peace somewhere on the net share it! -Tox [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 248 of 447 Subject: Re: Hacker Beginings From: sheldon (Jeremy Day) Date: Sun, 10 Jan 93 16:37:22 EST In-Reply-To: Well, yeah, my humble beginnings in what I consider "hacking" had nothing at all to do with any ethical questions. There was no question of where to "start" hacking, either, it just doesn't work that way for me. I was in spirit a hacker right from the time I started getting into computers and modems, not knowing that much about anything but willing to experiment to learn. The board I was on had a call forwarding setup between two or three towns that I learned to use for my advantage. The point is not what I did (trivial) but that I just got in there and figured it out. I'm still doing that, just on a different level, it's the same thing. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 249 of 447 Subject: Re: Hacker Beginings From: sheldon (Jeremy Day) Date: Sun, 10 Jan 93 16:48:53 EST toxic (Toxic Avenger) writes: > 4. Wares are not important, and do not belong on the net, get them from > a local BBS Hmm. I would if I could, sure (there IS no good local bbs here) but I don't see why it's actually unethical to get that stuff on the net. It's not as important as a lot of other things, I agree, but I don't think that just because wares "don't belong on the net" in your idealized picture of what the net should be that I should stop taking advantage of the fact that they're there. Oh well. I agree entirely with the rest of your list there. I don't knowif the ethical problems involved are more complex than the ones people deal with all the time, but they are certainly different enough to potentially create -- more (95%) -- misunderstandings. [ Area: CyberSpace / Forum: Ethics ] [Return] 1-447, [Q]uit: Post: 250 of 447 Subject: Re: Hacker Beginings From: ozone (Al Macey) Date: Sun, 10 Jan 93 17:39:33 EST In-Reply-To: <74k7wB2w165w@mindvox.phantom.com> I never really hacked much, having spent most of my time exploring the phone system in beautiful Rochester, MN. I don't think I ever cared about ethics: I didn't think I would ever get caught abusing codes or dialing